Methods for increasing smn protein expression based on pe and uses thereof

Abstract

The present application relates to a method for increasing SMN protein expression based on PE and application thereof. The method for increasing SMN protein expression based on PE comprises a PE gene editing system for precisely deleting 9 bases of an ISS-N1 core sequence, which comprises a pegRNA, a Nick-sgRNA and a PE protein targeting the ISS-N1 site, or a plasmid expressing the pegRNA, the Nick-sgRNA and the PE protein targeting the ISS-N1 site; and then introducing the system into cells for gene editing, so as to precisely delete 9 bases of the SMN2 gene ISS-N1 core sequence, thereby increasing the mRNA and protein expression of full-length SMN. The present application significantly increases the expression level of SMN protein, and establishes a SMA in-situ gene therapy technology which is precise, efficient and has small genomic changes.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering. It relates to a method and its application for increasing SMN protein levels by precisely deleting splicing regulatory elements using Prime Editing technology. Background Technology

[0002] Spinal Muscular Atrophy (SMA) is a neuromuscular disease characterized by symmetrical muscle weakness and atrophy due to degeneration of motor neurons in the anterior horn of the spinal cord. It is one of the most common autosomal recessive inherited diseases in infancy, primarily manifesting as proximal limb weakness. As the disease progresses, motor function declines or is lost, leading to difficulty swallowing and spontaneous breathing, ultimately resulting in death from respiratory muscle paralysis. The incidence of SMA in the general population is approximately 1 / 6000-1 / 10000, with a carrier rate of 1 / 40-1 / 50. [1] The carrier rate in my country is approximately 1 / 43. [2] SMA is typically classified into five subtypes based on disease severity and age of onset. SMA-I accounts for approximately 50% of cases, with onset at birth or within the first six months of life. Symptoms include severe generalized muscle weakness, inability to sit independently, and difficulty lifting the head. Death often occurs before 20 months of age due to respiratory muscle paralysis. [3] SMA is a serious, fatal, and disabling hereditary disease that places a huge burden on patients' families and society.

[0003] The pathogenic gene for SMA is the SMN1 gene, which encodes the survival motor neuron (SMN) protein. In humans, the SMN gene is located at 5q11.2-5q13.3. [4] Furthermore, there are two highly homologous copies: one closer to the telomere, called SMN1 / SMNt, and one closer to the centromere, called SMN2 / SMNc. They differ by only one base in their coding sequences and encode the same protein. The base at position 6 of exon 7 in the SMN1 gene is C, while in SMN2 it is T. This base difference leads to alternative splicing in SMN2, resulting in only about 10% of the active SMN protein. [5] While the deletion of the SMN2 gene does not cause disease, clinical statistics show that the SMN2 copy number is inversely proportional to the severity of the disease. [6] Furthermore, almost all SMA patients have at least one copy of the SMN2 gene, making SMN2 an ideal therapeutic target for SMA.

[0004] Because of the weak 3' and 5' splicing sites flanking exon 7 of the human SMN2 gene, exon 7 is skipped during splicing, resulting in 90% of the transcript lacking exon 7 and producing truncated, unstable SMN protein. However, exon 7 contains regulatory elements such as splicing repressors and splicing enhancers. Targeting the exon 7 splicing repressors with antisense oligonucleotides (ASOs) can promote the inclusion of exon 7 in SMN2 mRNA, increasing SMN protein levels. [7] Intronic splicing silencer number 1 (ISS-N1) is currently the most important target for treating SMA using ASOs (autosomal splicing silencing agents). This site is located at the 5' end of intron 7. ASOs block 19 bases in the ISS-N1 region through complementary base pairing, thereby inhibiting the binding of splicing repressors such as hnRNPA1. Spinraza, an ASO targeting this site, was approved by the FDA in December 2016. However, Spinraza requires repeated intrathecal injections, cannot achieve permanent restoration of SMN expression, and is extremely expensive. [8,9] .

[0005] Clustered regularly interspaced short palindrome repeats (CRISPR) and CRISPR-associated proteins (Cas), ubiquitous in bacteria and archaea, form a bacterial defense system against exogenous infections.

[10] Cas proteins can specifically recognize and cleave target DNA under the guidance of CRISPR RNA (crRNA) or guide RNA (small guide RNA, sgRNA).

[11] .

[0006] In 2020, Li Jin-Jing et al. designed an sgRNA targeting the ISS-N1 site of the SMN2 gene. Guided by this sgRNA, Cas9 specifically edited the ISS-N1 site, causing random insertions or deletions, thereby disrupting the splicing regulatory element. In their study, 54 clones were analyzed, and editing occurred in only 13 clones. Furthermore, the full-length SMN transcripts of four edited clones did not increase.

[13] .

[0007] In 2019, David Liu et al. developed a precise genome editing tool based on CRISPR: Prime Editing (PE). PE is composed of a single-strand cleaving Cas9 (Cas9 Nickase, nCas9) fusion with an engineered MLV reverse transcriptase; it also combines the targeting of sgRNA with DNA replication using RNA as a template to form prime editing guide RNA (pegRNA). Compared with traditional sgRNA, pegRNA can not only target specific DNA regions but also carries a "reverse transcription template." Guided by pegRNA, the Cas9-MLV-RT fusion protein precisely cleaves a single strand of DNA. Then, MLV-RT uses the primer binding site (PBS) on the pegRNA and the "reverse transcription template (RT template)" to synthesize the target DNA. Finally, the cell's DNA repair mechanism automatically integrates this newly synthesized sequence into the genome, thereby precisely inserting or deleting small fragments at the target site.

[12] This makes precise editing of ISS-N1 possible. Currently, there are no reports internationally of PE gene editing technology being used in gene therapy for genetic diseases.

[0008] References:

[0009] [1]J.Pearn,Classification of spinal muscular atrophies[J].Lancet,1980,1:919-922.

[0010] [2]X.Wei,T.Hu,Y.Pu,et al.,Notable Carrier Risks for IndividualsHaving Two Copies of SMN1 in Spinal Muscular Atrophy Families with 2-copyAlleles:Estimation Based on Chinese Meta-analysis Data[J].Journal of GeneticCounseling,2017,1-7

[0011] [3]E.Mercuri,E.Bertini,S.T.Iannaccone,Childhood spinal muscularatrophy:controversies and challenges[J].The Lancet.Neurology,2012,11:443-452.

[0012] [4]S.Lefebvre,L.Burglen,S.Reboullet,et al.,Identification andcharacterization of a spinal muscular atrophy-determining gene[J].Cell,1995,80:155-165.

[0013] [5]B.Wirth,An update of the mutation spectrum of the survival motorneuron gene(SMN1)in autosomal recessive spinal muscular atrophy(SMA)[J].Humanmutation,2000,15:228-237.

[0014] [6]E.Tizzano,Spinal muscular atrophy during human development:whereare the early pathogenic findings?[J].Advances in experimental medicine andbiology,2009,652:225-235.

[0015] [7]M.A.Passini,J.Bu,A.M.Richards,et al.,Antisense oligonucleotidesdelivered to the mouse CNS ameliorate symptoms of severe spinal muscularatrophy[J].Science translational medicine,2011,3:72ra18.

[0016] [8]C.A.Chiriboga,K.J.Swoboda,B.T.Darras,et al.,Results from a phase1study of nusinersen(ISIS-SMN(Rx))in children with spinal muscular atrophy[J].Neurology,2016,86:890-897.

[0017] [9] https: / / www.spinraza-hcp.com / en_us / home / dosing.html .

[0018]

[10] Y.Ishino,H.Shinagawa,K.Makino,et al.,Nucleotide sequence of theiap gene,responsible for alkaline phosphatase isozyme conversion inEscherichia coli,and identification of the gene product[J].Journal ofbacteriology,1987,169:5429-5433.

[0019]

[11] P.Mali,L.Yang,K.M.Esvelt,et al.,RNA-guided human genomeengineering via Cas9[J].Science,2013,339:823-826.

