A method for constructing a MYH11 gene knockout mouse model and its application

Abstract

The present invention relates to the technical field of animal model construction, and in particular to a method for constructing a MYH11 gene knockout mouse model and its application. The construction method involves a gRNA combination, including gRNA1: 5'-CAGGGGTCCTAACCTTATATAGG-3', gRNA2: 5'-TGTGTGCGCTGAAGAGGTACTGG-3'. The present invention conditionally knocks out a specific site of exon 3 of the MYH11 gene, generates a double-strand break, forces cells to perform emergency repair, and then realizes a deletion mutation of the MYH11 gene, with a high knockout efficiency.

Description

Technical Field

[0001] The present invention relates to the technical field of animal model construction, and in particular to a method for constructing a MYH11 gene knockout mouse model and an application thereof. Background Art

[0002] Smooth muscle myosin heavy chain (SMMHC) is encoded by the Myh11 gene, located on chromosome 16, and consists of 1972 amino acids. SMMHC is also known as "SM-MHC" (smooth muscle-myosin heavy chain, SM-MHC) or "MYH11" (myosin heavy polypeptide 11, MYH11). MYH11 is an important marker in the contraction process of vascular smooth muscle cells (VSMCs), and plays an important role in muscle physiology and smooth muscle contractile function. Its selective overexpression can accelerate the contraction of airway smooth muscle, thereby causing respiratory diseases such as asthma. Myh11 gene mutations can cause many tumor-related diseases. For example, missense mutations and frameshift mutations of the Myh11 gene can lead to intestinal tumors and abdominal aortic aneurysms. MYH11 can regulate the invasion and metastasis of bladder urothelial carcinoma and uterine fibroids by regulating extracellular signaling pathways. MYH11 mutations often lead to acute myeloid leukemia (AML) and vascular diseases, such as thoracic aortic aneurysms / dissection (TAAD) and patent ductus arteriosus (PDA). Myh11 gene mutations in AML patients are one of the main causes of leukemia.

[0003] Spermatogenesis is a complex differentiation process that depends largely on the dynamic changes of the cytoskeleton and the role of motor proteins. The cytoskeleton system controls the morphology of cells and is composed of microfilaments, microtubules and intermediate filaments. Myosin is an ATP hydrolase that can convert the chemical energy on ATP into mechanical energy to generate the energy required for movement. Myosin is involved in acrosome formation, vesicle transport, gene transcription and nuclear formation. Actin and Myosin cooperate to promote spermatogenesis during spermatogenesis. They influence each other and jointly control the process of cell migration. The walls of male seminiferous tubules contain contractile smooth muscle-like peritubular cells, which are considered to be important cells for sperm transport. Studies have shown that the loss of MYH11 in the peritubular cells of most men with impaired spermatogenesis leads to a decrease in the contractile ability of peritubular cells, resulting in a decrease in male fertility. Therefore, MYH11 also plays an important role in the development of the male reproductive system.

[0004] The gene knockout animal model is a new technology developed in the fields of life science research and medical research in recent years. There are currently no research reports on how the MYH11 gene is involved in regulating the molecular mechanisms related to spermatogenesis and male infertility. Summary of the invention

[0005] In order to solve the problems existing in the prior art, the present invention provides a method for constructing a MYH11 gene knockout mouse model and its application. The obtained animal model can be used to further explore the biological function of the MYH11 gene and the pathogenic mechanism of diseases related to smooth muscle contraction defects.

[0006] In a first aspect, the present invention provides a gRNA combination, comprising:

[0007] gRNA1: 5'-CAGGGGTCCTAACCTTATATAGG-3',

[0008] gRNA2: 5'-TGTGTGCGCTGAAGAGGTACTGG-3'.

[0009] The present invention further provides a kit comprising the gRNA combination.

[0010] The present invention further provides the use of the gRNA combination or the kit in constructing a MYH11 gene systemic knockout mouse model.

[0011] In a second aspect, the present invention provides a method for constructing a MYH11 gene knockout mouse model, comprising:

[0012] Exon 3 of the MYH11 gene was used as the knockout site for systemic knockout.

