A kit and detection method for rapid detection of gene variants based on lit-type click-link probes.

Abstract

This invention belongs to the field of gene detection technology, specifically relating to a kit and detection method for rapid detection of gene variations based on click chemistry and a light-up click ligation probe. The light-up click ligation probe in the kit consists of two oligonucleotide fragments, head-to-tail linked and complementary to the target sequence: a 5'-terminal oligonucleotide fragment and a 3'-terminal oligonucleotide fragment complementary to the target sequence. Both the 3'-end of the 5'-terminal oligonucleotide fragment and the 5'-end of the 3'-terminal oligonucleotide fragment are labeled with click chemistry functional groups. When the target sequence is present, during nucleic acid amplification, the target sequence triggers a click chemistry reaction, and the light-up click ligation probe, complementary to the target sequence, releases a fluorescent signal, enabling real-time parallel synchronous detection of wild-type and mutant genes of the target gene in a single reaction tube or at a single detection point. This invention is applicable to various nucleic acid amplification technologies and possesses the ability to accurately identify single-base variations.

Description

Technical Field

[0001] This invention relates to the field of gene detection technology, specifically to a kit and detection method for rapid detection of gene variations based on a lit-type click-link probe. Background Technology

[0002] Gene variations include point mutations caused by a single base change, single nucleotide polymorphisms (SNPs), deletion or insertion mutations, mutations, deletions or insertions of two or more bases, and gene fusions of two or more genes. Currently, routine gene variation detection typically requires nucleic acid amplification methods that rely on DNA polymerases, with temperature-dependent PCR being the most commonly used method.

[0003] In recent years, bioorthogonal reactions based on click chemistry have attracted much attention. Click chemistry, also known as linker chemistry, can be achieved under physiological conditions and is a rapid and efficient coupling reaction based on carbon-heteroatom bonds, exhibiting good biocompatibility. Click chemistry has been used in research on oligonucleotide labeling and linking. Two typical click chemistry reactions are: one involves the reaction of azides and alkynes to form a covalent bond, producing a highly stable 1,4-disubstituted-1,2,3-triazole that can complete the reaction in 1 minute; the other involves the rapid and efficient inverse electron-demand Diels-Alder reaction (IEDDA) between tetrazides and cyclic alkenes (or cyclic alkynes), generating stable click linker products with reaction rates as high as 10⁻⁶. 6 L·mol -1 ·s -1 .

[0004] Click-linking reactions are highly sensitive to complementary base pairing and exhibit extremely high sequence specificity: when no target sequence is present, free collisions between azide and alkyne groups, or between tetrazine and cyclic alkenes (or cyclic alkynes), result in very low linking efficiency and negligible background signal. Rapid and efficient click-linking reactions occur only when a specific complementary target sequence is present. Genetic mutations can suppress this reaction. Another characteristic of these reactions is that coupling an azide or tetrazine to a fluorescent reporter group quenches its fluorescence. However, by clicking-linking with a matching click chemical functional group (alkynyl or cyclic alkene (or cyclic alkyne), the structure of the azide or tetrazine is disrupted, eliminating its quenching effect on the coupled fluorescent reporter group and restoring its fluorescence properties, thus enabling it to "turn on" or "enhance" fluorescence.

[0005] Considering that during nucleic acid amplification, the target sequence to be detected will be replicated or amplified in a large number of times in an exponential or linear manner under the action of DNA and / or RNA polymerase, if a click-linking probe as described in this invention is added to the nucleic acid reaction system, then, on the one hand, the ability of the probe to identify single-base variations can be used to achieve real-time fluorescence detection of gene variations; on the other hand, the click-linking reaction and the nucleic acid amplification reaction occur simultaneously, enabling single-tube parallel detection of wild-type and mutant genes; furthermore, the above reaction can also be carried out under solid-phase conditions. Under these conditions, compared with traditional solid-phase amplification, no subsequent hybridization and washing steps are required, and real-time fluorescence or endpoint fluorescence detection of gene variations can be achieved in one step. Summary of the Invention

[0006] In view of this, one objective of the present invention is to provide a kit for rapid detection of gene mutations based on a lit-type click-link probe; another objective of the present invention is to provide a detection method for rapid detection of gene mutations based on a lit-type click-link probe.

[0007] To achieve the above objectives, the present invention provides the following technical solution:

[0008] A kit for rapid detection of gene mutations based on a light-up click-link probe, specifically, during the nucleic acid amplification reaction, achieves qualitative and quantitative (or semi-quantitative) detection of the genotype of the target sequence by real-time monitoring or endpoint detection of the type and intensity of the fluorescence signal released by the light-up click-link probe. The kit includes the following reaction components:

[0009] ① Upstream and downstream primers;

[0010] ② A set of lit-up click-link probes: to identify the wild-type and mutant sequences of the gene to be tested;

[0011] ③ The nucleic acid template to be tested;

[0012] ④ Deoxyribonucleotide triphosphates (dNTPs), including dATP, dTTP, dCTP, and dGTP;

[0013] ⑤ Other enzymes, cofactors (e.g., single-stranded DNA binding proteins), ions, and buffer systems required for nucleic acid amplification;

[0014] The reaction mixture of the reactants can be carried out under either constant temperature or variable temperature conditions.

[0015] The lit-up click linkage probe consists of two oligonucleotide fragments that are complementary to the target sequence to be detected, namely a 5'-terminal oligonucleotide fragment and a 3'-terminal oligonucleotide fragment that are complementary to the target sequence.

[0016] The lit-up click connection probe can be used to identify and detect point mutations, SNPs, insertions or deletions caused by a single base variation, or mutations, insertions or deletions caused by two or more base variations, or gene fusions of two or more genes.

[0017] For different types of gene mutations, the lit-up click-link probe has the following essential characteristics:

[0018] For the aforementioned illuminated click linker, the recognition site for the gene variant base is located at any one of the 3' end, 5' end, or middle position of the 5'-end oligonucleotide fragment of the illuminated click linker; or, the recognition site for the variant base is located at any one of the 5' end, 3' end, or middle position of the 3'-end oligonucleotide fragment of the illuminated click linker.

[0019] For point mutations, SNPs, insertions, or deletions caused by a single base variation: the recognition site of the variant base is located at any position on the 3' end, 5' end, or middle of the 5'-end oligonucleotide fragment of the light-up click-link probe; or, the recognition site of the variant base is located at any position on the 5' end, 3' end, or middle of the 3'-end oligonucleotide fragment of the light-up click-link probe. Preferably, the recognition site of the variant base is located at the 3' end or 1-4 bases from the end of the 3' end of the 5'-end oligonucleotide fragment of the light-up click-link probe; or, the recognition site of the variant base is located at the 5' end or 1-4 bases from the end of the 5' end of the 3'-end oligonucleotide fragment of the light-up click-link probe. Under the above conditions, the 5'-end oligonucleotide fragment or 3'-end oligonucleotide fragment with the variant base recognition site is referred to as a recognition probe in this invention, and the corresponding other oligonucleotide fragment is referred to as a universal probe in this invention. For example, when a 5'-terminal oligonucleotide fragment has a recognition site with a variant base, it is called a recognition probe, while a 3'-terminal oligonucleotide fragment is called a universal probe; and vice versa.

[0020] For gene mutations, insertions, or deletions caused by two or more bases: the recognition site of the variant base is located at any one of the 3' end, 5' end, or middle position of the 5'-end oligonucleotide fragment of the illuminated click-link probe; or, the recognition site of the variant base is located at any one of the 5' end, 3' end, or middle position of the 3'-end oligonucleotide fragment of the illuminated click-link probe. Preferably, the recognition site of the variant base is located at two or more bases at the 3' end of the 5'-end oligonucleotide fragment of the illuminated click-link probe or at two or more bases adjacent to the 3' end; or, the recognition site of the variant base is located at two or more bases at the 5' end of the 3'-end oligonucleotide fragment of the illuminated click-link probe or at two or more bases adjacent to the 5' end. Under the above conditions, the 5'-end oligonucleotide fragment or 3'-end oligonucleotide fragment with the variant base recognition site is referred to as a recognition probe in this invention, and the corresponding other oligonucleotide fragment is referred to as a universal probe in this invention. For example, when a 5'-terminal oligonucleotide fragment has a recognition site with a variable base, it is called a recognition probe, while a 3'-terminal oligonucleotide fragment probe is called a universal probe; and vice versa.

[0021] For fusion genes of two or more genes: the recognition site of the variant base is located at any one of the 3' end, 5' end, or middle position of the 5'-end oligonucleotide fragment of the illuminated click-link probe; or, the recognition site of the variant base is located at any one of the 5' end, 3' end, or middle position of the 3'-end oligonucleotide fragment of the illuminated click-link probe. Preferably, the recognition site of the variant base is located at one or more consecutive base positions at the 3' end, adjacent to the 3' end, or in the middle of the sequence of the 5'-end oligonucleotide fragment of the illuminated click-link probe; or, the recognition site of the variant base is located at one or more consecutive base positions at the 5' end, adjacent to the 5' end, or in the middle of the sequence of the 3'-end oligonucleotide fragment of the illuminated click-link probe. Under the above conditions, the 5'-end oligonucleotide fragment or 3'-end oligonucleotide fragment with the variant base recognition site is referred to as the recognition probe in this invention, and the corresponding other oligonucleotide fragment is referred to as the universal probe in this invention. For example, when a 5'-terminal oligonucleotide fragment has a recognition site with a variable base, it is called a recognition probe, while a 3'-terminal oligonucleotide fragment probe is called a universal probe; and vice versa.

[0022] In special cases, to further enhance the ability of the lit-up click linker probe to identify genotypes, the bases that specifically identify the variant sequence of the target gene can be designed simultaneously into the 5'-end oligonucleotide fragment and the 3'-end oligonucleotide fragment of the lit-up click linker probe. In this case, both the 5'-end oligonucleotide fragment and the 3'-end oligonucleotide fragment are referred to as recognition probes, and there is no universal probe.