[0020]

[12] Anzalone AV,Randolph PB,Davis JR,et al.Search-and-replace genomeediting without double-strand breaks or donor DNA.Nature.2019;576(7785):149-157.

[0021]

[13] Jin-Jing L, Xiang L, Cheng T, et al. Disruption of splicing-regulatory elements using CRISPR / Cas9 to rescue spinal muscular atrophy in human iPSCs and mice. National Science Review. 2020;7(1):92-101.

[0022]

[14] Miaojin Zhou, Zhiqing Hu, Liyan Qiu, et al. Seamless genetic conversion of SMN2 to SMN1 via CRISPR / Cpf1 and single-stranded oligodeoxynucleotides in spinal muscular atrophy patient-specific iPSCs. HumanGene Therapy, 2018, 29(11): 1252-1263. Summary of the Invention

[0023] This invention provides a method based on PE gene editing technology to precisely delete the core region of the ISS-N1 site of the SMN2 gene, thereby blocking the binding of splicing repressors such as hnRNPA1, so that the SMN2 transcript contains more full-length SMN, thus enhancing the expression of full-length SMN protein.

[0024] This invention designs and constructs PE gene editing systems of varying lengths of primer-binding sequences and reverse transcription templates, screens for the optimal combination, and validates the feasibility of this in situ gene therapy strategy in SMA patient-specific iPSCs. This is the first SMA gene therapy strategy internationally based on precisely targeting deletion splicing regulatory sequences.

[0025] To solve the above-mentioned technical problems, the technical solution of the present invention is as follows:

[0026] A method for increasing SMN protein expression includes: constructing a PE gene editing system that precisely deletes 9 bases from the ISS-N1 core sequence, the system comprising pegRNA, Nick-sgRNA, and PE protein targeting the ISS-N1 site, or a plasmid expressing pegRNA, Nick-sgRNA, and PE protein targeting the ISS-N1 site; then introducing the system into cells to precisely delete 9 bases from the ISS-N1 core sequence of the SMN2 gene to increase the mRNA and protein expression of full-length SMN.

[0027] Preferably, the method for increasing the expression of functional SMN proteins is a non-therapeutic, non-diagnostic method.

[0028] There are several ways to introduce cells, including electroporation, liposome transfection, viral transduction, and nanomaterial transfection. Any method that can introduce cells is acceptable.

[0029] Preferably, the method is applied to human induced pluripotent stem cells, comprising: providing sgRNA targeting the splice silencer ISS-N1 site on intron 7 of the SMN2 gene, constructing a targeting plasmid, performing gene editing on iPSCs, and obtaining a gene-edited cell line.

[0030] The iPSCs are derived from cells isolated from the urine of SMA patients and reprogrammed.

[0031] Preferably, the human induced pluripotent stem cells may also be derived from iNEP, iMNP or iMNs.

[0032] An iPSCs that precisely delete 9 bases from the ISS-N1 core sequence.

[0033] Preferably, the iPSCs have the sequence: AAGGAGTAAGTTTATGAAAGTGAATCTTAC (SEQ ID NO.24).

[0034] The sequencing results of iPSCs with precise deletion of 9 bases are shown in the figure. Figure 7 As shown.

[0035] A directed differentiation cell, wherein the directed differentiation cell is a neural epithelial progenitor cell (NEP), a motor neuron progenitor cell (MNP), or an iMN, and the directed differentiation cell is obtained by directed differentiation of the aforementioned iPSCs.

[0036] A plasmid comprising a pegRNA backbone (SEQ ID NO. 1) initiated by the U6 promoter and a Nick-sgRNA (SEQ ID NO. 2) initiated by the U6 promoter, wherein the plasmid number is SEQ ID NO. 27.

[0037] A method for constructing the above plasmid includes the following steps:

[0038] S1. Based on the ISS-N1 site of the human SMN2 gene, an sgRNA containing a specific target ISS-N1 site was designed and synthesized. At the same time, two Bbs1 restriction sites were added to the end of the sgRNA sequence to construct a pegRNA backbone vector.

[0039] S2. Using the reverse sgRNA as Nick-sgRNA, the corresponding primers were synthesized. At the same time, the ADDGENE42230 plasmid was cut with Bbs1, and the Nick-sgRNA expression cassette containing the U6 promoter was amplified and ligated into the pegRNA backbone. Finally, a plasmid containing the pegRNA backbone and the Nick-sgRNA expression cassette was constructed (pegRNA-Nick, the pegRNA-Nick plasmid sequence number is shown as SEQ ID NO.27).

[0040] Preferably, the reverse sgRNA is a reverse sgRNA located 45 bases downstream of the pegRNA editing site of ISS-N1.

[0041] Choosing this reverse sgRNA can significantly improve editing efficiency.

[0042] PE can only introduce mutations into single-stranded DNA that is not bound to pegRNA, while the pegRNA-binding strand remains in its original state. To promote the repair of the binding strand, the binding strand is cleaved 40-90 nt downstream of the pegRNA cleavage site, allowing it to use the non-pegRNA-binding DNA single-strand as a template for repair, thus improving editing efficiency.

[0043] Preferably, the U6 promoter contained in the Nick-sgRNA expression cassette and pegRNA backbone can also be replaced by CMV or H1.

[0044] A plasmid containing Nick-sgRNA (SEQ ID NO.2) and pegRNA.

[0045] Preferably, the sequence number of the plasmid is as shown in SEQ ID NO.25 or SEQ ID NO.26.

[0046] Preferably, the pegRNA is pegRNA-1527 (SEQ ID NO.7) or pegRNA-1327 (SEQ ID NO.8).

[0047] The pegRNA can also be pegRNA of other lengths, such as any one of SEQ ID NO.20-23. For example, pegRNA-1524, although its precise deletion efficiency is lower than that of pegRNA-1527 and pegRNA-1327, still enhances the expression of full-length SMN protein.

[0048] A method for constructing the above-mentioned pegRNA includes the following steps:

[0049] A1. The plasmid pegRNA-Nick, which contains the pegRNA backbone and Nick-sgRNA expression cassette, was cut with Bbs1. Primers were designed and synthesized based on the sequence of 9 bases deleted at the ISS-N1 site. The mixture was then slowly annealed at high temperature to form a double strand.

[0050] A2. The double strand is ligated to the pegRNA-Nick digestion product to construct a pegRNA containing SNick-sgRNA and pegRNA.

[0051] Preferably, the primers comprise RT and PBS of different lengths.

[0052] Preferably, the length of RT is 19nt, 24nt, or 27nt.

[0053] Preferably, the length of the PBS is 13 nt or 15 nt.

[0054] There are 6 possible combinations of RT and PBS: when PBS is 13nt, the combinations are 1319, 1324, and 1327; when PBS is 15nt, the combinations are 1519, 1524, and 1527.

[0055] In this invention, any plasmid that can express pegRNA, Nick-sgRNA and PE protein targeting the ISS-N1 site can be used as one of the options in this application.

[0056] The use of Nick-sgRNA as shown in SEQ ID NO.2 or pegRNA as shown in SEQ ID NO.7 or SEQ ID NO.8 in the preparation of drugs or reagents for relieving or treating spinal muscular atrophy.

[0057] A pharmaceutical composition for relieving or treating spinal muscular atrophy, said pharmaceutical composition containing Nick-sgRNA as shown in SEQ ID NO.2 or pegRNA as shown in SEQ ID NO.7 or SEQ ID NO.8.

[0058] A kit containing Nick-sgRNA as shown in SEQ ID NO.2 or pegRNA as shown in SEQ ID NO.7 or SEQ ID NO.8.

[0059] The above-mentioned kit is used in the preparation of reagents to alleviate or treat spinal muscular atrophy.

[0060] The present invention will be further explained below:

[0061] To date, there are no reported studies on using PE (penetrating protein) to treat SMA, nor are there any studies demonstrating that deleting 9 bases from the ISS-N1 core sequence can make the SMN2 gene include exon 7. This invention constructs a PE gene editing system that precisely deletes 9 bases from the ISS-N1 core sequence for SMA gene therapy, and demonstrates, at both the iPSCs and iMNs stages, that precisely deleting 9 bases effectively increases the mRNA and protein expression of the full-length SMN.