[0013] Furthermore, the gRNA combination is used to conditionally knock out the MYH11 gene.

[0014] Furthermore, the construction method includes: injecting the gRNA combination and Cas9 nuclease into a mouse fertilized egg.

[0015] Furthermore, after the knockout, the method further includes identifying the mice by using a primer combination to determine their genotype;

[0016] The primer combination comprises:

[0017] F1:5'-TTTCAGCGGCATCTCTAGTTGT-3',

[0018] R1:5'-TTGCTCATTCACAGTCACATAGCC-3',

[0019] F2:5'-CCATTGTGGTTTCACGTTTGGAC-3'.

[0020] The present invention further provides application of the construction method in constructing a reproductive system disease mouse model, a non-small cell lung cancer disease mouse model, an aortic aneurysm disease mouse model, a muscular system disease model or a urinary system disease mouse model.

[0021] The present invention has the following beneficial effects:

[0022] The present invention designs a pair of gRNA combinations for a specific site in exon 3 of the MYH11 gene. After the gRNA combination and Cas9 nuclease are injected into mouse fertilized eggs, the MYH11 gene can be systemically knocked out with a high knockout efficiency, which is of great significance in the field of studying the functions related to the MYH11 gene. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is a flow chart of the method for constructing Myh11 gene knockout mice provided in Example 1 of the present invention.

[0024] Figure 2 This is a ratio distribution diagram of the four bases in the KO region provided in Example 1 of the present invention.

[0025] Figure 3 This is a schematic diagram of the similarity analysis results of BLAST comparison of the 3000 bp upstream and downstream sequences of the KO region provided in Example 1 of the present invention with the mouse genome.

[0026] Figure 4 This is a diagram of the Myh11 gene knockout target site construction provided in Example 1 of the present invention.

[0027] Figure 5The genotype of the Myh11 gene knockout site in heterozygous mice was detected, and a total of 2282bp bases were knocked out.

[0028] Figure 6 This is a diagram showing the genotype detection results of the Myh11 gene knockout site in the knockout mice provided in Example 1 of the present invention.

[0029] Figure 7 This is a schematic diagram of the testicular pathological changes of KO heterozygous and wild-type mice provided in Example 1 of the present invention.

[0030] Figure 8 This is a schematic diagram of the results of pathological changes in lung tissues of KO heterozygous and wild-type mice provided in Example 1 of the present invention.

[0031] Fig. 9 The present invention provides the results of pathological changes in the thoracic aorta of KO heterozygous and wild-type mice in Example 1.

[0032] Fig.10 A schematic diagram of the pathological changes in the pectoral muscle tissue of KO heterozygous and wild-type mice is provided for Example 1 of the present invention.

[0033] Fig.11 The present invention provides a schematic diagram of the results of pathological changes in the bladder tissues of KO heterozygous and wild-type mice in Example 1. DETAILED DESCRIPTION

[0034] The following examples are used to illustrate the present invention but are not intended to limit the scope of the present invention.

[0035] Example 1

[0036] This embodiment provides a method for constructing a Myh11 gene knockout mouse. Figure 1 As shown, the specific process includes the following:

[0037] 1. MYH11 gene gRNA target sequence design and vector construction

[0038] The MYH11 gene (NCBI reference sequence: NM_001161775; ENSEMBL: ENSMUSG00000018830) is located on mouse chromosome 16 and has 41 exons (transcript: ENSMUST00000090287). The present invention found that exon 3 is located in the 5.85% region of the coding region, and its deletion will cause a frameshift mutation in the MYH11 gene; and the exon 3 region of the MYH11 gene does not belong to other genes, and will not cause sequence deletions in other genes after knockout; therefore, exon 3 of the MYH11 gene is evaluated to be the site of action with the highest knockout efficiency and the lowest off-target probability, and is selected as the knockout region (KO region), and the evaluation data is shown in Figure 2and Figure 3 . The deletion of the KO region should result in the loss of function of the mouse MYH11 gene. Cas9 endonuclease (Cat. No.: #M0386M) was purchased from NEB (Beijing) Co., Ltd. It is an RNA-mediated endonuclease that can catalyze the cutting of specific sites of double-stranded DNA. gRNAs were designed at both ends of exon 3 of the MYH11 gene, where (SEQ ID NO.1-2):

[0039] gRNA1 sequence: CAGGGGTCCTAACCTTATATAGG;

[0040] gRNA2 sequence: TGTGTGCGCTGAAGAGGTACTGG.