[0023] To achieve real-time fluorescence detection or endpoint fluorescence interpretation of wild-type and mutant genes of the target gene, the design and labeling scheme of the lit-up click-link probe has two options:

[0024] Option 1: For the 5'-terminal oligonucleotide fragment of the light-type click ligation probe, a click chemical functional group A and a fluorescent reporter group are labeled at its 3' end, and the click chemical functional group A has a fluorescence quenching effect on the fluorescent reporter group labeled on the fragment; under this condition, for the 3'-terminal oligonucleotide fragment of the light-type click ligation probe, a click chemical functional group B is labeled at its 5' end, and the 3'-hydroxyl (-OH) of the 3'-terminal base is labeled with a blocking group to prevent the 3'-terminal oligonucleotide fragment from being used as a primer for extension during amplification.

[0025] Option 2: For the 5'-terminal oligonucleotide fragment of the light-type click ligation probe, label the 3' end with click chemical functional group B; under this condition, for the 3'-terminal oligonucleotide fragment of the light-type click ligation probe, label the 5' end with click chemical functional group A and a fluorescent reporter group in the 5'>3' direction, and the click chemical functional group A has a fluorescence quenching effect on the fluorescent reporter group labeled on the fragment. The 3'-OH of the 3'-terminal base is labeled with a blocking group to prevent the 3'-terminal oligonucleotide fragment from being extended as a primer during amplification.

[0026] In Scheme 1 and Scheme 2, when the 3'-OH of the 3'-terminal base of the 5'-terminal oligonucleotide fragment of the light-type click ligation probe is not blocked by a labeling group, a blocking group needs to be labeled on the 3'-OH of its 3'-terminal base to prevent the 5'-terminal oligonucleotide fragment from being extended as a primer during amplification.

[0027] In Scheme 1 and Scheme 2, there are two coupling methods between the click chemical functional group A and the fluorescent reporter group: the first is a tandem type, that is, the click chemical functional group A and the fluorescent reporter group are directly connected in a linear manner; the second is a "Y" type, that is, the click chemical functional group A and the fluorescent reporter group are simultaneously labeled on the 3'-terminal base of the 5'-terminal oligonucleotide fragment, or the click chemical functional group A and the fluorescent reporter group are simultaneously labeled on the 5'-terminal base of the 3'-terminal oligonucleotide fragment.

[0028] When the lit-up click ligation probe of the present invention is present in the nucleic acid amplification system, a very rapid and efficient click chemical ligation reaction can only occur between the click chemical functional groups A and B during the nucleic acid amplification reaction, and when the 5'-terminal oligonucleotide fragment and the 3'-terminal oligonucleotide fragment of the lit-up click ligation probe simultaneously pair with the target gene in a head-to-tail linkage mode to form a double-stranded nucleic acid molecule. After the click chemical ligation reaction occurs, the fluorescence quenching effect of the click chemical functional group A on the fluorescent reporter group labeled on the oligonucleotide fragment disappears, and the fluorescent reporter group releases a fluorescent signal.

[0029] In practical applications, based on the wild-type and mutant gene sequence characteristics of the target gene, a light-up click-link probe complementary to the wild-type gene sequence and a light-up click-link probe complementary to the mutant gene sequence are designed and used in the nucleic acid amplification reaction system. Furthermore, the 5'-terminal or 3'-terminal oligonucleotide fragments of the light-up click-link probes corresponding to different genotypes are labeled with different fluorescent groups. The wild-type and mutant genes and their abundance can be specifically identified by the type and intensity of the fluorescence signals released by different fluorescent reporter groups. The fluorescence detection method can be either real-time fluorescence, which monitors the type and intensity of fluorescence in real time during the nucleic acid amplification reaction, or fluorescence endpoint method, which directly detects the type and intensity of fluorescence in the reaction system after the nucleic acid amplification reaction is completed.

[0030] Furthermore, the 5'-terminal or 3'-terminal oligonucleotide fragments of the click-linked probes for detecting different mutant gene sequences can be labeled with different fluorescent reporter groups. The different mutant gene sequences and their abundances of the target gene can be specifically identified by the type and intensity of the fluorescence signals released by different fluorescent reporter groups. The fluorescence detection method can be either real-time fluorescence, which monitors the type and intensity of fluorescence in real time during the nucleic acid amplification reaction, or fluorescence endpoint method, which directly detects the type and intensity of fluorescence in the reaction system after the nucleic acid amplification reaction is completed.

[0031] In this invention, in the nucleic acid amplification system, the oligonucleotide fragment that specifically recognizes the wild-type or mutant sequence of the target gene is called a recognition probe. This probe can be the 5'-end oligonucleotide fragment or the 3'-end oligonucleotide fragment of the lit-up click-link probe. In this case, the other oligonucleotide sequence constituting the lit-up click-link probe is called a universal probe. For example, when the 5'-end oligonucleotide fragment of the lit-up click-link probe is a recognition probe, its 3'-end oligonucleotide fragment is called a universal probe, and vice versa. The bases that specifically recognize the variant sequence of the target gene are designed into the recognition probe sequence, while the universal probe sequence is complementary to the sequence common to both wild-type and mutant genes.

[0032] The click chemical functional groups A and B of the 5'-terminal or 3'-terminal oligonucleotide fragment labeled in the click-link probe of this invention can utilize a pair of click chemical functional groups known in the art to which this invention pertains, capable of undergoing a very rapid and efficient click-link reaction. Preferably, click chemical functional groups A and B can be an azide group and an alkynyl group, respectively; or, click chemical functional groups A and B can be a tetrazine group and a cyclic alkene or cyclic alkyne group, respectively. Under these conditions, click chemical functional group A exhibits a fluorescence quenching effect on the fluorescent reporter group labeled with its associated oligonucleotide fragment. However, after the click-link reaction between click chemical functional groups A and B, the original structure of click chemical functional group A is destroyed, the aforementioned quenching effect disappears, and the click-link probe releases a fluorescent signal.

[0033] The fluorescent reporter group labeled at the 3' end of the 5'-terminus or the 5'-terminus of the 3'-terminus oligonucleotide fragment of the luminescent click-link probe described in this invention is not specifically required. Preferred options include carboxyfluorescein (6-FAM), hexachlorofluorescein (HEX), tetrachlorofluorescein (TET), JOE, VIC, fluorescein isothiocyanate (FITC), indoledicarboxycyanine (Cy3, Cy5), TAMRA, and ROX, as well as other fluorescent molecules or luminescent groups known in the technical field to which this invention pertains.

[0034] Furthermore, the fluorescent reporter group is a fluorescent substance, which can be any substance known in the technical field to which this invention pertains, specifically including: Cy2 TM (506), YO-PRO TM -1(509), YOYO TM -1(509)、Calcein(517)、FITC(518)、FluorX TM (519) Alexa TM (520), Rhodamine110(520), Oregon Green TM 500(522), Oregon Green TM 488(524), RiboGreen TM (525), Rhodamine Green TM (527), Rhodamine 123(529), MagnesiumGreen TM (531), Calcium Green TM (533), TO-PRO TM-1(533), TOTO1(533), JOE(548), BODIPY530 / 550(550), Dil(565), BODIPYTMR(568), BODIPY558 / 568(568), BODIPY564 / 570(570), Cy3TM(570), Alexa TM 546(570), TRITC(572), Magnesium Orange TM (575), Phycoerythrin R&B(575), RhodaminePhalloidin(575), Calcium Orange TM (576), Pyronin Y (580), Rhodamine B (580), TAMRA (582), Rhodamine RedTM (590), Cy3.5TM (596), ROX (608), Calcium Crimson TM (615), AlexaTM 594(615), Texas Red(615), Nile Red(628), YO-PROTM-3(631), YOYOTM-3(631), R-phycocyanin(642), C-Phycocyanin(648), TO-PRO TM -3(660), TOTO3(660), DiD DilC(5)(665), Cy5 TM (670), Thiadicarbocyanine (671), Cy5.5 (694), HEX (556), TET (536), Biosearch Blue (447), CALFluor Gold 540 (544), CAL Fluor Orange 560 (559), CALFluor Red 590 (591), CAL Fluor Red 610 (610), CAL Fluor Red 635 (637), FAM (520), Fluorescein (520), Fluorescein-C3 (520), Pulsar 650 (566), Quasar 570 (667), Quasar 670 (705), and Quasar 705 (610). The numbers in parentheses above are the maximum emission wavelengths in nanometers.

[0035] Furthermore, there are no specific requirements for the blocking groups labeled on the 5'-end or 3'-end oligonucleotide fragments of the click-link probe described in this invention. Any substance known in the technical field of this invention that blocks the 3'-OH of the 5'-end or 3'-end oligonucleotide fragments can be used. Its function is to prevent the 5'-end or 3'-end oligonucleotide fragments from triggering the extension reaction as primers in the nucleic acid amplification system. The preferred embodiments include labeling the 3'-end base of the 5'-end or 3'-end oligonucleotide fragment with a phosphate group, an amino group, polyhexanediol (PEG), or C3 (a carbon chain of three carbon atoms; C3-Spacer) at the 3'-end base of the 5'-end or 3'-end oligonucleotide fragment. Alternatively, the 3'-end base can be a reverse base or a dideoxynucleotide.

[0036] Furthermore, the 5'-end oligonucleotide fragment or 3'-end oligonucleotide fragment of the lit-up click linking probe of the present invention may be further incorporated with one or more derivative nucleotides to improve its mismatch recognition ability and / or Tm value. Any substance known in the technical field to which this invention pertains may be used, with preferred options including locked nucleic acids (LNA) and peptide nucleic acids (PNA).