[0062] Compared with existing technologies that design sgRNAs targeting the ISS-N1 site of the SMN2 gene and then use Cas9 to specifically edit the ISS-N1 site under the guidance of the sgRNA, causing random insertions or deletions to disrupt splicing regulatory elements, this invention achieves precise deletion of the ISS-N1 core sequence based on PE targeted editing technology, which has the following unique advantages and innovations: (1) The PE system cuts single strands, which, compared with Cas9, is less likely to produce random insertions or deletions and is also less likely to cause off-target effects; (2) The reported strategies produce deletion fragments of random and uncontrollable size, which can easily lead to situations where editing occurs but the clone is not a repair clone. However, the pegRNA used in this invention has both targeting and repair template functions, which can achieve precise base deletion. All nine edited clones obtained in the two experimental groups were repair clones; (3) The reported strategies produce deletion fragments of more than 15 bases, while this study found that only nine bases in the ISS-N1 core region need to be deleted, which can effectively increase the expression of the full-length SMN. In summary, this invention not only greatly improves the repair efficiency but also greatly enhances the safety.

[0063] Current research by Li Jin-Jing et al. reported that among 13 clones that underwent Cas9-specific editing of the ISS-N1 site, four clones did not increase the full-length SMN2 transcript. The editing occurred at the ISS-N1 site in these four clones, but the specific bases edited were not identified. Their results showed that the functional clones had deletions of 15 and 20 bases at the ISS-N1 site. These clones, with deletions of 15 and 20 bases respectively, were able to transcribe a full-length SMN transcript similar to that of normal human cells. However, the number of missing bases was excessive.

[0064] To minimize impact on the genome, this invention utilizes the restriction-specific design of the PAM sequence in the PE system to implement a 9-base deletion at the ISS-N1 site of the SMN2 gene. Clones with this 9-base deletion can transcribe a full-length SMN transcript similar to that of normal human cells. Furthermore, this study optimized the implementation conditions of PE, ultimately selecting pegRNA-1527N and pegRNA-1327N for achieving the 9-base deletion at the ISS-N1 site of the SMN2 gene. Compared to existing technologies, this application involves a smaller number of bases (9 bases), and the results show that the gene repair efficiency of this invention is higher.

[0065] The beneficial effects of this invention are as follows:

[0066] Spinraza, a therapeutic drug based on antisense oligonucleotides (ASOs), requires patients to undergo repeated intrathecal injections throughout their lives, cannot achieve permanent restoration of SMN expression, and is extremely expensive.

[0067] The strategy of disrupting splicing regulatory elements by specifically editing the ISS-N1 site with Cas9 to randomly generate insertions or deletions has been found in reported studies to have failed to increase the expression level of SMN protein in nearly one-third of the edited clones.

[0068] To overcome the shortcomings of the aforementioned techniques, this invention utilizes pegRNA-guided PE technology to precisely delete only 9 bases in the core region of ISS-N1, thereby disrupting the binding of splicing repressor factors. All the resulting edited clones significantly increased the expression level of SMN protein, establishing a precise, efficient, and genomically minimal in situ gene therapy technique for SMA.

[0069] All positive clones obtained in this invention have the same genotype, exhibiting a precise deletion of the same 9 bases at the ISSN1 site of the SMN2 gene. Furthermore, the clones disclosed in the examples were randomly selected from all clones, and other undisclosed clones also showed similar results, all capable of increasing the full-length transcript. Therefore, these genotype-consistent clones of this invention can all increase the full-length transcript. Its accuracy and efficiency in increasing SMN protein expression levels are significantly higher than existing technologies. Attached Figure Description

[0070] Figure 1 for Figure 1 .Prime Editing diagram;

[0071] Among them, nCas9 (H840A) is a single-stranded Cas9 cleavage enzyme; RT is an MLV reverse transcriptase; PBS, RT template and sgRNA scaffold make up pegRNA, where PBS is the primer binding sequence and RT template is the reverse transcription template, which can introduce specific mutations;

[0072] Figure 2 Annealing reaction conditions for 1527F / R and 1327F / R;

[0073] Figure 3 For accurate detection of SMN expression in missing clones;

[0074] Among them, A. FL-SMN mRNA transcription level detection; B. Δ7-SMN mRNA transcription level detection; C. SMN protein expression level in precisely deleted clones, with β-actin as an internal reference; D. Statistical results of SMN protein expression, *, P<0.05, **, P<0.01;

[0075] Figure 4 A schematic diagram illustrating the directed differentiation of iPSCs into iMNs;

[0076] Figure 5 Detection of surface biomarkers for iMNs in directed differentiation of iPSCs;

[0077] Among them, motor neuron progenitor cells expressing OLI-2 positive were differentiated on day 12, early motor neurons expressing SMI32 and ISL1 positive were differentiated on day 18, and mature motor neurons expressing ChAT positive were differentiated on day 28.

[0078] Figure 6 For the precise detection of SMN expression in iMNs-stage deletion clones;

[0079] The study included: A. FL-SMN mRNA transcription level detection; B. SMN protein expression level in precisely deleted clones, with β-actin as an internal control; and C. Statistical results of SMN protein expression. (Note: The original text contains inconsistencies and inconsistencies in the data. A more accurate translation would require the full context.)

[0080] Figure 7 The sequencing results of iPSCs with 9 bases precisely deleted are shown in the figure. Detailed Implementation

[0081] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments that do not specify specific conditions are generally performed according to conventional conditions such as those described in J. Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd Edition, Science Press, 2002, or according to the manufacturer's recommendations.

[0082] Example 1

[0083] (1) Construction of pegRNA

[0084] 1.1 The plasmid pegRNA-Nick, containing a pegRNA backbone initiated by the U6 promoter and the Nick-sgRNA listed in the table above initiated by the U6 promoter, was designed and synthesized. The specific sequence is shown in Table 1:

[0085] Table 1 shows the primer sequences required.

[0086]

[0087]

[0088]

[0089] After digesting the plasmid with BBSI, six combinations (13nt and 15nt) of different PBS lengths (19nt, 24nt, and 27nt) and different RT lengths (19nt, 24nt, and 27nt) were used (1319F / R, 1324F / R, 1327F / R, 1519F / R, 1524F / R, and 1527F / R). When the PBS was 13nt, the RT could be 19nt, 24nt, or 27nt, with primers of 1319F / R, 1324F / R, and 1327F / R, respectively. When the PBS was 15nt, the RT could be 19nt, 24nt, or 27nt, with primers of 1519F / R, 1524F / R, and 1527F / R, respectively. These primers were annealed and then ligated to the pegRNA-Nick digested product. This example only uses 1527F / R and 1327F / R; the other combinations are the same.

[0090] The enzyme digestion system is as follows:

[0091]

[0092] Incubate for 2-3 hours.

[0093] 1.2 Annealing of 1527F / R and 1327F / R, the reaction system for annealing is as follows:

[0094]

[0095] The conditions for the annealing reaction are as follows: Figure 2 As shown.

[0096] 1.3 The annealing product from 1.2 was ligated into the pegRNA-Nick digestion product from 1.1 and then transformed.

[0097] The connected reaction system is as follows:

[0098]

[0099] Incubate at 22°C for 2 hours.

[0100] 1.3.1 Remove the DH5α competent cells from -80℃ and thaw them on ice for 5 min;

[0101] 1.3.2 Gently mix 10 μL of the above ligation product with 50 μL of DH5α competent cells and let stand on ice for 30 min;

[0102] 1.3.3 Simultaneously turn on the water bath and set the temperature to 42℃;

[0103] 1.3.4 Place the mixture in a water bath for 90 seconds and then let it stand on ice for 2 minutes;

[0104] 1.3.5 Add 100 μL of antibiotic-free LB solution to the clean bench and incubate at 37°C on a shaker at 180 rpm for 45 min;

[0105] 1.3.6 In a clean bench, spread all the liquid onto a solid LB agar plate containing ampicillin resistance and incubate overnight at 37°C;

[0106] 1.3.7 On the second day, five white single colonies were picked and placed in liquid LB medium containing ampicillin, labeled, and incubated on a shaker at 37°C for 7 hours at 220 rpm.

