Method and program for calculating methylation degree of bases

By calibrating the sequence analysis data of the sequencer and utilizing comethylation sites, paired end method, molecular barcoding, and multiple sequence analyses, the problem of inaccurate quantification of base methylation in bisulfite sequencing was solved, achieving higher precision in base methylation calculation.

CN115427587BActive Publication Date: 2026-01-02FUJIFILM CORP
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202080098492.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2020-03-25
Filing Date
2020-11-10
Publication Date
2026-01-02
Estimated Expiration
2040-11-10

AI Technical Summary

Technical Problem

In existing technologies, bisulfite sequencing has limited accuracy in quantifying the degree of base methylation in DNA, mainly due to uncertainties caused by errors in bisulfite treatment, PCR amplification, and sequencer reading.

Method used

By acquiring sequence analysis data from the sequencer, correcting read lengths using quality information, removing erroneous data, and employing methods such as comethylation sites, paired end methods, molecular barcoding, and multiple sequence analyses, the accuracy of base methylation degree calculation can be improved.

Benefits of technology

This enables more accurate calculation of the methylation degree of bases in DNA, improving the precision and reliability of quantitative analysis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115427587B_ABST
    Figure CN115427587B_ABST
Patent Text Reader

Abstract

A method for calculating a degree of methylation of a base and a program, the method for calculating a degree of methylation of a base calculating a degree of methylation of a base from sequence analysis data of DNA, the method including a step of correcting a read length from quality information of the sequence analysis data when using a co-methylation site, using paired-end reads, using molecular barcodes, or using a plurality of sequence analysis data, the program for causing a computer to execute the method for calculating a degree of methylation of a base.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to a method and a program for calculating the degree of methylation of a base from sequence analysis data of DNA. BACKGROUND

[0002] There is a phenomenon in which a methyl group is added to a carbon atom of a base constituting DNA, and the base is methylated. The methylation of a base is known to play a role as a control factor of gene expression, and is attracting attention as information useful for elucidating the mechanism of a life phenomenon or diagnosis of a disease.

[0003] There are several methods for measuring the degree of methylation of a base in DNA, and a representative one is a method using a sequencer, which is an apparatus that reads the base sequence of a nucleic acid. For example, there is a method (i.e., bisulfite sequencing method) in which bisulfite treatment, PCR (polymerase chain reaction), and sequence analysis using a sequencer are combined. When DNA is treated with bisulfite, unmethylated cytosine is converted into uracil, and on the other hand, methylated cytosine remains as cytosine. That is, by bisulfite treatment, the methylation state (unmethylated, or methylated) of cytosine is converted into sequence information (uracil or cytosine) of its position. Next, amplification of a DNA fragment is performed by PCR. In this process, uracil is converted into thymine. Next, the sequence of the amplification product is analyzed using a sequencer. By determining whether the base at the position of the analysis object is thymine or cytosine, it is possible to know the methylation state of cytosine at the target position in DNA.

[0004] For example, a method for detecting the methylation of a base by changing the bisulfite sequencing method is disclosed in Japanese Patent Application Laid-Open No. 2007-502126 and Japanese Patent Application Laid-Open No. 2005-514035. SUMMARY

[0005] Technical Problem to be Solved by the Invention

[0006] According to the bisulfite sequencing method, it is theoretically possible to quantitatively determine the degree of methylation of cytosine at any position in DNA in the range of 0 to 100%. However, in practice, there are limitations in quantitative accuracy due to conversion errors of bases at the time of bisulfite treatment, amplification errors of PCR, reading errors of a sequencer, and the like.

[0007] The embodiment of the present application is completed in view of the above circumstances.

[0008] The present application relates to a method and a program for calculating the degree of methylation of a base from sequence analysis data of DNA.

[0009] Means for Solving the Technical Problem

[0010] A specific aspect of the present application includes the following.