[0037] Furthermore, the 5'-end or 3'-end oligonucleotide fragment of the lit-up click ligation probe of the present invention can be further incorporated with one or more mismatched bases or nucleotide derivatives to enhance its mismatch recognition ability. Preferred mismatch options for the mismatched bases are: first, GA, CT, and TT mismatches; second, CC mismatches; third, AA and GG mismatches; and fourth, CA and GT mismatches. Among these four preferred mismatch options, the order of mismatch recognition ability is from preferred options one to four. Nucleotide derivatives may be one or more of the following: deoxyinosine, inosine, 7-deaza-2'-deoxyinosine, 2-aza-2'-deoxyinosine, 2'-methoxyinosine, 2'-F inosine, deoxy 3-nitropyrrole, 3-nitropyrrole, 2'-methoxy 3-nitropyrrole, 2'-OMe3-nitropyrrole, 2'-F3-nitropyrrole. 3-nitropyrrole), 1-(2'-deoxy-β-D-ribofuranosyl)-3-nitropyrrole, deoxy5-nitroindole, 5-nitroindole, 2'-methoxy5-nitroindole, 2'-F5-nitroindole, deoxy4-nitrobenzimidazole, 4-nitrobenzimidazole, deoxy4-aminobenzimidazole, 4-aminobenzimidazole, deoxymethylenetetramine nebularine), 2'-F nebularine, 2'-F4-Nitrobenzimidazole (2'-F4-nitrobenzimidazole), PNA-5-nitroindole, PNA-nebularine, PNA-inosine, PNA-4-nitrobenzimidazole, PNA-3-nitropyrrole, morpholino-5-nitroindole, morpholino-nebularine, morpholino-inosine, morpholino-4-nitrobenzimidazole, morpholino-4-nitrobenzimidazole, morpholino-5-nitroindole, morpholino-nebularine, morpholino-inosine, morpholino-4-nitrobenzimidazole, morpholino-5-nitroindole ...5-nitroindole, morpholino-nebularine, morpholino-inosine, morpholino-4-nitrobenzimidazole, morpholino-5-nitroindole, morpholino-5-nitroindole, morpholino-5-nitroindole, morpholino-5-nitroindole, morpholino-5-nitroindole, morpholino-5-nitroindole, morpholino-5 Morphyrino-3-nitropyrrole, phosphoramidate-5-nitroindole, phosphoramidate-nebularine, phosphoramidate-inosine, phosphoramidate-4-nitrobenzimidazole, phosphoramidate-3-nitropyrrole, 2'-O-methoxyethylinosine, 2'-O-methoxyethyl The probes used in this study include nebularine, 2'-O-methoxyethyl 5-nitroindole, 2'-O-methoxyethyl 4-nitro-benzimidazole, and 2'-O-methoxyethyl 3-nitropyrrole. Furthermore, it is possible to introduce one or more commonly used bases without requiring nucleotide derivatives, significantly reducing the cost of probe synthesis.

[0038] There is no specific requirement for the length of the lit-up click ligation probe, but the preferred option is that the lengths of the 5'-terminal oligonucleotide fragment and the 3'-terminal oligonucleotide fragment of the lit-up click ligation probe are in the range of 10-50 nt.

[0039] There are no specific requirements for the GC content of the lit-up click ligation probe, but the preferred option is that the GC content of the 5'-terminal oligonucleotide fragment and the 3'-terminal oligonucleotide fragment of the lit-up click ligation probe is in the range of 20%-80%.

[0040] The nucleic acid amplification reaction can be either isothermal amplification at a single reaction temperature, including recombinase polymerase amplification (RPA), chain displacement amplification (SDA), loop-mediated isothermal amplification (LAMP), rolling circle amplification (RCA), and isothermal exponential amplification (EXPAR), or temperature-variable amplification represented by polymerase chain reaction (PCR), with RPA being the preferred option.

[0041] The present invention provides a method for rapid detection of gene mutations based on click chemical linkage, wherein the detection is performed using the kit described in any of the above claims;

[0042] The nucleic acid amplification reaction for detection can be implemented in two specific ways: liquid-phase nucleic acid amplification and solid-phase nucleic acid amplification.

[0043] One implementation method is liquid-phase nucleic acid amplification, characterized by employing a traditional liquid-phase reaction in a PCR-like reaction tube. Under these conditions, the type and intensity of fluorescence signals can be monitored in real time during the nucleic acid amplification reaction, enabling qualitative and quantitative detection of wild-type and mutant genes, as well as different types of mutant genes. Furthermore, after the nucleic acid amplification reaction is completed, the type and intensity of the terminal fluorescence signal in the reaction system can be directly detected, enabling qualitative and semi-quantitative detection of wild-type and mutant genes, as well as different types of mutant genes.

[0044] Implementation method two is solid-phase nucleic acid amplification, characterized in that: when the universal probe is a 5'-terminal oligonucleotide fragment of a light-up click-link probe, an additional polybase known in the art of this invention is added to the 5'-terminus of this fragment, preferably poly(A) or poly(T), with a length preferably 5-25 nt. Then, the 5'-terminus of poly(A) or poly(T) is immobilized onto a solid support using a biocrosslinking technique and method known in the art of this invention; or, when the universal probe is a 3'-terminal oligonucleotide fragment of a light-up click-link probe, an additional polybase known in the art of this invention is added to the 3'-terminus of this fragment, preferably poly(A) or poly(T). The poly(A) or poly(T) probe is preferably 5-25 nt in length. Then, using biocrosslinking techniques and methods known in the technical field of this invention, the 3'-end of poly(A) or poly(T) is fixed onto a solid support; or, the recognition probe is fixed onto a solid support according to the above method. Under these conditions, the type and intensity of fluorescence signals can be monitored in real time during the nucleic acid amplification reaction, enabling qualitative and quantitative detection of wild-type and mutant genes, as well as different types of mutant genes. After the nucleic acid amplification reaction is completed, the type and intensity of the terminal fluorescence signal of the reaction system can be directly detected without additional incubation, hybridization, washing, or other steps, enabling qualitative and semi-quantitative detection of wild-type and mutant genes, as well as different types of mutant genes.

[0045] In the nucleic acid amplification system, apart from the upstream primer, downstream primer, light-up click ligation probe, and nucleic acid template to be tested, other components can be commercially available reagents, or they can be prepared by using isothermal amplification and variable-temperature amplification techniques and related reagent formulations known in the technical field of this invention.

[0046] The upstream and downstream primers in the nucleic acid amplification system can be designed and used independently using isothermal amplification and variable-temperature amplification techniques known in the technical field of this invention.

[0047] The nucleic acid template to be tested in the nucleic acid amplification system can be either a nucleic acid template extracted or prepared using techniques known in the technical field of this invention, or it can be a raw sample without a nucleic acid extraction step, such as saliva, urine, or cerebrospinal fluid, used to replace the nucleic acid template to be tested. The gene variation of the target gene to be tested is detected using a direct nucleic acid amplification method known in the technical field of this invention.

[0048] The nucleic acid template to be tested in the nucleic acid amplification system can be either a DNA-based nucleic acid template or an RNA-based nucleic acid template.

[0049] There are no specific requirements for the temperature of the nucleic acid amplification reaction. The preferred option is a reaction temperature range of 25-95℃. A further preferred option is isothermal amplification at any single temperature between 25-65℃. An even more preferred option is isothermal amplification at any single temperature between 25-42℃. A still more preferred option is isothermal amplification at any single temperature between 35-42℃.

[0050] There is no specific requirement for the reaction time of the nucleic acid amplification reaction. The preferred reaction time is 5-120 min, the further preferred reaction time is 5-60 min, and the even further preferred reaction time is 5-25 min.

[0051] The detection method described is amplification-ligation-simultaneous, where amplification, ligation, and detection occur in an integrated and parallel manner. The application scenarios for this method can be reagent kits or microfluidic chips.

[0052] The basic principle of the rapid gene mutation detection method based on click chemistry ligation is as follows: During nucleic acid amplification, when the target molecule is absent, the 5'-terminal and 3'-terminal oligonucleotide fragments of the complementary click ligation probe are both in their original free state and do not undergo click ligation with each other. Under these conditions, the fluorescent reporter groups labeled with either the 5'-terminal or 3'-terminal oligonucleotide fragments of the click ligation probe do not release fluorescent signals. When the target molecule is present and amplified exponentially or linearly, the 5'-terminal and 3'-terminal oligonucleotide fragments of the click ligation probe that recognize the wild-type or mutant sequence of the target gene simultaneously pair complementaryly with the target sequence, and are joined head-to-tail. Under these conditions, the click chemical functional group A (or B) labeled at the 3'-terminus of the 5'-terminal oligonucleotide fragment undergoes a click ligation reaction with the click chemical functional group B (or A) labeled at the 5'-terminus of the 3'-terminal oligonucleotide fragment. The destruction of the click chemical functional group structure on the oligonucleotide fragment or 3'-terminal oligonucleotide fragment, which is coupled to the fluorescent reporter group, leads to the disappearance of the fluorescence quenching effect of the fluorescent reporter group labeled on the oligonucleotide fragment. The fluorescent reporter group labeled on the 5'-terminal or 3'-terminal oligonucleotide fragment then releases a fluorescent signal. Under these conditions, since the click-linked probes corresponding to wild-type and mutant genes are labeled with different types of fluorescent reporter groups, and the click-linked probes corresponding to different types of mutant genes can be further labeled with different types of fluorescent reporter groups, it is possible to achieve qualitative and quantitative detection of wild-type and mutant genes, as well as different types of mutant genes, by real-time monitoring of the type and intensity of the fluorescence signal during the nucleic acid amplification reaction. Furthermore, after the nucleic acid amplification reaction, such as in solid-phase nucleic acid amplification, qualitative and semi-quantitative detection of wild-type and mutant genes, as well as different types of mutant genes, can be achieved by detecting the type and intensity of the final fluorescence signal in the reaction system.