[0107] 1.3.8 The bacterial culture was sent to a biotechnology company for sequencing;

[0108] 1.3.9 Plasmids pegRNA-1527N (containing SEQ ID NO.2 and SEQ ID NO.8, the full sequence of which is shown in SEQ ID NO.25) and pegRNA-1327N (containing SEQ ID NO.2 and SEQ ID NO.7, the full sequence of which is shown in SEQ ID NO.26) were constructed.

[0109] (2) Medium-scale extraction of pegRNA and PE expression plasmid

[0110] 2.1 Take a 50 mL centrifuge tube, aspirate the bacterial solution into the centrifuge tube in a clean bench, add 30 mL of LB liquid containing ampicillin, and incubate on a shaker at 37°C for 220 rpm for 12 h.

[0111] 2.2 Use the OMEGA EZNA Plasmid Midi Kit to extract plasmids according to the instructions and label them.

[0112] 2.3 The plasmid concentration was determined using Nanodrop 1000, labeled on the tube wall, and stored at -20℃ for subsequent experiments.

[0113] (3) Optimal pegRNA screening

[0114] 3.1 Take a 6-well cell culture plate and seed 7 × 10⁶ cells per well. 5 Take one HEK293T cell, shake well in a cross shape, and place in a cell culture incubator for culture. Change the medium every other day.

[0115] 3.2 When the cells reach a confluence of 40%, discard the old culture medium. Add 2 mL of fresh culture medium to each well;

[0116] 3.3 After 2 hours, remove the jetPRIME kit (containing buffer and jetPRIME reagent) and allow it to equilibrate at room temperature;

[0117] 3.4 Add 200 μL buffer and 2 μg GFP plasmid to the first EP tube; add 200 μL buffer and 1.5 μg PE expression plasmid to the second to seventh EP tubes, and add 0.5 μg of the six plasmids constructed above (plastmids: pegRNA-1319N, pegRNA-1324N, pegRNA-1327N, pegRNA-1519N, pegRNA-1524N, and pegRNA-1527N) to each tube. After mixing, add 8 μL jetPRIME reagent to each tube, mix again, and incubate at room temperature for 10 min.

[0118] 3.5 Gently add the liquid from the EP tube to the cell culture medium, mix well, and label. Incubate at 37°C in a cell culture incubator.

[0119] 3.6 Change the medium after 12-16 hours and place the cell culture incubator to continue culturing;

[0120] 3.7 72 h after transfection, cells were collected in a drawer for gDNA, amplified using ISSN-F / R, and then sent to a biotechnology company for deep sequencing;

[0121] 3.8 To achieve a more efficient 9-nt deletion at the ISS-N1 site of the SMN2 gene within the genome, we analyzed the percentage of reads with a precise 9-nt deletion at the ISS-N1 site of the SMN2 gene obtained from sequencing results (results are shown in Tables 2 and 3). The results showed that plasmids pegRNA-1527N and pegRNA-1327N were highly efficient, meaning that when the RT length was 27 nt and the PBS length was 13 nt or 15 nt, the efficiency of precisely deleting 9 bases at the ISS-N1 site was high, and this can be used for subsequent research.

[0122] The results are shown in Tables 2 and 3. 72 hours after transfecting HEK-293T cells, gDNA was extracted using the phenol-chloroform method, followed by PCR amplification. The amplified products were sent to a biotechnology company for deep sequencing. The editing efficiency of the corresponding plasmid was calculated by analyzing the number of reads with precise deletion of 9 bases in the total number of sequencing reads. When the PBS length was fixed at 13 nt, and the RT template lengths were 19 nt, 24 nt, and 27 nt, the efficiencies for precisely deleting 9 bases at the ISS-N1 site of the SMN2 gene were 2.63%, 8.24%, and 18.61%, respectively (i.e., reads with precisely deleted 9 bases accounted for 18.61% of the total sequencing reads), as shown in Table 2. This indicates that a PBS length of 13 nt and an RT template length of 27 nt can efficiently achieve precise deletion of 9 bases at the ISS-N1 site of the SMN2 gene. When the PBS length was fixed at 15 nt, and the RT template lengths were 19 nt, 24 nt, and 27 nt, the efficiencies for precisely deleting 9 bases at the ISS-N1 site of the SMN2 gene were 1.68%, 6.78%, and 16.15%, respectively (i.e., reads with precisely deleted 9 bases accounted for 16.15% of the total sequencing reads), as shown in Table 3. As shown, a PBS length of 15 nt and a RT template length of 27 nt can efficiently achieve a precise deletion of 9 bases at the ISS-N1 site of the SMN2 gene. Therefore, the highest efficiency in achieving a precise deletion of 9 bases at the ISS-N1 site of the SMN2 gene is achieved when the PBS length is 13 nt and the RT length is 27 nt (i.e., pegRNA-1327N) and when the PBS length is 15 nt and the RT length is 27 nt (i.e., pegRNA-1527N). These two plasmids will be used in subsequent studies.

[0123] Table 2. Precise deletion efficiency of pegRNA with different RT lengths in 13nt PBS.

[0124]

[0125] Table 3. Precise deletion efficiency of pegRNA with different RT lengths in 15nt PBS.

[0126]

[0127]

[0128] (4) Combining PE with pegRNA-transferred SMA patient-specific iPSCs (SMA-iPSCs)

[0129] SMA-iPSCs were obtained by reprogramming cells isolated from the urine of SMA patients. The reprogramming method is existing and similar to the method reported in reference 14.

[0130] 4.1 The day before nuclear transfer, coat four wells of a 12-well plate with Matrigel;

[0131] 4.2 When the SMA-iPSCs cells reached 80% confluence, replace the medium with fresh mTeSR Plus medium and add Y27632 to a final concentration of 10 nM. Place the cells in an incubator and incubate statically for 2 hours.

[0132] 4.3 After 2 hours, remove the cells, gently pipette them, and discard the culture medium. Rinse the cells three times with 1×DPBS, add TrypLE Select until the cells are submerged, and digest at 37°C for no more than 5 minutes.

[0133] 4.4 Simultaneously, take out the Amaxa Human Stem Cell Nucleofector Starter Kit, take a sterile EP tube, add 18 μL of Supplement 1 and 82 μL of Solution 2, mix gently, and let stand for 15 min;

[0134] 4.5 Discard TrypLE Select and gently pipette the cells 2-3 times with 1 mL of mTeSR Plus medium to completely detach the cells;

[0135] 4.6 Take a 15mL centrifuge tube and transfer the cell suspension into the centrifuge tube;

[0136] 4.7 Count the cells using a red blood cell counter; the total number of cells must be greater than 10. 6 indivual;

[0137] 4.8 Centrifuge at 175g for 5 minutes;

[0138] 4.9 After the incubation period, add 6 μg of PE expression plasmid and 2 μg of pegRNA-1527N (or 2 μg of pegRNA-1327N) plasmid to the EP tube, mix gently, and incubate at room temperature for 5 min.

[0139] 4.10 After centrifugation, aspirate the supernatant from the 15 mL centrifuge tube and spot-dissolve the remaining liquid on the tube wall. Resuspend the cell pellet in the centrifuge tube with nuclear transfer buffer in the EP tube, and then carefully transfer the cell suspension to the nuclear transfer cup.

[0140] 4.11 Turn on the nuclear transfer instrument, select program B016, place the nuclear transfer cup into the nuclear transfer instrument, and start nuclear transfer;

[0141] 4.12 Immediately after nuclear transfer is complete, add 500 μL of mTeSR Plus medium to the nuclear transfer vessel and let it stand for 5 min;

[0142] 4.13 Discard Matrigel used for coating well plates;

[0143] 4.14 Seed the cell suspension; add 10 μM Y27632;

[0144] 4.15 Shake well, place in a cell culture incubator and let stand. Change the medium 12 hours after nuclear transformation (use mTeSRPlus medium containing 10 μM Y27632);

[0145] 4.16 After nuclear transfer for 24 hours, the medium was changed using regular mTeSR Plus medium.