[0011] A method for calculating a methylation degree of a base at a target position in DNA having a co-methylation site, the method comprising the steps of:

[0012] obtaining sequence analysis data obtained by performing sequence analysis on the DNA having the co-methylation site using a sequencer;

[0013] correcting bases at the co-methylation site in reads according to quality information included in the sequence analysis data; and

[0014] calculating the methylation degree of the base at the target position from the corrected reads.

[0015] A method for calculating a methylation degree of a base at a target position in DNA having a co-methylation site, the method comprising the steps of:

[0016] obtaining sequence analysis data obtained by performing sequence analysis on the DNA having the co-methylation site using a sequencer;

[0017] correcting reads according to quality information included in the sequence analysis data, and removing reads in which bases are not consistent between the co-methylation sites;

[0018] calculating the methylation degree of the base at the target position from the remaining reads.

[0019] A method for calculating a methylation degree of a base at a target position in DNA, the method comprising the steps of:

[0020] obtaining sequence analysis data obtained by performing sequence analysis on the DNA using a next-generation sequencer by a paired-end method;

[0021] correcting paired-end reads according to quality information included in the sequence analysis data; and

[0022] calculating the methylation degree of the base at the target position from the corrected reads.

[0023] A method for calculating a methylation degree of a base at a target position in DNA, the method comprising the steps of:

[0024] obtaining sequence analysis data obtained by performing sequence analysis on the DNA using a next-generation sequencer by a paired-end method;

[0025] correcting the read length according to quality information contained in the sequence analysis data, and removing paired-end read lengths in which bases at the target position are not identical between paired-end read lengths; and

[0026] calculating the methylation degree of the base at the target position from the remaining read lengths.

[0027] <5> A method of calculating a methylation degree of a base, which calculates a methylation degree of a base at a target position in DNA, the method comprising the steps of:

[0028] obtaining sequence analysis data obtained by performing sequence analysis on DNA to which a molecular barcode has been attached using a sequencer;

[0029] correcting the read length according to quality information contained in the sequence analysis data;

[0030] dividing the corrected read length into read length groups in which the molecular barcodes are identical;

[0031] determining the most frequent base at the target position in each read length group; and

[0032] calculating the methylation degree of the base at the target position from the set of the most frequent bases.

[0033] <6> A method of calculating a methylation degree of a base, which calculates a methylation degree of a base at a target position in DNA, the method comprising the steps of:

[0034] obtaining sequence analysis data obtained by performing sequence analysis on DNA to which a molecular barcode has been attached using a sequencer;

[0035] correcting the read length according to quality information contained in the sequence analysis data;

[0036] dividing the corrected read length into read length groups in which the molecular barcodes are identical, and removing read lengths in which the sequence of the region containing the target position is not identical in each read length group, to obtain read length groups in which the molecular barcodes are identical and the sequences of the regions containing the target position are identical;

[0037] determining the base at the target position in each read length group in which the molecular barcodes are identical and the sequences of the regions containing the target position are identical; and

[0038] calculating the methylation degree of the base at the target position from the set of the determined bases.

[0039] <7> A method of calculating a methylation degree of a base, which calculates a methylation degree of a base at a target position in DNA, the method comprising the steps of:

[0040] obtaining a plurality of sequence analysis data obtained by performing a plurality of times of sequence analysis on DNA using a sequencer;

[0041] for each of the sequence analysis data, correcting the read length based on quality information included in the sequence analysis data, and calculating the methylation degree of the base at the target position based on the corrected read length; and

[0042] calculating a representative value from the set of the methylation degrees of all the times, and using the representative value as the methylation degree of the base at the target position.

[0043] <8> The method for calculating the methylation degree of a base according to <7>, wherein when the set of the methylation degrees of all the times includes one or both of a specific large or small methylation degree and a deviation from each other, the representative value and the methylation degree of the base at the target position are calculated to be uncalculable.

[0044] <9> A method for calculating the methylation degree of a base, which is performed by combining two or more of <1> to <8>.

[0045] <10> A program for causing a computer to execute the method for calculating the methylation degree of a base according to any one of <1> to <9>.

[0046] <10> A program for causing a computer to execute the method for calculating the methylation degree of a base according to any one of <1> to <9>.