[0041] The above-mentioned gRNA combination and Cas9 nuclease were co-injected into mouse fertilized eggs to create mice with knockout of exon 3 sequence of MYH11 gene.

[0042] 2. Knockout mouse strain establishment process

[0043] The F0 offspring obtained after pronuclear injection were bred and mated with wild-type mice after PCR identification to produce F1 heterozygous mice; after further breeding, homozygous mice with MYH11 gene knockout were obtained, which can achieve the knockout of MYH11 gene in systemic tissues.

[0044] 3. Genotype identification of knockout mice

[0045] For F2 generation and later breeding mice, the knockout target site was constructed Figure 4 Primers were designed at the positions shown to identify the KO gene region. Primers F1, F2 and R1 were designed according to the knockout target construction map above, and a two-step PCR method was used to identify whether the mouse was homozygous or heterozygous for gene knockout, or wild type. The primer sequences are as follows.

[0046] PCR primer sequences (Annealing Temperature 60.0°C) (SEQ ID NO.3-5):

[0047] Forward primer(F1):5'-TTTCAGCGGCATCTCTAGTTTGT-3',

[0048] Reverse primer(R1):5'-TTGCTCATTCACAGTCACATAGCC-3',

[0049] Reverse primer(F2):5'-CCATTGTGGTTTCACGTTTGGAC-3'.

[0050] The first step is PCR: When identifying the genotype of the knockout mouse offspring, PCR is first performed using the genome as a template with the help of F1 and R1 primers. Both suspected homozygous and suspected heterozygous mice can produce a 494bp fragment band, while wild-type mice do not produce any band.

[0051] The second step is PCR: the genome of the knockout mouse offspring is subjected to PCR using primers F2 and R1. No band is produced in the KO homozygous mouse; the target sequence product length of the wild-type mouse and heterozygous mouse is 489 bp.

[0052] Figure 5 The genotype of the Myh11 gene knockout site in heterozygous mice was detected, and a total of 2282bp bases were knocked out.

[0053] No homozygous individuals were obtained during the breeding process. Figure 6 The two-step genotype detection result diagram of the Myh11 gene knockout site for 12 knockout breeding mice provided in Example 1 of the present invention is shown. Each mouse to be tested has a set of PCR electrophoresis result diagrams, and each set of electrophoresis diagrams includes two lanes, lane 1 is the electrophoresis result of the first step PCR (F1+R1), and lane 2 is the electrophoresis result of the second step PCR (F2+R1). The PCR identification results of the mice to be tested show that the mice with serial numbers 506, 507, 509, 511, and 512 are KO heterozygotes, and the rest are wild types.

[0054] 4. Analysis of tissue differences in knockout mice

[0055] The present invention compared the tissue differences between KO mice and wild-type mice and found that the male reproductive system, urinary system, lung tissue and blood vessels all had developmental abnormalities. The specific results are as follows Figure 7-Figure 11 shown.

[0056] Figure 7 The results of HE staining of testicular tissues of KO heterozygous and wild-type mice. The testicular tissue structure of wild-type mice is normal, the seminiferous epithelium and basement membrane are intact, the seminiferous tubules are closely arranged, the morphology is clear, the boundaries are complete, the upgraded cells at all levels are clearly layered, and the interstitial cells are evenly arranged. As can be seen from the upper right picture, the seminiferous tubules of KO heterozygous mice have incomplete boundaries (upper right triangle), the seminiferous epithelium is separated from the basement membrane (upper left triangle), the spermatogenic cells are arranged irregularly (lower left triangle), and the layers are unclear; from the lower right picture, it can be seen that vacuoles are formed (arrows) and the lumen of the seminiferous tubules is narrow.