[0053] The following are specific examples of the design of the lit-up click-connect probe and its technical method for detecting different genotypes of the target gene described in this invention:

[0054] like Figure 1As shown, the 5'-terminal oligonucleotide fragment of the light-up click-link probe is a universal probe P, which is complementary to the wild-type and mutant common sequences of the target gene. It has no ability to recognize the gene variant sequences of the target gene. During nucleic acid amplification, it can simultaneously complement the wild-type and mutant gene sequences. The 3'-terminal base of this universal probe is labeled with a cyclic olefinic group (or: cyclic alkyne group). The 3'-terminal oligonucleotide fragments of the lit-up click-link probes are recognition probes, namely recognition probe P1 for recognizing wild-type gene sequences and recognition probe P2 for recognizing mutant gene sequences. The 5'-terminus of both P1 and P2 oligonucleotides is labeled with a tetrazine group. Furthermore, the tetrazine group of the P1 oligonucleotide is further coupled to a Cy5 fluorescent reporter group that emits red fluorescence, and the tetrazine group of the P2 oligonucleotide is further coupled to a FAM fluorescent reporter group that emits green fluorescence. During nucleic acid amplification, P1 and P2 are complementary to the wild-type and mutant gene sequences, respectively, and recognize the wild-type and mutant gene sequences. Under these conditions, P and P1 constitute the lit-up click-link probe for recognizing wild-type genes, and P and P2 constitute the lit-up click-link probe for recognizing mutant genes. In the nucleic acid amplification reaction system, when wild-type and mutant gene sequences of the target gene are present at the same time, P and P1, P and P2 undergo click chemical reactions in a head-to-tail linkage manner, respectively. Furthermore, the oligonucleotides P1 and P2 release red Cy5 fluorescence signals and green FAM fluorescence signals, respectively, and the fluorescence signal intensities of each are positively correlated with the initial abundance of wild-type and mutant gene sequences, respectively.

[0055] Furthermore, such as Figure 1 As shown, there are two ways in which the tetrazine group labeled with the fluorescent reporter group of P1 and P2 oligonucleotides are coupled: the first is the tandem type, that is, the tetrazine group and the fluorescent reporter group are directly connected in a linear manner; the second is the "Y" type, that is, the tetrazine group and the fluorescent reporter group are simultaneously labeled on the 5'-terminal base of P1 and P2 oligonucleotides.

[0056] During nucleic acid amplification, when the gene sequence of the target gene is absent, P1 or P2 will be in a free state and will not undergo a click-link reaction with P. The tetrazine group labeled with P1 or P2 has a quenching effect on the fluorescent reporter group labeled with the oligonucleotide fragment to which it is located, and the fluorescent reporter group will not release a fluorescent signal. When the gene mutation sequence of the target gene is present, P1 and P2 are complementary to the wild-type and mutant gene sequences of the target gene, respectively. The tetrazine group labeled at the 5' end of P1 and P2 oligonucleotides undergoes a click-link reaction with the cyclic olefin group (or cyclic alkyne group) labeled at the 3' end of P oligonucleotide. Under these conditions, the original structure of the tetrazine group labeled at the 5' end of P1 and P2 oligonucleotides is destroyed, and its quenching effect on the fluorescent reporter group labeled with the oligonucleotide fragment to which it is located disappears, and the fluorescent reporter group releases a fluorescent signal.

[0057] In another specific embodiment, an alkynyl group can be used instead. Figure 1 The cyclic olefinic group (or: cyclic alkyne group) is replaced by an azide group. Figure 1 The tetraazine group.

[0058] Methods for detecting gene mutations caused by single, two, or more base variations, such as... Figure 2 Example: A pair of nucleic acid amplification primers are designed upstream and downstream of the gene mutation site to amplify the target gene. Recognition probes for the light-up click-link probe are designed and prepared according to the principle of the light-up click-link probe described in this invention. These are P1 oligonucleotides that specifically recognize wild-type genes and P2 oligonucleotides that specifically recognize mutant genes. Different fluorescent reporter groups are labeled at the 5' ends of P1 and P2 oligonucleotides, and the recognition sites for the gene mutation sites are located at the 5' ends of both P1 and P2 oligonucleotides. Furthermore, a universal probe P for the light-up click-link probe is designed and prepared. During nucleic acid amplification, when recognition probes P1 and / or P2 specifically bind complementary to the target sequence, a very rapid and efficient click-link reaction is triggered, releasing their respective fluorescent signals. The genotype (i.e., wild-type and mutant) and abundance of the target gene can be determined based on the type and intensity of the fluorescent signals.

[0059] Detection methods for gene deletion mutations caused by single, two, or more base variations, such as... Figure 3Example: A pair of nucleic acid amplification primers are designed upstream and downstream of the gene mutation site to amplify the target gene. Recognition probes for the light-up click-link probe are designed and prepared according to the principle of the light-up click-link probe described in this invention. These are P1 oligonucleotides that specifically recognize wild-type genes and P2 oligonucleotides that specifically recognize mutant genes. Different fluorescent reporter groups are labeled at the 5' ends of P1 and P2 oligonucleotides, and the recognition sites for the gene mutation sites are located at the 5' ends of both P1 and P2 oligonucleotides. Furthermore, a universal probe P for the light-up click-link probe is designed and prepared. During nucleic acid amplification, when recognition probes P1 and / or P2 specifically bind complementary to the target sequence, a very rapid and efficient click-link reaction is triggered, releasing their respective fluorescent signals. The genotype (i.e., wild-type and mutant) and abundance of the target gene can be determined based on the type and intensity of the fluorescent signals.

[0060] Methods for detecting gene insertion mutations caused by single, two, or more base variations, such as... Figure 4 Example: A pair of nucleic acid amplification primers are designed upstream and downstream of the gene mutation site to amplify the target gene. Recognition probes for the light-up click-link probe are designed and prepared according to the principle of the light-up click-link probe described in this invention. These are P1 oligonucleotides that specifically recognize wild-type genes and P2 oligonucleotides that specifically recognize mutant genes. Different fluorescent reporter groups are labeled at the 5' ends of P1 and P2 oligonucleotides, and the recognition sites for the gene mutation sites are located at the 5' ends of both P1 and P2 oligonucleotides. Furthermore, a universal probe P for the light-up click-link probe is designed and prepared. During nucleic acid amplification, when recognition probes P1 and / or P2 specifically bind complementary to the target sequence, a very rapid and efficient click-link reaction is triggered, releasing their respective fluorescent signals. The genotype (i.e., wild-type and mutant) and abundance of the target gene can be determined based on the type and intensity of the fluorescent signals.

[0061] Detection methods for gene fusion mutations, such as Figure 5Example: When the fusion of gene A and gene B is present, a pair of nucleic acid amplification primers are designed upstream and downstream of the fusion site. The upstream and downstream primers are complementary to the sequences of gene A and gene B, respectively, to amplify the fusion gene. The 5'-terminal oligonucleotide fragment PA and the 3'-terminal oligonucleotide fragment PB of the light-up click ligation probe are designed and prepared according to the principle of the light-up click ligation probe described in this invention. The PA oligonucleotide is complementary to gene A, and the PB oligonucleotide is complementary to gene B. Furthermore, the 3' end of the PA oligonucleotide terminates at the 3'-terminal gene fusion site of gene A, and the 5' end of the PB oligonucleotide begins at the 5'-terminal gene fusion site of gene B. When the fusion gene is present, the PA and PB oligonucleotides will complementarily pair with the target sequence in a head-to-tail linkage manner, resulting in a very rapid and efficient click ligation reaction, releasing a fluorescent signal labeled with PB (or PA) oligonucleotides. The genotype and abundance of the target gene can be determined based on the type and intensity of the fluorescent signal.

[0062] Compared with traditional real-time fluorescence nucleic acid amplification techniques and methods, the gene variation detection method based on a light-up click-link probe described in this invention has significant advantages such as simple operation, high sensitivity, strong specificity, and easy control.

[0063] The nucleic acid amplification reaction based on the glowing click-link probe described in this invention can be either isothermal amplification at a single reaction temperature, including recombinase polymerase amplification (RPA), strand displacement amplification (SDA), loop-mediated isothermal amplification (LAMP), rolling circle amplification (RCA), and isothermal exponential amplification (EXPAR), or temperature-variable amplification represented by polymerase chain reaction (PCR). During the above nucleic acid amplification reaction, the fluorescence signal and its intensity released by the glowing click-link probe can efficiently monitor the presence of base variations in the target sequence or template, which has significant practical value in the field of gene variation detection.

[0064] The beneficial effects of this invention are as follows:

[0065] Compared with other methods for detecting gene variations, the detection method described in this invention has the following main and significant advantages:

[0066] 1. This invention creatively uses a light-up click-link probe in nucleic acid amplification reactions that can identify gene variations of the target molecule, providing a specific, high-throughput, efficient, and accurate technique and method for detecting multiple types of gene variations. Furthermore, it is not only applicable to temperature-dependent amplification techniques such as PCR, but also particularly suitable for isothermal amplification techniques such as RPA and LAMP, demonstrating universality in the field of nucleic acid amplification techniques and methods.

[0067] 2. The spot-click ligation probe used in the nucleic acid amplification system of this invention has the ability to recognize single-base variations. The spot-click ligation probe can completely solve the problem of poor single-base variation recognition ability of traditional fluorescent probes used in isothermal amplification technologies such as RPA and LAMP, as well as the technical bottleneck of difficulty in simultaneously detecting wild-type and mutant genes of the target gene in a single tube. It has extremely high practical value and can provide an efficient and rapid point-of-care testing (POCT) technology, reagents and kits for the detection of various gene variations.

[0068] 3. The nucleic acid amplification reaction based on the light-up click-link probe described in this invention can be either liquid-phase amplification or solid-phase amplification. When applied to solid-phase amplification, compared with traditional solid-phase nucleic acid amplification techniques and methods, the solid-phase amplification described in this invention can monitor the changes in the type and abundance of fluorescence signals in real time during the nucleic acid amplification process. Furthermore, when using the endpoint method for detection, the subsequent incubation, hybridization, and washing steps required by traditional methods are not required. After the amplification reaction is completed, the type and abundance of fluorescence signals can be directly detected. This method is particularly suitable for high-throughput POCT detection techniques, reagents, and kits for gene mutations represented by SNPs.