[0047] <11> A program for calculating the methylation degree of a base at a target position in DNA having a co-methylation site, the program causing a computer to execute the following stages:

[0048] a stage of obtaining sequence analysis data obtained by performing sequence analysis on DNA having a co-methylation site using a sequencer;

[0049] a stage of correcting the base at the co-methylation site in the read length based on quality information included in the sequence analysis data; and

[0050] a stage of calculating the methylation degree of the base at the target position based on the corrected read length.

[0051] <12> A program for calculating the methylation degree of a base at a target position in DNA having a co-methylation site, the program causing a computer to execute the following stages:

[0052] a stage of acquiring sequence analysis data obtained by performing sequence analysis on DNA having a co-methylation site using a sequencer;

[0053] a stage of correcting read lengths according to quality information included in the sequence analysis data, and removing read lengths in which bases at the target position are not consistent between co-methylation sites; and

[0054] a stage of calculating methylation of bases at the target position from the remaining read lengths.

[0055] <13> A program that calculates a degree of methylation of bases at a target position in DNA, the program causing a computer to execute the following stages:

[0056] a stage of acquiring sequence analysis data obtained by performing sequence analysis on DNA using a next-generation sequencer by a paired-end method;

[0057] a stage of correcting paired-end read lengths according to quality information included in the sequence analysis data; and

[0058] a stage of calculating a degree of methylation of bases at the target position from the corrected read lengths.

[0059] <14> A program that calculates a degree of methylation of bases at a target position in DNA, the program causing a computer to execute the following stages:

[0060] a stage of acquiring sequence analysis data obtained by performing sequence analysis on DNA using a next-generation sequencer by a paired-end method;

[0061] a stage of correcting read lengths according to quality information included in the sequence analysis data, and removing paired-end read lengths in which bases at the target position are not consistent between paired-end read lengths; and

[0062] a stage of calculating methylation of bases at the target position from the remaining read lengths.

[0063] <15> A program that calculates a degree of methylation of bases at a target position in DNA, the program causing a computer to execute the following stages:

[0064] a stage of acquiring sequence analysis data obtained by performing sequence analysis on DNA to which molecular barcodes are attached using a sequencer;

[0065] a stage of correcting read lengths according to quality information included in the sequence analysis data;

[0066] a stage of grouping the corrected read lengths into read length groups in which molecular barcodes are the same;

[0067] a stage of determining, in each read length group, a base that is most frequently present at the target position; and

[0068] a stage of calculating the methylation degree of the base at the target position from the set of the most frequent bases.

[0069] <16> A program that calculates the methylation degree of a base at a target position in DNA, the program causing a computer to execute the following stages:

[0070] a stage of acquiring sequence analysis data obtained by performing sequence analysis on DNA to which molecular barcodes are attached using a sequencer;

[0071] a stage of correcting read lengths according to quality information included in the sequence analysis data;

[0072] a stage of grouping the corrected read lengths into read length groups that have the same molecular barcode, and removing read lengths in which the sequence of the region including the target position is not identical in each read length group, to obtain read length groups that have the same molecular barcode and the same sequence of the region including the target position;

[0073] a stage of determining the base at the target position in each read length group that has the same molecular barcode and the same sequence of the region including the target position; and

[0074] a stage of calculating the methylation degree of the base at the target position from the set of the determined bases.

[0075] <17> A program that calculates the methylation degree of a base at a target position in DNA, the program causing a computer to execute the following stages:

[0076] a stage of acquiring a plurality of sequence analysis data obtained by performing a plurality of times of sequence analysis on DNA using a sequencer;

[0077] a stage of, for each time of sequence analysis data, correcting read lengths according to quality information included in the sequence analysis data, and calculating the methylation degree of the base at the target position from the corrected read lengths; and

[0078] a stage of calculating a representative value from the set of the methylation degrees of all times, and calculating the methylation degree of the base at the target position as the representative value.