[0146] (5) Single-cell cloning

[0147] 5.1 One day before single-cell seeding, line a 6cm cell culture dish with Matrigel;

[0148] 5.2 Remove the cells after nuclear transformation, rinse the cells once with 1×DPBS, add TrypLE Select until the cells are submerged, and digest at 37°C for no more than 5 minutes;

[0149] 5.3 Discard the TrypLE Select cells and gently pipette them 2-3 times with 1 mL of mTeSR Plus medium to completely detach the cells. Count the cells and resuspend 300-500 cells in Clone R medium, then seed them into 6 cm cell culture dishes.

[0150] 5.4 After 10-14 days of culture, when the cells in the 6cm cell culture dish have grown to half the microscope field of view, coat the 48-well cell culture plate with Matrigel overnight.

[0151] 5.5 Discard the Matrigel from the well plate and add an appropriate amount of mTeSR Plus medium to each well until it covers the bottom of the plate.

[0152] 5.6 Under a microscope, select single-cell clones in good growth condition from 6cm cell culture dishes, and use a small tip to transfer them to 48-well cell culture plates. Label each well, and inoculate one clone per well. Place the plates in a cell culture incubator and culture. Change the medium every two days.

[0153] pegRNA-1527N and pegRNA-1327N were nuclear-transferred into SMA-iPSCs, respectively. After PCR, sequencing, and single-clone identification, 2 out of 21 pegRNA-1327N clones were edited, both having undergone SMN2 splicing correction to include Exon7. Similarly, 7 out of 24 pegRNA-1527N clones were edited, all having undergone SMN2 splicing correction to include Exon7 (see Table 4). Two clones, 1527N-8 and 1527N-25, were selected for further research.

[0154] Table 4. Results of single-cell clone analysis after nuclear transfer.

[0155]

[0156] (6) Cloning identification and SMN expression detection

[0157] 6.1 Using specific primers, the obtained clones were found to be clones with precise deletion of 9 bases. The deletion of the clones was confirmed by PCR-Sanger sequencing. TA cloning analysis was used to analyze the precise deletion of 9 bases in the SMN2 copy in each clone.

[0158] 6.2 The levels of full-length SMN mRNA (FL-SMN) and SMN mRNA deleting exon 7 (Δ7-SMN mRNA) were detected by RT-qPCR.

[0159] 6.3 The level of full-length SMN protein was detected by Western blot.

[0160] After obtaining single-cell clones, we used RT-qPCR and Western blot to detect the levels of FL-SMN mRNA, Δ7-SMN mRNA, and full-length SMN protein in the clones. RT-qPCR revealed that FL-SMN mRNA was significantly increased in precisely deleted clones 1527N-8 and 1527N-25 compared to SMA-specific iPSCs (Figure 3A), while the corresponding Δ7-SMN mRNA was significantly decreased. Figure 3 B) indicates that the Exon 7 splicing of SMN2 has been altered. Total protein was extracted from the cell lysate and analyzed by Western blot of SMN protein. As shown in Figures 3C and 3D, the SMN protein levels were significantly increased in cells 1527N-8 and 1527N-25.

[0161] (7) iPSCs differentiate into iMNs

[0162] like Figure 4As shown, different small chemical molecules were added at different time periods.

[14] iPSCs were induced to differentiate into mature motor neurons (iMNs) using MN-induced differentiation medium (50% DMEM / F12, 50% Neurobasal Medium, 0.5×N2, 0.5×B27, 0.1mM ascorbic acid) via neural epithelial progenitor cells (NEP), motor neuron progenitor cells (MNP), and finally directed differentiation. Cellular markers were detected by immunofluorescence at each stage of differentiation. The directed differentiation process is as follows:

[0163] 7.1 Pre-coating with Matrigel: After digesting the iPSCs to be differentiated with Accutase or Dispase (1 mg / mL), seed them onto Matrigel at a ratio of 1:6 and culture them with mTeSR1 for 1-2 days.

[0164] 7.2 Replace the culture medium with MN induction medium, and add 3 μM CHIR99021, 2 μM DMH1, and 2 μM SB421542 to a final concentration. This is then labeled as Day 0.

[0165] 7.3 Change the medium every other day. During the culture process, it can be observed that the cell clonal clusters gradually become looser and less dense than iPSCs. On Day 5, pre-coat with Matrigel at room temperature overnight, and coat with 24-well plates containing climbing plates.

[0166] On Day 6 of 7.4, cells were digested with dispase (1 mg / mL) for 3-5 min. The cells were gently blown off with a large tip using DMEM / F12 and transferred to a 15 mL centrifuge tube. The cells were centrifuged at room temperature for 5 min at a weight of <175 g (150 g in this experiment).

[0167] 7.5 Carefully discard the supernatant, resuspend the cells in MN induction medium, and seed the cells in 12-well plates coated with Matrigel overnight and 24-well plates with climbing slides at a ratio of 1:4 to 1:6. At the same time, add the following to a final concentration: 1 μM CHIR99021, 2 μM DMH1, 2 μM SB431542, 0.1 μM RA, and 0.5 μM Pur.

[0168] 7.6 Change the medium every other day. On Day 11, pre-coat Matrigel at room temperature overnight, while coating the wells with 24-well plate slides.

[0169] 7.7 On Day 12, cells in 12-well plates were digested with dispase (1 mg / mL) for 3-5 min. The cells were gently blown off with a large tip using DMEM / F12 and transferred to 15 mL centrifuge tubes. The cells were centrifuged at room temperature for 5 min at a weight of <175 g (150 g in this experiment). Cells seeded on the spreader were then subjected to immunofluorescence detection of the cell surface marker OLIG2 on Day 12.

[0170] 7.8 Carefully discard the supernatant, resuspend the cells in MN induction medium, and seed the cells in Matrigel-coated overnight well plates at a ratio of 1:4 to 1:6, while adding 0.5 μM RA and 0.1 μM Pur to a final concentration.

[0171] 7.9 Change the medium every other day. On Day 17, pre-coat Matrigel at room temperature overnight, while placing a 24-well plate with a smear in the well.

[0172] 7.10 On Day 18, cells in 12-well plates were digested with Accutase for 3-5 minutes. The cells were gently blown off with a large tip using DMEM / F12 and transferred to 15 mL centrifuge tubes. The cells were centrifuged at 175 g at room temperature for 5 minutes. Cells seeded on the spreader were then subjected to immunofluorescence detection of the cell surface marker MNX1 on Day 18.

[0173] 7.11 Carefully discard the supernatant, resuspend the cells in MN induction medium, and seed the cells in a 1:2 to 1:3 ratio into 12-well plates coated with Matrigel overnight and 24-well plates with climbing slides, while adding 0.5 μM RA, 0.1 μM ur, and 0.1 μM DAPT to a final concentration.

[0174] 7.12 Change the medium every other day. By Day 24-28, a large number of ChAT+ motor neuron cells can be obtained. Cells seeded on the slide are subjected to immunofluorescence detection of cell surface markers at Day 24.

[0175] SMA-iPSCs, normal human iPSCs (hiPSCs), and precisely deleted clones 1527N-8 and 1527N-25 were directed to differentiate into SMA-iMNs, hiMNs, 8-iMNs, and 25-iMNs, such as Figure 5 The image shows motor neuron progenitor cells (MNPs) expressing OLIG-2, early motor neurons expressing SMI32 and ISL1, and mature motor neurons expressing ChAT during the differentiation process, indicating successful differentiation of motor neuron cells.

[0176] (8) Detect SMN expression in the iMNs stage

[0177] 8.1 The levels of full-length SMN mRNA (FL-SMN mRNA) and SMN mRNA deleting exon 7 (Δ7-SMN mRNA) were detected by RT-qPCR.