[0069] 4. The nucleic acid amplification system described in this invention requires only one pair of primers and one set of light-up click ligation probes (or: 3 oligonucleotide fragments) to simultaneously detect wild-type and mutant sequences of the target gene in a single tube. It is particularly suitable for isothermal amplification technologies and methods represented by RPA and LAMP. Furthermore, when applied to isothermal amplification technologies and methods represented by RPA and LAMP, it has advantages such as low requirements for the detection environment and easier control of detection conditions. It is particularly suitable for POCT detection technologies, reagents, and kits for various gene variations. Attached Figure Description

[0070] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments:

[0071] Figure 1 This is a structural example diagram of a light-up click-connect probe (taking the reaction of tetrazine and cyclic olefin as an example).

[0072] Figure 2 This is an example diagram for detecting gene point mutations (using a tetrazine group and a fluorescent reporter group directly linked together as an example).

[0073] Figure 3 This is an example diagram for detecting gene deletion mutations (using the reaction of tetrazine and cyclic olefins as an example).

[0074] Figure 4 This is an example diagram for detecting gene insertion mutations (using the reaction of tetrazine and cyclic olefins as an example).

[0075] Figure 5 This is an example diagram for detecting gene fusion mutations (using the reaction of tetrazine and cyclic olefins as an example).

[0076] Figure 6 This is a graph showing the detection results of Example 1 (taking the RPA reaction as an example).

[0077] Figure 7 This is a graph showing the detection results of Example 2 (taking the RPA reaction as an example).

[0078] Figure 8 This is a graph showing the detection results of Example 3 (taking the RPA reaction as an example).

[0079] Figure 9 This is a graph showing the detection results of Example 4 (taking the RPA reaction as an example).

[0080] Figure 10 This is an example diagram of solid-phase nucleic acid amplification (taking the reaction of tetrazine and cyclic olefins as an example).

[0081] Figure 11 This is a chip schematic diagram of Example 5.

[0082] Figure 12 This is an example image of the detection results from Example 5 (using the RPA reaction as an example). Detailed Implementation

[0083] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the method of the present invention is not limited to the following limited examples. For those skilled in the art, several modifications and improvements can be made without departing from the structure of the present invention, and these should also be considered within the scope of protection of the present invention, without affecting the effectiveness of the implementation of the present invention or the practicality of the patent.

[0084] Unless otherwise specified, the experimental methods in the following examples are conventional methods; the chemical and biological reagents used are conventional reagents in the art and are commercially available unless otherwise specified.

[0085] In all embodiments of the present invention, the commercially available kits used for the RPA amplification reaction are DNA / RNA isothermal rapid amplification kits from Amperex Technology Co., Ltd. (China), which contain Buffer A and Buffer B.

[0086] Example 1. Detection of the 430C>T (rs1799853) site in the CYP2C9 gene

[0087] (1) Primer design and synthesis

[0088] Based on the sequence of the single base variation site 430C>T in the CYP2C9 gene, upstream and downstream primers required for amplification were designed. The design principles are the same as those for conventional RPA amplification primers. The specific primer sequences are shown below:

[0089] Wild-type gene sequence (underlined bold text indicates single nucleotide variant sites) (SEQ ID NO.1, 5'>3' direction):

[0090]

[0091] Mutant gene sequence (underlined bold text indicates single base variation sites) (SEQ ID NO.2, 5'>3' direction):

[0092]

[0093] RPA upstream primer sequence F (SEQ ID NO.3, 5'>3' direction):

[0094] CAGCAATGGAAAGAAATGGAAGGAGATCCGGCGTT.

[0095] RPA downstream primer sequence R (SEQ ID NO.4, 5'>3' direction):

[0096] GGTCACCCACCCTTGGTTTTTCTCAACTCCTCC.

[0097] (2) Design and synthesis of a light-up click connection probe (taking a series connection as an example)

[0098] Wild-type probe P1, mutant probe P2, and universal probe P were designed using specialized software to target single-base mutation sites. P1's 5' end is labeled with a red fluorescent reporter group Cy5 and a tetrazine group, while P2's 5' end is labeled with a green fluorescent reporter group FAM and a tetrazine group. The 3'-OH group at the 3'-terminus of probes P1 and P2 is labeled with C3 to block their extension activity. The 3'-OH group at the 3'-terminus of universal probe P is labeled with the compound trans-cyclotene (TCO), which also blocks its extension activity. The specific sequences of the lit-up click-link probes are shown below:

[0099] Wild-type probe P1 sequence (SEQ ID NO.5, 5'>3' orientation):

[0100] [Cy5-Tetraazine]- -[C3 spacer];

[0101] Mutant probe P2 sequence (SEQ ID NO.6, 5'>3' orientation):

[0102] [FAM-Tetraazine]- -[C3 spacer];

[0103] Universal probe P (SEQ ID NO.7, 5'>3' orientation):

[0104] GGAATTTTGGGATGGGGAAGAGGAGCATTGAGGAC-[TCO];

[0105] In the above sequences, the bolded underlined sequences are the bases containing genotype-specific recognition sites.

[0106] (3) Establishment and detection of RPA amplification reaction system

[0107] ① DNA was extracted from whole blood cells using a DNA extraction kit via magnetic bead method, and its purity and concentration were determined using NanoDrop 2000.

[0108] ② The required primers and probes are synthesized by a professional biotechnology company, diluted to a certain concentration, and stored at -20℃ for later use.

[0109] ③ Using a commercially available kit, prepare an amplification reaction system of 50 μL in total. Use H2O instead of DNA template as a blank template control (NTC).

[0110] The system comprises the following components:

[0111]

[0112] The reaction mixture was placed in a Bio-Rad CFX96 real-time quantitative PCR instrument, and the reaction conditions were 39℃ for 20 min. The fluorescence value was recorded by the PCR instrument every 20 seconds.

[0113] Test results: such as Figure 6 As shown in Figure a, if only red fluorescence is produced and an amplification curve is observed in the Cy5 channel, it indicates the presence of a homozygous wild-type allele; if only green fluorescence is produced and an amplification curve is observed in the FAM channel, it indicates the presence of a homozygous mutant allele; if both red and green fluorescent reporter groups are produced simultaneously and amplification curves are observed in both the Cy5 and FAM channels, it indicates the presence of a heterozygous allele.

[0114] (4) Sensitivity detection

[0115] ① Design primers to amplify the target genes for the wild-type and mutant gene fragments of the above genes, clone them into plasmids, and construct wild-type and mutant standards.

[0116] ② Dilute the primers and probes to a certain concentration and store them at -20℃ for later use.

[0117] ③ Dilute the mutant standard into a series of concentration gradients, namely 10ng, 1ng, 100pg, 10pg, and 1pg, and use the established system to obtain its lowest detection limit, i.e., sensitivity determination.

[0118] ④ The reaction system and conditions are the same as those in (3) above.

[0119] Test results: such as Figure 6 As shown in b, the limit of detection for this reaction system is 1 pg / reaction.

[0120] Example 2. Detection of E746-A750del deletion mutation in exon 19 of the EGFR gene

[0121] (1) Primer design and synthesis

[0122] A pair of RPA primers was designed based on the wild-type sequence and the deletion mutation sequence of exon 19, E746-A750del, of the EGFR gene. These primers can amplify both the wild-type and mutant sequences.

[0123] Wild-type gene sequence (bases underlined in bold are missing in the mutant plasmid) (SEQ ID NO.8, 5'>3' direction):

[0124] Mutant gene sequence (SEQ ID NO.9, 5'>3' direction):

[0125] GGCACCATCTCACAATTGCCAGTTAACGTCTTCCTTCTCTCTGTCATAGGGACTCTGGATCCCAGAAGGTGAGAAAGTTAAAATTCCCGTCGCTATCAAAACATCTCCGAAAGCCAACAAGGAAATCCTCGATGTGAGTTTCTGCTTTGCTGTGTGGGGGTCCATGGCTCTGAACCTCAGGCCCACCTTTTCTCATGTC.

[0126] RPA upstream primer RPA-EGFR19del-F sequence (SEQ ID NO.10, 5'>3' direction):

[0127] GGCACCATCTCACAATTGCCAGTTAACGTCTTC;

[0128] RPA downstream primer RPA-EGFR19del-R sequence (SEQ ID NO.11, 5'>3' direction):

[0129] GACATGAGAAAAGGTGGGCCTGAGGTTCAGAGCCA;

[0130] (2) Design and synthesis of a light-up click connection probe (taking a series connection as an example)

[0131] Wild-type Probe-EGFR19del-W probe sequence (SEQ ID NO.12, 5'>3' orientation):

[0132] [Cy5-Tetraazine]- -[C3 spacer];

[0133] Mutant Probe-EGFR19del-M probe sequence (SEQ ID NO.13, 5'>3' orientation):

[0134] [FAM-tetrazine]-AAAACATCTCCGAAAGCCAACAAGGAAATCCTCGA-[C3 spacer];

[0135] Universal probe P (SEQ ID NO.14, 5'>3' orientation):

[0136] AAGGTGAGAAAGTTAAAATTCCCGTCGCTATC-[TCO].

[0137] In the above sequences, the bolded underlined sequences are the bases containing genotype-specific recognition sites.

[0138] (3) Establishment and detection of RPA amplification reaction system

[0139] ① DNA was extracted from whole blood cells using a DNA extraction kit via magnetic bead method, and its purity and concentration were determined using NanoDrop 2000.

[0140] ② The required primers and probes are synthesized by a professional biotechnology company, diluted to a certain concentration, and stored at -20℃ for later use.

[0141] ③ Using a commercially available kit, prepare a 50 μL isothermal amplification reaction system, and use H2O instead of DNA template as an NTC control.