[0079] <18> The program according to <17>, wherein when the set of the methylation degrees of all times has one or both of a bias and includes a methylation degree that is significantly large or small, the representative value and the methylation degree of the base at the target position are calculated to be unable to be calculated.

[0080] <19> A program for causing a computer to execute two or more programs selected from the group consisting of the program according to <11>, the program according to <12>, the program according to <13>, the program according to <14>, the program according to <15>, the program according to <16>, the program according to <17>, and the program according to <18>.

[0081] <20> A computer that works by the program of any one of <11> to <19>.

[0082] Effects of the Invention

[0083] According to the present application, there is provided a method and a program for more accurately calculating the degree of methylation of a base from sequence analysis data of DNA. BRIEF DESCRIPTION OF DRAWINGS

[0084] Figure 1 is a flowchart illustrating the flow of Embodiment 1-1.

[0085] Figure 2 is a flowchart illustrating the flow of Embodiment 1-2.

[0086] Figure 3 is a flowchart illustrating the flow of Embodiment 2-1.

[0087] Figure 4 is a flowchart illustrating the flow of Embodiment 2-2.

[0088] Figure 5 is a flowchart illustrating the flow of Embodiment 3-1.

[0089] Figure 6 is a flowchart illustrating the flow of Embodiment 3-2.

[0090] Figure 7 is a flowchart illustrating the flow of Embodiment 4-1.

[0091] Figure 8 is a hardware configuration diagram of a computer. DETAILED DESCRIPTION

[0092] Hereinafter, embodiments of the present application will be described. These descriptions and examples exemplify the embodiments and do not limit the scope of the embodiments.

[0093] In the present application, a numerical range indicated by "to" indicates a range including the values recited before and after "to" as the minimum value and the maximum value, respectively.

[0094] The meanings of the terms used in the present application are as follows.

[0095] The target position in DNA indicates a position as an object for which the degree of methylation is calculated by the method and the program of the present application. The target position in DNA is arbitrary.

[0096] The methylation degree of a base is a value calculated from a set of DNA fragments, and is calculated for each base in the DNA. The methylation degree of a certain base is {the number of DNA fragments in which the certain base is methylated / (the number of DNA fragments in which the certain base is methylated + the number of DNA fragments in which the certain base is not methylated)}, expressed in percentage (%).

[0097] The sequence analysis data contains the base sequence of each read, the identity of the sequence between reads, quality information of the sequence analysis, and the like, which are all information about the sequence analysis output from the sequencer. The quality information is information containing at least one of the accuracy of the sequence of the 1st sequencing process, the accuracy of the sequence of each read, and the accuracy of the base at each position.

[0098] The sequencer is a term including the first generation sequencer (capillary sequencer), the second generation sequencer (next generation sequencer), the third generation sequencer, the fourth generation sequencer, and a sequencer to be developed in the future. Unless otherwise specified, the sequencer can be a capillary sequencer, a next generation sequencer, or another sequencer. As the sequencer, from the viewpoint of the analysis speed, the number of samples that can be processed at a time, and the like, a next generation sequencer is preferable. The next generation sequencer (NGS) refers to a sequencer classified in comparison with the capillary sequencer using the Sanger method (referred to as the first generation sequencer). The most popular next generation sequencer at present is a sequencer that captures fluorescence or luminescence linked to the synthesis of a complementary strand of a DNA polymerase or the binding of a complementary strand of a DNA ligase to determine the base sequence. Specifically, MiSeq (Illumina, Inc.), HiSeq2000 (Illumina, Inc., HiSeq is a registered trademark), Roche 454 (Roche company), and the like can be mentioned.

[0099] The read length refers to the unit of the base sequence subjected to the read process by the sequencer.

[0100] The read length is corrected according to the quality information contained in the sequence analysis data. The correction of the read length includes at least any one of the exclusion of the read length in which the accuracy of the sequence is absolutely or relatively low, the selection of the read length in which the accuracy of the sequence is absolutely or relatively high, and the correction of each base (for example, replacement of the existing base with low accuracy with the existing base with high accuracy).