[0178] 8.2 Full-length SMN protein levels were detected by Western blot.

[0179] The results are as follows Figure 6 As shown, RT-qPCR detection of FL-SMN mRNA levels revealed that FL-SMN mRNA levels were significantly increased in precisely deleted clones 8-iMNs and 25-iMNs compared to SMA-iMNs. Figure 6 A). Total protein was extracted from the cell lysate and analyzed by Western blot of SMN protein. The results are as follows: Figure 6 As shown in B and 6C, the FL-SMN mRNA level in 8-iMNs and 25-iMNs was significantly higher than the SMN protein level in SMA-iMNs.

[0180] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims. SEQUENCE LISTING <110> central south university <120> Methods and applications of PE-based methods for increasing SMN protein expression <130> twenty four <160> 27 <170> PatentIn version 3.5 <210> 1 <211> 114 <212> DNA <213> Artificial synthesis <400> 1 gagattcact ttcataatgc gttttagagc tagaaatagc aagttaaaat aaggctagtc 60 cgttatcaac ttgaaaaagt ggcaccgagt cggtgcgcgt cttcgagaag acgc 114 <210> 2 <211> 96 <212> DNA <213> Synthetic <400> 2 gacaaaatca aaaagaagga gttttagagc tagaaatagc aagttaaaat aaggctagtc 60 cgttatcaac ttgaaaaagt ggcaccgagt cggtgc 96 <210> 3 <211> 46 <212> DNA <213> Synthetic <400> 3 gtgctcacat tccttaaatt aaggagtaag tttatgaaag tgaatc 46 <210> 4 <211> 46 <212> DNA <213> Synthetic <400> 4 aaaagattca ctttcataaa cttactcctt aatttaagga atgtga 46 <210> 5 <211> 44 <212> DNA <213> Synthetic <400> 5 gtgctcacat tccttaaatt aaggagtaag tttatgaaag tgaa 44 <210> 6 <211> 44 <212> DNA <213> Synthetic <400> 6 aaaattcact ttcataaact tactccttaa tttaaggaat gtga 44 <210> 7 <211> 138 <212> DNA <213> Synthetic <400> 7 gagattcact ttcataatgc gttttagagc tagaaatagc aagttaaaat aaggctagtc 60 cgttatcaac ttgaaaaagt ggcaccgagt cggtgctcac attccttaaa ttaaggagta 120 agtttatgaa agtgaatc 138 <210> 8 <211> 136 <212> DNA <213> Synthetic <400> 8 gagattcact ttcataatgc gttttagagc tagaaatagc aagttaaaat aaggctagtc 60 cgttatcaac ttgaaaaagt ggcaccgagt cggtgctcac attccttaaa ttaaggagta 120 agtttatgaa agtgaa 136 <210> 9 <211> 24 <212> DNA <213> Synthetic <400> 9 aatcaaaaag aaggaaggtg ctca 24 <210> 10 <211> 26 <212> DNA <213> Synthetic <400> 10 cctttcaact ttctaacatc tgaact 26 <210> 11 <211> 29 <212> DNA <213> Synthetic <400> 11 cattccttaa attaaggagt aagtttatg 29 <210> 12 <211> 36 <212> DNA <213> Synthetic <400> 12 gtgccttaaa ttaaggagta agtttatgaa agtgaa 36 <210> 13 <211> 36 <212> DNA <213> Synthetic <400> 13 aaaattcact ttcataaact tactccttaa tttaag 36 <210> 14 <211> 41 <212> DNA <213> Synthetic <400> 14 gtgccattcc ttaaattaag gagtaagttt atgaaagtga a 41 <210> 15 <211> 41 <212> DNA <213> Synthetic <400> 15 aaaattcact ttcataaact tactccttaa tttaaggaat g 41 <210> 16 <211> 38 <212> DNA <213> Synthetic <400> 16 gtgccttaaa ttaaggagta agtttatgaa agtgaatc 38 <210> 17 <211> 38 <212> DNA <213> Synthetic <400> 17 aaaagattca ctttcataaa cttactcctt aatttaag 38 <210> 18 <211> 43 <212> DNA <213> Synthetic <400> 18 gtgccattcc ttaaattaag gagtaagttt atgaaagtga atc 43 <210> 19 <211> 43 <212> DNA <213> Synthetic <400> 19 aaaagattca ctttcataaa cttactcctt aatttaagga atg 43 <210> 20 <211> 128 <212> DNA <213> Synthetic <400> 20 gagattcact ttcataatgc gttttagagc tagaaatagc aagttaaaat aaggctagtc 60 cgttatcaac ttgaaaaagt ggcaccgagt cggtgcctta aattaaggag taagtttatg 120 aaagtgaa 128 <210> 21 <211> 133 <212> DNA <213> Synthetic <400> 21 gagattcact ttcataatgc gttttagagc tagaaatagc aagttaaaat aaggctagtc 60 cgttatcaac ttgaaaaagt ggcaccgagt cggtgccatt ccttaaatta aggagtaagt 120 ttatgaaagt gaa 133 <210> 22 <211> 130 <212> DNA <213> Synthetic <400> 22 gagattcact ttcataatgc gttttagagc tagaaatagc aagttaaaat aaggctagtc 60 cgttatcaac ttgaaaaagt ggcaccgagt cggtgcctta aattaaggag taagtttatg 120 aaagtgaatc 130 <210> 23 <211> 135 <212> DNA <213> Synthetic <400> 23 gagattcact ttcataatgc gttttagagc tagaaatagc aagttaaaat aaggctagtc 60 cgttatcaac ttgaaaaagt ggcaccgagt cggtgccatt ccttaaatta aggagtaagt 120 ttatgaaagt gaatc 135 <210> 24 <211> 30 <212> DNA <213> Synthetic <400> 24 aaggagtaag tttatgaaag tgaatcttac 30 <210> 25 <211> 2766 <212> DNA <213> Synthetic <400> 25 tctagatatc gctcaatact gaccatttaa atcatacctg acctccatag cagaaagtca 60 aaagcctccg accggaggct tttgacttga tcggcacgta agaggttcca actttcacca 120 taatgaaata agatcactac cgggcgtatt ttttgagtta tcgagatttt caggagctaa 180 ggaagctaaa atgagtattc aacatttccg tgcgccctt attcccttt ttgcggcatt 240 ttgccttcct gttttgctc acccagaaac gctggtgaaa gtaaaagatg ctgaagatca 300 gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga tccttgagag 360 tttacgcccc gaagaacgtt ttccaatgat gagcacttt aaagttctgc tatgtggcgc 420 ggtattatcc cgtattgacg ccgggcaaga gcaactcggt cgccgcatac actattctca 480 gaatgacttg gttgagtact caccagtcac agaaaagcat ctcacggatg gcatgacagt 540 aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca acttacttct 600 ggcaacgatc ggaggaccga aggagctaac cgctttttg cacaacatgg gggatcatgt 660 aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg acgagcgtga 720 caccacgatg cctgtagcaa tggcaacac gttgcgcaaa ctattaactg gcgaactact 780 tactctagct tcccggcaac attaataga ctggatggag gcggataaag ttgcaggatc 840 acttctgcgc tcggccctcc cggctggctg gtttattgct gataaatctg gagccggtga 900 gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct cccgcatcgt 960 1020 gataggtgcc tcactgatta agcattggta atgagggccc aaatgtaatc acctggctca 1080 ccttcgggtg ggcctttctg cgttgctggc gtttttccat aggctccgcc cccctgacga 1140 gcatcacaaa aatcgatgct caagtcagag gtggcgaaac ccgacaggac tataaagata 1200 ccaggcgttt ccccctggaa gctccctcgt gcgctctcct gttccgaccc tgccgcttac 1260 cggatacctg tccgcctttc tcccttcggg aagcgtggcg ctttctcata gctcacgctg 1320 taggtatctc agttcggtgt aggtcgttcg ctccaagctg ggctgtgtgc acgaaccccc 1380 cgttcagccc gaccgctgcg ccttatccgg taactatcgt cttgagtcca acccggtaag 1440 acacgactta tcgccactgg cagcagccac tggtaacagg attagcagag cgaggtatgt 1500 aggcggtgct acagagttct tgaagtggtg gcctaactac ggctacacta gaaacagt 1560 atttggtatc tgcgctctgc tgaagccagt tacctcggaa aaagagttgg tagctcttga 1620 tccggcaaac aaaccaccgc tggtagcggt ggtttttttg tttgcaagca gcagattacg 1680 cgcagaaaaa aaggatctca agaagatcct ttgatttct accgaagaaa ggcccacccg 1740 tgaaggtgag ccagtgagtt gattgcagtc cagttacgct ggagtctgag gctcgtcctg 1800 aatgatatca agcttgaatt cgagctcggt accgagggcc tatttcccat gattccttca 1860 tatttgcata tacgatacaa ggctgttaga gagataatta gaattaattt gactgtaaac 1920 acaaagatat tagtacaaaa tacgtgacgt agaaagtaat aatttcttgg gtagtttgca 1980 gttttaaaat tatgttttaa aatggactat catatgctta ccgtaacttg aaagtatttc 2040 gatttcttgg ctttatatat cttgtggaaa ggacgaaaca ccgagattca ctttcataat 2100 gcgttttaga gctagaaata gcaagttaaa ataaggctag tccgttatca acttgaaaaa 2160 gtggcaccga gtcggtgctc acattcctta aattaaggag taagttatg aaagtgaatc 2220 ttttttggg ccgctcgagg gatcccgaaa aacgccagca acgcggcctt tttacggttc 2280 ctggcctttt gctggccttt tgctcacatg tgagggccta tttcccatga ttccttcata 2340 tttgcatata cgatacaagg ctgttagaga gataattgga attaatttga ctgtaaacac 2400 aaagatatta gtacaaaata cgtgacgtag