[0142] The system comprises the following components:

[0143]

[0144]

[0145] The reaction mixture was placed in a Bio-Rad CFX96 real-time quantitative PCR instrument, and the reaction conditions were 39℃ for 20 min. The fluorescence value was recorded by the PCR instrument every 20 seconds.

[0146] Test results: such as Figure 7 As shown in Figure a, in the reaction system with wild-type DNA, only the Cy5 channel showed an amplification curve; in the reaction system with mutant DNA, only the FAM channel showed an amplification curve; and no amplification curve was observed for NTC, indicating that the reaction system has good specificity.

[0147] (4) Sensitivity detection

[0148] ① Design primers to amplify the target genes for the wild-type and mutant gene fragments of the above genes, clone them into plasmids, and construct wild-type and mutant standards.

[0149] ② Dilute the primers and probes to a certain concentration and store them at -20℃ for later use.

[0150] ③ Dilute the mutant standard into a series of concentration gradients, namely 50ng, 5ng, 500pg, 50pg, and 5pg, and use the established system to obtain its lowest detection limit, i.e., sensitivity determination.

[0151] ④ The reaction system is the same as the system described in (3) above.

[0152] Test results: such as Figure 7 As shown in b, the limit of detection for this reaction system is 5 pg / reaction.

[0153] Example 3. Detection of V769_D770 insASV insertion mutation in exon 20 of the EGFR gene

[0154] (1) Primer design and synthesis

[0155] A pair of RPA primers was designed based on the wild-type sequence and the insertion mutation sequence of exon 20 of the EGFR gene, V769_D770 insASV. These primers can amplify both wild-type and mutant sequences.

[0156] Wild-type gene sequence (SEQ ID NO.15, 5'>3' direction):

[0157] AAGATCGCATTCATGCGTCTTCACCTGGAAGGGGTCCATGTGCCCCTCCTTCTGGCCACCATGCGAAGCCACACTGACGTGCCTCTCCCTCCCTCCAGGAAGCCTACGTGATGGCCAGCGTGGACAACCCCCACGTGTGCCGCCTGCTGGGCATCTGCCTCACCTCCACCGTGCAGCTCATCACGCAGCTCATGCCCTTCGGCTGCCTCCTGGACTATGTCCGGGAA;

[0158] Mutant gene sequence (indicated by bold underlined bases) (SEQ ID NO.16, 5'>3' direction):

[0159]

[0160] RPA upstream primer RPA-EGFR20ins-F sequence (SEQ ID NO.17, 5'>3' direction):

[0161] CTTCTGGCCACCATGCGAAGCCACACTGACG;

[0162] RPA downstream primer RPA-EGFR20ins-R sequence (SEQ ID NO.18, 5'>3' direction):

[0163] ACATAGTCCAGGAGGCAGCCCGAAGGGCATGAGC.

[0164] (2) Design and synthesis of a light-up click connection probe (taking a series connection as an example)

[0165] Wild-type probe sequence Probe-EGFR20ins-W (SEQ ID NO.19, 5'>3' orientation):

[0166] [Cy5-tetrazine]-GACAACCCCCACGTGTGCCGCCTGCTGGGCATC-[C3 spacer];

[0167] Mutant probe sequence Probe-EGFR20ins-M (SEQ ID NO.20, 5'>3' orientation):

[0168] [FAM-Tetraazine]- -[C3 spacer];

[0169] Universal probe P (SEQ ID NO.21, 5'>3' orientation):

[0170] CTCCCTCCAGGAAGCCTACGTGATGGCCAGCGTG-[TCO].

[0171] In the above sequences, the bolded underlined sequences are the bases containing genotype-specific recognition sites.

[0172] (3) Establishment and detection of RPA amplification reaction system

[0173] ① A professional biotechnology company synthesizes plasmids targeting wild-type and mutant gene fragments of the above-mentioned genes, and at the same time synthesizes the required primers and probes, dilutes them to a certain concentration, and stores them at -20℃ for later use.

[0174] ② Using a commercially available kit, prepare a 50 μL isothermal amplification reaction system, and use H2O instead of DNA template as an NTC control.

[0175] The system comprises the following components:

[0176]

[0177]

[0178] The reaction mixture was placed in a Bio-Rad CFX96 real-time quantitative PCR instrument, and the reaction conditions were 39℃ for 20 min. The fluorescence value was recorded by the PCR instrument every 20 seconds.

[0179] Test results: such as Figure 8 As shown, Figure 8 a represents the amplification status of the wild-type plasmid; only the Cy5 channel shows an amplification curve, while the FAM channel shows no amplification curve. Figure 8 b shows the amplification status of the mutant plasmid. Only the FAM channel shows an amplification curve, while the Cy5 channel shows no amplification curve. Figure 8 c represents the amplification of the NTC control. If no amplification curve appears, it indicates that the reaction system has good specificity.

[0180] (4) Sensitivity detection

[0181] ① Design primers to amplify the target genes for the wild-type and mutant gene fragments of the above genes, clone them into plasmids, and construct wild-type and mutant standards.

[0182] ② Dilute the primers and probes to a certain concentration and store them at -20℃ for later use.

[0183] ③ Dilute the mutant standard into a series of concentration gradients, i.e., 10-10 4 Copy / ul, 10 3 Copy / ul, 10 2Copy / ul, 10 1 Copy / ul, and use the established system to obtain its lowest detection limit, i.e., sensitivity determination.

[0184] ④ The reaction system and conditions are the same as those in (3) above.

[0185] Test results: such as Figure 8 As shown in d, the limit of detection for this reaction system is 10 copies / reaction.

[0186] Example 4. Detection of fusion mutations in EML4-ALK fusion gene variant V3a

[0187] (1) Primer design and synthesis

[0188] A pair of RPA primers were designed based on the EML4-ALK fusion gene variant V3a sequence.

[0189] Mutant 3a sequence (the bold italicized portion is the EML4 gene sequence, the remaining portion is the ALK gene sequence) (SEQ ID NO.22, 5'>3' direction):

[0190]

[0191] RPA upstream primer RPA-V3a-F sequence (SEQ ID NO.23, 5'>3' direction):

[0192] CGAAAATACCTTCAACACCCAAATTAATACCAA;

[0193] RPA downstream primer RPA-V3a-R sequence (SEQ ID NO.24, 5'>3' direction):

[0194] TCAGCTTGTACTCAGGGCTCTGCAGCTCCATCTGC.

[0195] (2) Design and synthesis of a light-up click connection probe (taking a series connection as an example)

[0196] Probe PA sequence (SEQ ID NO.25, 5'>3' orientation):

[0197] GCAGACAAGCATAAAGATGTCATCATCAACCAAG-[TCO];

[0198] Probe PB sequence (SEQ ID NO.26, 5'>3' orientation):

[0199] [Cy5-tetrazine]-TGTACCGCCGGAAGCACCAGGAGCTGCAAGCCA-[C3 spacer].

[0200] (3) Establishment and detection of RPA amplification reaction system

[0201] ① The EML4-ALK fusion gene variant 3a plasmid was synthesized by a professional biotechnology company and used as a standard for mutant 3a. At the same time, the required primers and probes were synthesized, diluted to a certain concentration, and stored at -20℃ for later use.

[0202] ② Using a commercially available kit, prepare a 50 μL isothermal amplification reaction system, in which the concentration of mutant 3a plasmid is 10. 4 Copy / ul, the reaction with H2O instead of DNA template serves as the NTC control.

[0203] The system comprises the following components:

[0204]

[0205] Place the reaction mixture in a Bio-Rad CFX96 real-time quantitative PCR instrument. The reaction conditions are 39℃ for 20 min. Record the fluorescence value every 20 seconds using the PCR instrument. If there is a curve amplification, it is judged as positive; if there is no amplification curve, it is judged as negative.

[0206] Test results: such as Figure 9 As shown, Figure 9 'a' represents the amplification of the 3a mutant plasmid. Figure 9 b shows the amplification results for the NTC control. The reaction tube containing the mutant 3a plasmid showed an amplification curve, while the NTC tube did not, indicating that this reaction system has good specificity.

[0207] (4) Sensitivity detection

[0208] ① Primers were designed to amplify the target gene for the EML4-ALK fusion gene variant 3a, which was then cloned into a plasmid to construct a standard.

[0209] ② Dilute the primers and probes to a certain concentration and store them at -20℃ for later use.

[0210] ③ Dilute the mutant 3a plasmid into a series of concentration gradients, i.e., 10-1 4 Copy / ul, 10 3 Copy / ul, 10 2 Copy / ul, 10 1 Copy / ul, and use the established system to obtain its lowest detection limit, i.e., sensitivity determination.

[0211] ④ The reaction system and conditions are the same as those in (3) above. The results are interpreted based on whether or not an amplification curve is present.

[0212] Test results: such as Figure 9 As shown, Figure 9 c represents the sensitivity result of the mutant 3a plasmid. The limit of detection for this reaction system is 10 copies / reaction.

[0213] Example 5. High-throughput detection of the 636G>A (rs4986893) and 681G>A (rs4244285) sites in the CYP2C19 gene.

[0214] (1) Primer design and synthesis

[0215] Based on the sequences of the single nucleotide polymorphisms 636G>A (rs4986893) and 681G>A (rs4244285) in the CYP2C19 gene, upstream and downstream primers required for amplification were designed. The design principles are the same as those for conventional RPA amplification primers. The specific primer sequences are shown below:

[0216] SNP locus 1: 636G>A (rs4986893)

[0217] Wild-type gene sequence (underlined bold text indicates single nucleotide variant sites) (SEQ ID NO.27, 5'>3' direction):

[0218]

[0219] Mutant gene sequence (underlined bold text indicates single-base variation sites) (SEQ ID NO.28, 5'>3' direction):

[0220]

[0221] RPA upstream primer sequence F1 (SEQ ID NO.29, 5'>3' direction):

[0222] ACGTTTCGATTATAAAGATCAGCAATTTCTTAA;

[0223] RPA downstream primer sequence R1 (SEQ ID NO.30, 5'>3' direction):

[0224] GCTTGGTCAATATAGAATTTTGGATTTCCCAGAA.