[0101] The co-methylation site refers to two or more methylation sites at different positions on the DNA that are presumed to be in the same methylation state (both methylated or both unmethylated).

[0102] A co-methylation site is, for example, two CpG sites (a two-base sequence in which cytosine is followed by guanine) that are adjacent with one or more bases interposed therebetween.

[0103] The paired-end method is a method in which base sequences are read from both ends of a nucleic acid.

[0104] A paired-end read length indicates a pair of read lengths that are read from both ends of one base sequence.

[0105] A molecular barcode is a synthetic nucleic acid that is attached in order to distinguish a plurality of nucleic acids that are measurement targets from each other, and that differs in sequence from each other. If an inherent molecular barcode is attached to a nucleic acid that is a measurement target before amplification, an amplified product from the nucleic acid that is a measurement target can be identified.

[0106] Disclosed is a method and a program for acquiring sequence analysis data obtained by performing sequence analysis on DNA using a sequencer, and calculating the methylation degree of a base at a target position in the DNA from the sequence analysis data. As the base at the target position, cytosine and adenine can be given.

[0107] For sequence analysis of DNA using a sequencer, in the case where the base at the target position is cytosine, bisulfite sequencing is preferable. An embodiment of bisulfite sequencing includes subjecting DNA to bisulfite treatment, performing PCR using primers, and performing sequence analysis of an amplified product using a sequencer.

[0108] As a method and a program for calculating the methylation degree of a base, the present application discloses a first embodiment, a second embodiment, a third embodiment, and a fourth embodiment. Hereinafter, each embodiment will be described with reference to the flowchart shown in Figures 1-7

[0109] <First Embodiment: Embodiment Using Co-methylation Site>

[0110] The first embodiment is a method for calculating the methylation degree of a base at a target position in DNA from sequence analysis data obtained by performing sequence analysis on DNA having a co-methylation site. The first embodiment is an embodiment that can be performed in the case where a co-methylation site is present in the DNA to be analyzed, and the base at the target position constitutes the co-methylation site.

[0111] A co-methylation site in DNA can be identified by a list of co-methylation sites or a search algorithm. The first embodiment can further include a step of identifying a co-methylation site in the DNA to be analyzed by a list of co-methylation sites or a search algorithm.

[0112] ​The list of co-methylation sites can be constructed by obtaining information on methylation sites from an existing gene database. An example of a search algorithm for co-methylation sites is an algorithm that searches for two CpG sites adjacent to each other with one or fewer than ten bases sandwiched therebetween.

[0113] The first embodiment improves the accuracy of the methylation degree of a base by correcting a read length according to quality information of sequence analysis data when using co-methylation sites. The first embodiment is divided into two modes according to the method of using co-methylation sites (referred to as embodiment 1-1 and embodiment 1-2).

[0114] [Embodiment 1-1]

[0115] Figure 1 is a flowchart illustrating the flow of embodiment 1-1. Embodiment 1-1 includes a stage shown by S111, a stage shown by S112, and a stage shown by S113.

[0116] When co-methylation sites in DNA are expected to be in the same methylation state (both methylated or both unmethylated), in the case where the C / T sequence of a co-methylation site in a read length is different, it is presumed that a measurement error (for example, a base conversion error at the time of bisulfite treatment, an amplification error of PCR, a reading error of a sequencer) has occurred in at least one base of the co-methylation site. Embodiment 1-1 performs correction of the above measurement error at the stage shown by S112.

[0117] Hereinafter, each stage will be described.

[0118] In the stage shown by S111, sequence analysis data obtained by performing sequence analysis on DNA having a co-methylation site using a sequencer is acquired. Then, the stage shown by S112 is entered.

[0119] In the stage shown by S112, the base of the co-methylation site in the read length is corrected according to the quality information included in the sequence analysis data. Specifically, it is preferable to perform correction in which the base of a site with a high reliability of the C / T sequence in the co-methylation site in the read length is substituted for the base of a site with a low reliability of the C / T sequence. In the case where the C / T sequence between co-methylation sites in a read length is different, the C / T sequence between co-methylation sites in the read length is substituted for the same sequence in the stage shown by S112.