aaagtaataa tttcttgggt agtttgcagt 2460 tttaaaatta tgttttaaaa tggactatca tatgcttacc gtaacttgaa agtatttcga 2520 tttcttggct ttatatatct tgtggaaagg acgaaacacc gacaaaatca aaaagaagga 2580 gttttagagc tagaaatagc aagttaaaat aaggctagtc cgttatcaac ttgaaaaagt 2640 ggcaccgagt cggtgctttt ttgttttaga gctagaaata gcaagttaaa ataaggctag 2700 tccgttttta gcgcgtgcgc caattctgca ggatcccggg cccgtcgact gcagaggcct 2760 gcatgc 2766 <210> 26 <211> 2764 <212> DNA <213> Synthetic <400> 26 tctagatatc gctcaatact gaccatttaa atcatacctg acctccatag cagaaagtca 60 aaagcctccg accggaggct tttgacttga tcggcacgta agaggttcca actttcacca 120 taatgaaata agatcactac cgggcgtatt ttttgagtta tcgagatttt caggagctaa 180 ggaagctaaa atgagtattc aacatttccg tgcgccctt attcccttt ttgcggcatt 240 ttgccttcct gttttgctc acccagaaac gctggtgaaa gtaaaagatg ctgaagatca 300 gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga tccttgagag 360 tttacgcccc gaagaacgtt ttccaatgat gagcacttt aaagttctgc tatgtggcgc 420 ggtattatcc cgtattgacg ccgggcaaga gcaactcggt cgccgcatac actattctca 480 gaatgacttg gttgagtact caccagtcac agaaaagcat ctcacggatg gcatgacagt 540 aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca acttacttct 600 ggcaacgatc ggaggaccga aggagctaac cgctttttg cacaacatgg gggatcatgt 660 aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg acgagcgtga 720 caccacgatg cctgtagcaa tggcaacac gttgcgcaaa ctattaactg gcgaactact 780 tactctagct tcccggcaac attaataga ctggatggag gcggataaag ttgcaggatc 840 acttctgcgc tcggccctcc cggctggctg gtttattgct gataaatctg gagccggtga 900 gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct cccgcatcgt 960 1020 gataggtgcc tcactgatta agcattggta atgagggccc aaatgtaatc acctggctca 1080 ccttcgggtg ggcctttctg cgttgctggc gtttttccat aggctccgcc cccctgacga 1140 gcatcacaaa aatcgatgct caagtcagag gtggcgaaac ccgacaggac tataaagata 1200 ccaggcgttt ccccctggaa gctccctcgt gcgctctcct gttccgaccc tgccgcttac 1260 cggatacctg tccgcctttc tcccttcggg aagcgtggcg ctttctcata gctcacgctg 1320 taggtatctc agttcggtgt aggtcgttcg ctccaagctg ggctgtgtgc acgaaccccc 1380 cgttcagccc gaccgctgcg ccttatccgg taactatcgt cttgagtcca acccggtaag 1440 acacgactta tcgccactgg cagcagccac tggtaacagg attagcagag cgaggtatgt 1500 aggcggtgct acagagttct tgaagtggtg gcctaactac ggctacacta gaaacagt 1560 atttggtatc tgcgctctgc tgaagccagt tacctcggaa aaagagttgg tagctcttga 1620 tccggcaaac aaaccaccgc tggtagcggt ggtttttttg tttgcaagca gcagattacg 1680 cgcagaaaaa aaggatctca agaagatcct ttgatttct accgaagaaa ggcccacccg 1740 tgaaggtgag ccagtgagtt gattgcagtc cagttacgct ggagtctgag gctcgtcctg 1800 aatgatatca agcttgaatt cgagctcggt accgagggcc tatttcccat gattccttca 1860 tatttgcata tacgatacaa ggctgttaga gagataatta gaattaattt gactgtaaac 1920 acaaagatat tagtacaaaa tacgtgacgt agaaagtaat aatttcttgg gtagtttgca 1980 gttttaaaat tatgttttaa aatggactat catatgctta ccgtaacttg aaagtatttc 2040 gatttcttgg ctttatatat cttgtggaaa ggacgaaaca ccgagattca ctttcataat 2100 gcgttttaga gctagaaata gcaagttaaa ataaggctag tccgttatca acttgaaaaa 2160 gtggcaccga gtcggtgctc acattcctta aattaaggag taagttatg aaagtgaatt 2220 tttttgggcc gctcgagggga tcccgaaaaa cgccagcaac gcggcctttt tacggttcct 2280 ggccttttgc tggccttttg ctcacatgtg agggcctatt tcccatgatt ccttcatatt 2340 tgcatatacg atacaaggct gttagagaga taattggaat taatttgact gtaaacacaa 2400 agatattagt acaaaatacg tgacgtagaa agtaataatt tcttgggtag tttgcagttt 2460 taaaattatg ttttaaaatg gactatcata tgcttaccgt aacttgaaag tatttcgatt 2520 tcttggcttt atatatcttg tggaaaggac gaaacaccga caaaatcaaa aagaaggagt 2580 tttagagcta gaaatagcaa gttaaaataa ggctagtccg ttatcaactt gaaaaagtgg 2640 caccgagtcg gtgctttttt gttttagagc tagaaatagc aagttaaaat aaggctagtc 2,700 cgtttttagc gcgtgcgcca attctgcagg atcccgggcc cgtcgactgc agaggcctgc 2,760 atgc 2,764 <210> 27 <211> 2,742 <212> DNA <213> Synthetic <400> 27 tctagatatc gctcaatact gaccatttaa atcatacctg acctccatag cagaaagtca 60 aaagcctccg accggaggct tttgacttga tcggcacgta agaggttcca actttcacca 120 taatgaaata agatcactac cgggcgtatt ttttgagtta tcgagatttt caggagctaa 180 ggaagctaaa atgagtattc aacatttccg tgcgccctt attcccttt ttgcggcatt 240 ttgccttcct gttttgctc acccagaaac gctggtgaaa gtaaaagatg ctgaagatca 300 gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga tccttgagag 360 tttacgcccc gaagaacgtt ttccaatgat gagcacttt aaagttctgc tatgtggcgc 420 ggtattatcc cgtattgacg ccgggcaaga gcaactcggt cgccgcatac actattctca 480 gaatgacttg gttgagtact caccagtcac agaaaagcat ctcacggatg gcatgacagt 540 aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca acttacttct 600 ggcaacgatc ggaggaccga aggagctaac cgctttttg cacaacatgg gggatcatgt 660 aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg acgagcgtga 720 caccacgatg cctgtagcaa tggcaacac gttgcgcaaa ctattaactg gcgaactact 780 tactctagct tcccggcaac attaataga ctggatggag gcggataaag ttgcaggatc 840 acttctgcgc tcggccctcc cggctggctg gtttattgct gataaatctg gagccggtga 900 gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct cccgcatcgt 960 1020 gataggtgcc tcactgatta agcattggta atgagggccc aaatgtaatc acctggctca 1080 ccttcgggtg ggcctttctg cgttgctggc gtttttccat aggctccgcc cccctgacga 1140 gcatcacaaa aatcgatgct caagtcagag gtggcgaaac ccgacaggac tataaagata 1200 ccaggcgttt ccccctggaa gctccctcgt gcgctctcct gttccgaccc tgccgcttac 1260 cggatacctg tccgcctttc tcccttcggg aagcgtggcg ctttctcata gctcacgctg 1320 taggtatctc agttcggtgt aggtcgttcg ctccaagctg ggctgtgtgc acgaaccccc 1380 cgttcagccc gaccgctgcg ccttatccgg taactatcgt cttgagtcca acccggtaag 1440 acacgactta tcgccactgg cagcagccac tggtaacagg attagcagag cgaggtatgt 1500 aggcggtgct acagagttct tgaagtggtg gcctaactac ggctacacta gaaacagt 1560 atttggtatc tgcgctctgc tgaagccagt tacctcggaa aaagagttgg tagctcttga 1620 tccggcaaac aaaccaccgc tggtagcggt ggtttttttg tttgcaagca gcagattacg 1680 cgcagaaaaa aaggatctca agaagatcct ttgatttct accgaagaaa ggcccacccg 1740 tgaaggtgag ccagtgagtt gattgcagtc cagttacgct ggagtctgag gctcgtcctg 1800 aatgatatca agcttgaatt cgagctcggt accgagggcc tatttcccat gattccttca 1860 tatttgcata tacgatacaa ggctgttaga gagataatta gaattaattt gactgtaaac 1920 acaaagatat tagtacaaaa tacgtgacgt agaaagtaat aatttcttgg gtagtttgca 1980 gttttaaaat tatgttttaa aatggactat catatgctta ccgtaacttg aaagtatttc 2040 gatttcttgg ctttatatat cttgtggaaa ggacgaaaca ccgagattca ctttcataat 2100 gcgttttaga gctagaaata gcaagttaaa ataaggctag tccgttatca acttgaaaaa 2160 gtggcaccga gtcggtgcgc gtcttcgaga agacgcttttt tttgggccgc tcgagggatc 2220 ccgaaaaacg ccagcaacgc ggccttttta cggttcctgg ccttttgctg gccttttgct 2280 cacatgtgag ggcctatttc ccatgattcc ttcatatttg catatacgat acaagctgt 2340 Tagagagata Attggaatta Atttgactgt aaacacaag Atattac Aaatacgtg 2400 acgtagaaag taataatttc ttgggtagtt tgcagtttta aaattatgtt ttaaaatgga 2460 ctatcatatg cttaccgtaa cttgaaagta ttcgatttc ttggctttat atatcttgtg 2520 gaaaggacga aaaccgaca aaatcaaaaa gaaggagtttt tagagctaga atagxaagt 2580 taaaatagg ctagtccgtt atcaacttga aaagtgca ccgagtcggt gctttttgt 2640 tttagagcta gaatagcaa gttaaaataa ggctagtccg ttttagcgc gtgcgccaat 2700 tctgcaggat cccggccccg tcgactgcag aggctgcat gc 2742