[0225] SNP locus 2: 681G>A (rs4244285)

[0226] Wild-type gene sequence (underlined bold text indicates single nucleotide variant sites) (SEQ ID NO.31, 5'>3' direction):

[0227]

[0228] Mutant gene sequence (underlined bold text indicates single nucleotide variant sites) (SEQ ID NO.32, 5'>3' direction):

[0229]

[0230] RPA upstream primer sequence F2 (SEQ ID NO.33, 5'>3' direction):

[0231] AATAAATTATTGTTTTCTCTTAGATATGCAA;

[0232] RPA downstream primer sequence R2 (SEQ ID NO.34, 5'>3' direction):

[0233] TCCATCGATTCTTGGTGTTCTTTTACTTTCTCCAA.

[0234] (2) Design and synthesis of a light-up click connection probe (taking a series connection as an example)

[0235] Wild-type probes, mutant probes, and universal probes targeting the two SNP sites were designed using specialized software. Different colored fluorescent groups and tetrazine groups were labeled at the 5' end of the recognition probes for different SNP sites, and the 3'-OH of the 3'-terminal base was labeled with C3 to block its extension activity. The universal probe had its 3'-terminal base labeled with TCO and a 12nt poly(A) sequence added to the 5' end. Using a biological cross-linking method, the poly(A) was immobilized on the surface of a solid support through the 5'-terminal base labeling group (-NH2). Four replicates were designed for each gene site. The schematic diagram is shown below. Figure 11 As shown. The specific sequence of the lit-up click connection probe is as follows:

[0236] For SNP site 1: 636G>A (rs4986893)

[0237] Wild-type probe P1 sequence (SEQ ID NO.35, 5'>3' orientation):

[0238] [Cy5-Tetraazine]- -[C3 spacer];

[0239] Mutant probe P2 sequence (SEQ ID NO.36, 5'>3' orientation):

[0240] [FAM-Tetraazine]- -[C3 spacer];

[0241] Universal probe P (SEQ ID NO.37, 5'>3' orientation):

[0242] NH2-AAAAAAAAAAAA-AATGAAAACATCAGGATTGTAAGCACCCCCTG-[TCO];

[0243] For SNP site two: 681G>A (rs4244285)

[0244] Wild-type probe P3 sequence (SEQ ID NO.38, 5'>3' orientation):

[0245] [Cy5-Tetraazine]- -[C3 spacer];

[0246] Mutant probe P4 sequence (SEQ ID NO.39, 5'>3' orientation):

[0247] [FAM-Tetraazine]- -[C3 spacer];

[0248] Universal probe P5 (SEQ ID NO.40, 5'>3' orientation):

[0249] NH2-AAAAAAAAAAAA-TAATTTTCCCACTATCATTGATTATTTCCC-[TCO].

[0250] In the above sequences, the bolded underlined sequences are the bases containing genotype-specific recognition sites.

[0251] (3) Establishment and detection of RPA amplification reaction system

[0252] ① DNA was extracted from whole blood cells using a DNA extraction kit via magnetic bead method, and its purity and concentration were determined using NanoDrop 2000.

[0253] ② The required primers and probes are synthesized by a professional biotechnology company, diluted to a certain concentration, and stored at -20℃ for later use.

[0254] ③ Prepare the amplification reaction system using a commercial kit, totaling 50 μL. Use H2O instead of DNA template as a blank template control (NTC).

[0255] The system comprises the following components:

[0256]

[0257] The reaction conditions are 39℃ for 20 min. In situ fluorescence signals are generated during the amplification process. After the nucleic acid amplification reaction, no additional incubation, hybridization, or washing steps are required; fluorescence scanning is performed directly. Different genotypes are identified based on the type and intensity of the terminal fluorescence signal detected in the reaction system. Judgment criteria: only red fluorescence indicates the presence of a homozygous wild-type allele; only green fluorescence indicates the presence of a homozygous mutant allele; and yellow fluorescence indicates the presence of a heterozygous allele. The location of the puncta can determine the type of SNP, and the specific genotype of the SNP at the designated locus can be determined by the type and color of the fluorescence. Results are as follows: Figure 12 As shown, the genotypes of 12a-12f are 636GG / 681GG, 636GG / 681GA, 636GA / 681GG, 636GG / 681AA, 636AA / 681GG, and 636GA / 681GA, respectively.

[0258]

[0259]

[0260]

[0261]

[0262]

[0263]

[0264]

[0265]

Claims

1. A method for rapid detection of genetic variations based on click chemistry linkage, which is not for diagnostic purposes, characterized in that: The kit for rapidly detecting gene mutation based on the on-off type click ligation probe is used, the method is amplification and ligation at the same time, and the reagent kit comprises the following reaction components: ① an upstream primer and a downstream primer; ② a group of on-off type click ligation probes for recognizing wild type and mutant sequences of the gene to be detected; ③ a nucleic acid template to be detected; ④ deoxyribonucleotide triphosphates dNTPs including dATP, dTTP, dCTP and dGTP; ⑤ other enzymes, cofactors, ions and buffer systems required for completing nucleic acid amplification; The reaction mixture of the reaction components is reacted under constant temperature conditions; The on-off type click ligation probe is composed of two oligonucleotide fragments connected at the head and tail and complementary to the target sequence to be detected, which are a 5'-end oligonucleotide fragment and a 3'-end oligonucleotide fragment complementary to the target sequence; For the on-off type click ligation probe, the recognition site of the gene mutation base is located at any one of the 3' end or the 5' end or the middle of the 5'-end oligonucleotide fragment of the on-off type click ligation probe; or the recognition site of the mutation base is located at any one of the 5' end or the 3' end or the middle of the 3'-end oligonucleotide fragment of the on-off type click ligation probe; Or, the base specifically recognizing the target gene mutation sequence to be detected in the sequence of the on-off type click ligation probe is designed in the 5'-end oligonucleotide fragment and the 3'-end oligonucleotide fragment of the on-off type click ligation probe at the same time; The 3'-end of the 5'-end oligonucleotide fragment of the on-off type click ligation probe is labeled with a click chemistry functional group A and a fluorescent reporter group, and the click chemistry functional group A has a fluorescence quenching effect on the fluorescent reporter group labeled on the fragment, in addition, the 5'-end of the 3'-end oligonucleotide fragment of the on-off type click ligation probe is labeled with a click chemistry functional group B and a 3'-OH blocking group of the 3'-end base; or the 3'-end of the 5'-end oligonucleotide fragment of the on-off type click ligation probe is labeled with a click chemistry functional group B, in addition, the 5'-end of the 3'-end oligonucleotide fragment of the on-off type click ligation probe is labeled with a click chemistry functional group A and a fluorescent reporter group, and the click chemistry functional group A has a fluorescence quenching effect on the fluorescent reporter group labeled on the fragment, and a 3'-OH blocking group of the 3'-end base; The click chemistry functional group A is a tetrazine group, and the click chemistry functional group B is a cyclic olefin group or a cyclic alkyne group; The click chemistry functional group A and the fluorescent reporter group are directly connected together in a linear manner; the click chemistry functional group A and the click chemistry functional group B of the on-off type click ligation probe are a pair of click chemistry functional groups which have a very fast and efficient click ligation reaction with each other, and the click chemistry functional group A has a fluorescence quenching effect on the fluorescent reporter group labeled on the oligonucleotide fragment.

2. The method of claim 1, wherein: When the gene mutation to be detected is a single base mutation: the recognition site of the variant base is located at the 3' terminal 1-4 bases of the 5'-end oligonucleotide fragment of the light-up click ligation probe; or, the recognition site of the variant base is located at the 5' terminal 1-4 bases of the 3'-end oligonucleotide fragment of the light-up click ligation probe; When the gene mutation to be detected is a mutation caused by two or more bases: the recognition site of the variant base is located at two or more bases at the 3' terminal or adjacent to the 3' terminal of the 5'-end oligonucleotide fragment of the light-up click ligation probe; or, the recognition site of the variant base is located at two or more bases at the 5' terminal or adjacent to the 5' terminal of the 3'-end oligonucleotide fragment of the light-up click ligation probe; When the gene mutation to be detected is a fusion gene of two or more genes: the recognition site of the variant base is located at one or more continuous base positions at the 3' terminal, adjacent to the 3' terminal or in the middle of the sequence of the 5'-end oligonucleotide fragment of the light-up click ligation probe; or, the recognition site of the variant base is located at one or more continuous base positions at the 5' terminal, adjacent to the 5' terminal or in the middle of the sequence of the 3'-end oligonucleotide fragment of the light-up click ligation probe.

3. The method of claim 1 or 2, further characterized in that: Further, when the 5'-end oligonucleotide fragment and the 3'-end oligonucleotide fragment of the light-up click ligation probe are simultaneously paired with the target gene to be detected in a head-to-tail mode to form a double-stranded nucleic acid molecule, the click chemistry functional groups A and B can undergo a very rapid and efficient click chemistry ligation reaction; Further, after the click chemistry ligation reaction, the quenching effect of the click chemistry functional group A on the fluorescent reporter group labeled on the oligonucleotide fragment disappears, and the fluorescent reporter group releases a fluorescent signal.

4. The method of claim 1 or 2, further characterized in that: The tetrazine group is a tetrazine compound, and the cyclic olefin group is a trans-cyclooctene TCO.

5. The method of claim 1 or 2, wherein: The fluorescent reporter group is selected from carboxyfluorescein 6-FAM, hexachlorofluorescein HEX, tetrachlorofluorescein TET, JOE, VIC, fluorescein isothiocyanate FITC, indodicarbocyanine Cy3 or Cy5, TAMRA, and ROX; The blocking group is a phosphate group, an amino group, a polyhexaethylene glycol, a C3-spacer labeled at the position of the 3'-OH of the 3' terminal base, or an inverted base or a dideoxynucleotide is used for the 3' terminal base.