[0057] Figure 8HE staining results of lung tissues of KO heterozygotes and wild-type mice, in which the airway lumen of wild-type mouse lung tissue is smooth, with clear structure and no hyperplasia of the airway septum. The airway wall of KO heterozygotes is thickened, with cilia falling off the epithelium (triangle in the upper right picture), airway deformity (triangle in the lower right picture), and thickening of the airway septum.

[0058] Fig. 9 The HE staining results of the thoracic aorta of KO heterozygous and wild-type mice show that the inner, middle and outer three-layer wall structure of the wild-type mouse thoracic aorta is intact, the wall thickness is uniform, and the vascular smooth muscle cells are clearly visible and arranged neatly. The wall structure of the thoracic aorta of KO heterozygous mice is incomplete, the intima is thickened, the decomposition of each layer is not obvious, the smooth muscle cells are disordered, the elastic fibers are broken, and obvious aortic dissection can be seen (the triangle in the figure).

[0059] Fig.10 The HE staining results of the pectoral muscle tissue of KO heterozygous and wild-type mice show that the muscle bundle structure of wild-type mice is dense and smooth, and the muscle bundles are arranged regularly; the muscle bundles of KO heterozygous mice are arranged disorderly, the muscle bundle structure is loose, and they show varying degrees of atrophy.

[0060] Fig.11 The HE staining results of bladder tissues of KO heterozygous and wild-type mice show that the bladder of wild-type mice has a regular structure, complete mucosal folds, and neatly arranged smooth muscles; the bladder volume of KO heterozygous mice is increased, the bladder wall is significantly thinned, the mucosal barrier is thinned, the mucosal folds disappear, and the number of smooth muscle layers is reduced.

[0061] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements may be made thereto based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention. Sequence Listing <110> Inner Mongolia Medical University <120> A method for constructing a MYH11 gene knockout mouse model and its application <130> KHP211123919.9 <160> 5 <170> SIPOSequenceListing 1.0 <210> 1 <211> twenty three <212> DNA <213> Artificial Sequence <400> 1 caggggtcct aaccttatat agg 23 <210> 2 <211> twenty three <212> DNA <213> Artificial Sequence <400> 2 tgtgtgcgct gaagaggtac tgg 23 <210> 3 <211> twenty three <212> DNA <213> Artificial Sequence <400> 3 tttcagcggc atctctagtt tgt 23 <210> 4 <211> twenty four <212> DNA <213> Artificial Sequence <400> 4 ttgctcattc acagtcacat agcc 24 <210> 5 <211> twenty three <212> DNA <213> Artificial Sequence <400> 5 ccattgtggt ttcacgtttg gac 23

Claims

1. A gRNA combination for constructing a MYH11 gene systemic knockout mouse model, characterized in that: include: gRNA1: 5'-CAGGGGTCCTAACCTTATATAGG-3', gRNA2: 5'-TGTGTGCGCTGAAGAGGTACTGG-3'.

2. A kit, characterized in that: The kit comprises the gRNA combination of claim 1.

3. Use of the gRNA combination according to claim 1 or the kit according to claim 2 in constructing a MYH11 gene systemic knockout mouse model.

4. A method for constructing a MYH11 gene knockout mouse model, characterized in that: include: Exon 3 of the MYH11 gene is used as a knockout site, and the gRNA and Cas9 nuclease described in claim 1 are injected into mouse fertilized eggs for conditional knockout; The F0 offspring were identified by PCR and mated with wild-type mice. The resulting F1 heterozygous mice were bred to obtain MYH11 gene knockout mice.

5. The construction method according to claim 4, characterized in that: The mice were identified by primer combinations to determine their genotypes; The primer combination comprises: F1:5'-TTTCAGCGGCATCTCTAGTTGT-3', R1:5'-TTGCTCATTCACAGTCACATAGCC-3', F2:5'-CCATTGTGGTTTCACGTTTGGAC-3'.

Images