Claims

1. A method for increasing SMN protein expression, characterized in that, include: A PE gene editing system with a precise deletion of 9 bases in the ISS-N1 core sequence was constructed. This system includes pegRNA, Nick-sgRNA, and PE protein targeting the ISS-N1 site, or plasmids expressing pegRNA, Nick-sgRNA, and PE protein targeting the ISS-N1 site. The system was then introduced into cells for gene editing, precisely deleting 9 bases in the ISS-N1 core sequence of the SMN2 gene to increase the expression of full-length SMN mRNA and protein. The cells in question are human induced pluripotent stem cells and their derivatives. Nick-sgRNA is shown in SEQ ID NO. 2, and pegRNA is shown in SEQ ID NO. 7 or SEQ ID NO. 8; The method for increasing SMN protein expression is not for therapeutic purposes.

2. The method for increasing SMN protein expression according to claim 1, characterized in that, The method for constructing the pegRNA includes the following steps: A1. The plasmid pegRNA-Nick, which contains the pegRNA backbone and Nick-sgRNA expression cassette, was cut with Bbs1. Primers were designed and synthesized based on the sequence of 9 bases deleted at the ISS-N1 site. The mixture was then slowly annealed at high temperature to form a double strand. A2. The double strand is ligated to the pegRNA-Nick digestion product to construct the pegRNA.

3. The method according to claim 1, characterized in that, The method is applied to human induced pluripotent stem cells, including: providing sgRNA targeting the ISS-N1 site of the splice silencer intron 7 of the SMN2 gene, constructing a targeting plasmid, performing gene editing on iPSCs, and obtaining gene-edited cell lines.

4. The method according to claim 3, characterized in that, The human induced pluripotent stem cells may also be derived from them, such as iNEP, iMNP, or iMNs.

5. An iPSC, characterized in that, The iPSCs precisely delete 9 bases from the ISS-N1 core sequence; the iPSCs have the sequence: AAGGAGTAAGTTTATGAAAGTGAATCTTAC (SEQ ID NO. 24), and the iPSCs are obtained by the method described in claim 1.

6. A type of directed differentiation cell, characterized in that, The directed differentiation cells are neural epithelial progenitor cells, motor neuron progenitor cells, or mature motor neurons (iMNs), and the directed differentiation cells are obtained by directed differentiation of iPSCs as described in claim 5.

7. A plasmid, characterized in that, It contains Nick-sgRNA and pegRNA; the sequence number of the pegRNA is shown in SEQ ID NO. 7 or SEQ ID NO. 8, and the Nick-sgRNA is shown in SEQ ID NO.

2.

8. A method for constructing the plasmid of claim 7, characterized in that, Includes the following steps: S1. Based on the ISS-N1 site of the human SMN2 gene, an sgRNA containing a specific target ISS-N1 site was designed and synthesized. At the same time, two Bbs1 restriction sites were added to the end of the sgRNA sequence to construct a pegRNA backbone vector. S2. Using the reverse sgRNA as Nick-sgRNA, synthesize the corresponding primers, and simultaneously cut the ADDGENE 42230 plasmid with Bbs1. Then, amplify the Nick-sgRNA expression cassette containing the U6 promoter, link it to the pegRNA backbone, and finally construct the plasmid described in claim 7.

9. The use of Nick-sgRNA as shown in SEQ ID NO. 2 and pegRNA as shown in SEQ ID NO. 7 or SEQ ID NO. 8 in the preparation of medicaments or reagents for the relief or treatment of spinal muscular atrophy.

10. A pharmaceutical composition for relieving or treating spinal muscular atrophy, characterized in that, The pharmaceutical composition contains Nick-sgRNA as shown in SEQ ID NO. 2 and pegRNA as shown in SEQ ID NO. 7 or SEQ ID NO.

8.

11. A reagent kit, characterized in that, The kit contains Nick-sgRNA as shown in SEQ ID NO. 2 and pegRNA as shown in SEQ ID NO. 7 or SEQ ID NO.

8.

12. The use of the kit described in claim 11 in the preparation of a medicament for relieving or treating spinal muscular atrophy.

Images