6. The method of claim 1 or 2, wherein: The 5'-end oligonucleotide fragment or 3'-end oligonucleotide fragment of the light-up click ligation probe incorporates one or more nucleotide derivatives, and the nucleotide derivative is one or more of locked nucleic acid, peptide nucleic acid, deoxyinosine, inosine, 7-deaza-2'-deoxyinosine, 2-aza-2'-deoxyinosine, 2'-methoxyinosine, 2'-F inosine, deoxy 3-nitropyrrole, 3-nitropyrrole, 2'-methoxy 3-nitropyrrole, 2'-F 3-nitropyrrole, 1-(2'-deoxy-beta-D-ribofuranosyl)-3-nitropyrrole, deoxy 5-nitropyrrole, 5-nitroindole, 2'-methoxy 5-nitroindole, 2'-F 5-nitroindole, deoxy 4-nitrobenzimidazole, 4-nitrobenzimidazole, deoxy 4-aminobenzimidazole, 4-aminobenzimidazole, deoxymogulmycin, 2'-F mogulmycin, 2'-F 4-nitrobenzimidazole, peptide nucleic acid-5-nitroindole, peptide nucleic acid-mogulmycin, peptide nucleic acid-inosine, peptide nucleic acid-4-nitrobenzimidazole, peptide nucleic acid-3-nitropyrrole, morpholino-5-nitroindole, morpholino-mogulmycin, morpholino-inosine, morpholino-4-nitrobenzimidazole, morpholino-3-nitropyrrole, phosphoramidate-5-nitroindole, phosphoramidate-mogulmycin, phosphoramidate-inosine, phosphoramidate-4-nitrobenzimidazole, phosphoramidate-3-nitropyrrole, 2'-O-methoxyethyl inosine, 2'-O-methoxyethyl mogulmycin, 2'-O-methoxyethyl 5-nitroindole, 2'-O-methoxyethyl 4-nitro-benzimidazole, and 2'-O-methoxyethyl 3-nitropyrrole.

7. The method of claim 1 or 2, wherein: The length of the 5'-end oligonucleotide fragment and the 3'-end oligonucleotide fragment of the light-up click ligation probe ranges from 10 nt to 50 nt. The GC content of the 5'-end oligonucleotide fragment and the 3'-end oligonucleotide fragment of the light-up click ligation probe ranges from 20% to 80%.

8. The method of claim 1 or 2, wherein: The nucleic acid template to be detected is extracted nucleic acid, or is a raw sample directly used without a nucleic acid extraction step, and the raw sample includes saliva, urine, cerebrospinal fluid. The nucleic acid template to be detected is a DNA nucleic acid template or an RNA nucleic acid template.

9. The method of claim 1 or 2, wherein: The detection is performed by liquid-phase nucleic acid amplification or solid-phase nucleic acid amplification.

10. The method of claim 9, wherein: In the liquid-phase nucleic acid amplification reaction, the wild-type and mutant genes of the target gene to be detected can be simultaneously detected in a single reaction tube, detection cell or detection well; In the solid-phase nucleic acid amplification reaction, the 5'-end of the 5'-end oligonucleotide fragment of the light-up click ligation probe is added with a poly(A) or poly(T) sequence of 5-25 nt, and the 5'-end oligonucleotide fragment is fixed on the surface of a solid-phase carrier by the 5'-end base of the poly(A) or poly(T) or a labeled group thereof in a form of biological cross-linking; or, In the solid-phase nucleic acid amplification reaction, the 3'-end of the 3'-end oligonucleotide fragment of the point-on light click connection probe is added with a poly(A) or poly(T) sequence of 5-25 nt, and the 3'-end oligonucleotide fragment is fixed on the surface of a solid-phase carrier by the 3'-end base of the poly(A) or poly(T) or a labeled group thereof in a form of biological cross-linking.

11. The method of claim 1 or 2, wherein: The temperature range of the nucleic acid amplification reaction is 35-42℃.

12. The method of claim 1 or 2, wherein: The time of the nucleic acid amplification reaction is 5-25 min.

13. The method of claim 1 or 2, wherein: During the nucleic acid amplification reaction, the types and intensities of the fluorescence signals are monitored in real time to realize qualitative and quantitative detection of wild-type and mutant genes and different types of mutant genes; or after the nucleic acid amplification reaction is completed, the types and intensities of the terminal fluorescence signals of the reaction system are directly detected to realize qualitative and semi-quantitative detection of wild-type and mutant genes and different types of mutant genes.

14. The method of claim 1 or 2, wherein: The method is integrated and parallel in amplification, connection and detection; The application scenario of the method can be a kit or a microfluidic chip.

15. A kit for rapid detection of genetic variations based on light-up type click ligation probe, characterized in that, The reaction mixture of the reaction components comprises: ① an upstream primer and a downstream primer; ② a group of point-on light click connection probes for recognizing wild-type and mutant sequences of the gene to be detected; ③ a nucleic acid template to be detected; ④ deoxyribonucleotide triphosphates dNTPs including dATP, dTTP, dCTP and dGTP; ⑤ other enzymes, cofactors, ions and buffer systems required for completing nucleic acid amplification; The reaction mixture of the reaction components is reacted under constant temperature conditions; The genetic variations are selected from any one of the following genetic variations: single base variation site 430C>T of CYP2C9 gene, EGFR gene exon 19 E746-A750del deletion mutation, EGFR gene exon 20 V769_D770 insASV insertion mutation, fusion mutation of EML4-ALK fusion gene variation V3a, single base variation site 636G>A of CYP2C19 gene and single base variation site 681G>A of CYP2C19 gene; the kit is a kit for RPA amplification reaction, and the primer and probe sequences corresponding to each genetic variation are as follows: (1) the sequences of the upstream primer and the downstream primer for RPA amplification of the single base variation site 430C>T of the CYP2C9 gene are shown in SEQ ID NO. 3 and SEQ ID NO. 4; the specific sequence of the point-on light click connection probe is as follows: Wild-type probe P1 sequence: [Cy5-tetrazine]-CGTGTTCAAGAGGAAGCCCGCTGCCTTGTG-[C3 spacer]; Mutant probe P2 sequence: [FAM-tetrazine]-TGTGTTCAAGAGGAAGCCCGCTGCCTTGTG-[C3 spacer]; Universal probe P: GGAATTTTGGGATGGGGAAGAGGAGCATTGAGGAC-[TCO]. (2) The upstream primer and downstream primer sequences for RPA amplification of the EGFR gene exon 19 E746-A750del deletion mutation are shown in SEQ ID NO. 10 and SEQ ID NO. 11; the specific sequence of the light-up click ligation probe is as follows: Wild type probe sequence Probe-EGFR19del-W: [Cy5-tetrazine]-AAGGAATTAAGAGAAGCAACATCTCCGAAAGCC-[C3 spacer]; Mutant probe sequence Probe-EGFR19del-M: [FAM-tetrazine]-AAAACATCTCCGAAAGCCAACAAGGAAATCCTCGA-[C3 spacer]; Universal probe P: AAGGTGAGAAAGTTAAAATTCCCGTCGCTATC-[TCO]; (3) The upstream primer and downstream primer sequences for RPA amplification of the EGFR gene exon 20 V769_D770 insASV insertion mutation are shown in SEQ ID NO. 17 and SEQ ID NO. 18; the specific sequence of the light-up click ligation probe is as follows: Wild type probe sequence Probe-EGFR20ins-W: [Cy5-tetrazine]-GACAACCCCCACGTGTGCCGCCTGCTGGGCATC-[C3 spacer]; Mutant probe sequence Probe-EGFR20ins-M: [FAM-tetrazine]-GCCAGCGTGGACAACCCCCACGTGTGCCGCCTGC-[C3 spacer]; Universal probe P: CTCCCTCCAGGAAGCCTACGTGATGGCCAGCGTG-[TCO]; (4) The upstream primer and downstream primer sequences for RPA amplification of the fusion mutation of the EML4-ALK fusion gene variant V3a are shown in SEQ ID NO. 23 and SEQ ID NO. 24; the specific sequence of the light-up click ligation probe is as follows: Probe PA sequence: GCAGACAAGCATAAAGATGTCATCATCAACCAAG-[TCO]; Probe PB sequence: [Cy5-tetrazine]-TGTACCGCCGGAAGCACCAGGAGCTGCAAGCCA-[C3 spacer]; (5) The upstream primer and downstream primer sequences for RPA amplification of the single base variant site 636G>A of the CYP2C19 gene are shown in SEQ ID NO. 29 and SEQ ID NO. 30; the specific sequence of the light-up click ligation probe is as follows: Wild type probe P1 sequence: [Cy5-tetrazine]-GATCCAGGTAAGGCCAAGTTTTTTGCTTCCTGAG-[C3 spacer]; Mutant probe P2 sequence: [FAM-tetrazine]-GATCCAGGTAAGGCCAAGTTTTTTGCTTCCTGAG-[C3 spacer]; [FAM-tetrazine]-AATCCAGGTAAGGCCAAGTTTTTTGCTTCCTGAG-[C3 spacer]; Universal probe P: NH2-AAAAAAAAAAAA-AATGAAAACATCAGGATTGTAAGCACCCCCTG-[TCO]; The sequences of the upstream primer and the downstream primer for RPA amplification of the single base variation site 681G>A of the CYP2C19 gene are shown as SEQ ID NO. 33 and SEQ ID NO. 34; the specific sequence of the dot-labeled click connection probe is as follows: Wild type probe P3 sequence: [Cy5-tetrazine]-GGGAACCCATAACAAATTACTTAAAAACCTTGCT-[C3 spacer]; Mutant probe P4 sequence: [FAM-tetrazine]-AGGAACCCATAACAAATTACTTAAAAACCTTGCT-[C3 spacer]; Universal probe P5: NH2-AAAAAAAAAAAA-TAATTTTCCCACTATCATTGATTATTTCCC-[TCO].

Images