[0120] Next, in the stage shown by S113, the methylation degree of the base of the target position is calculated from the corrected read length. Since the methylation degree is calculated from a set of read lengths in which the accuracy of the base of the target position is increased, the accuracy of the methylation degree of the base is improved.

[0121] [Embodiment 1-2]

[0122] Figure 2 is a flowchart illustrating a flow of Embodiment 1-2. Embodiment 1-2 includes a stage shown by S121, a stage shown by S122, and a stage shown by S123.

[0123] When the co-methylation sites in the DNA are expected to be in the same methylation state (both methylated or both unmethylated), in the case where the C / T sequence of the co-methylation sites in the read is different, it is presumed that a measurement error (for example, a base conversion error at the time of bisulfite treatment, an amplification error of PCR, a reading error of a sequencer) has occurred in at least one base of the co-methylation sites. Embodiment 1-2 performs correction of the above measurement error at the stage shown by S122.

[0124] Hereinafter, each stage will be described.

[0125] In the stage shown by S121, sequence analysis data obtained by performing sequence analysis of DNA having co-methylation sites using a sequencer is acquired. Then, the stage shown by S122 is entered.

[0126] In the stage shown by S122, the read is corrected according to the quality information included in the sequence analysis data, and the read in which the bases are not consistent between the co-methylation sites is removed. The correction of the read is preferably the exclusion of the read in which the accuracy of the sequence of the entire read or the accuracy of the base of the target position is absolutely or relatively low, or the selection of the read in which the accuracy of the sequence of the entire read or the accuracy of the base of the target position is absolutely or relatively high. Next, the read in which the bases are not consistent between the co-methylation sites is removed. In the stage shown by S122, the original read is reduced, and a group of reads with high reliability of the sequence is formed.

[0127] Next, in the stage shown by S123, the methylation degree of the base of the target position is calculated from the remaining read. Since the methylation degree is calculated from the set of reads with high reliability of the sequence, the accuracy of the methylation degree of the base is improved.

[0128] <Second Embodiment: Embodiment using paired-end reads>

[0129] The second embodiment is a method of calculating the methylation degree of the base of the target position in DNA from sequence analysis data obtained by performing sequence analysis of DNA by the paired-end method using a next-generation sequencer. The second embodiment improves the accuracy of the methylation degree of the base by correcting the read according to the quality information of the sequence analysis data when paired-end reads are used. The second embodiment is divided into two modes (referred to as Embodiment 2-1 and Embodiment 2-2) according to the method using paired-end reads.

[0130] [Embodiment 2-1]

[0131] Figure 3 is a flowchart illustrating the flow of Embodiment 2-1. Embodiment 2-1 includes a stage shown by S211, a stage shown by S212, and a stage shown by S213.

[0132] In a case where the sequences of the pair of reads constituting one paired-end read are predicted to be the same, in a case where the sequences between the paired-end reads are different, it is presumed that a reading error of the sequencer has occurred in at least one of the reads of the paired-end read. Embodiment 2-1 performs the correction of the measurement error described above at the stage shown by S212.

[0133] Hereinafter, each stage will be described.

[0134] In the stage shown by S211, sequence analysis data obtained by performing sequence analysis on DNA using a next-generation sequencer by paired-end method is acquired. Then, the stage shown by S212 is entered.

[0135] In the stage shown by S212, the paired-end reads are corrected on the basis of the quality information included in the sequence analysis data. The correction of the reads preferably selects a read in which the accuracy of the base of the target position is absolutely or relatively high, and uses the read as a representative of the paired-end reads. In a case where the sequences between the paired-end reads are different, the sequence of the read is corrected to the target position in the stage shown by S212.

[0136] Next, in the stage shown by S213, the methylation degree of the base of the target position is calculated on the basis of the corrected reads. Since the methylation degree is calculated on the basis of the set of reads in which the accuracy of the base of the target position is increased, the accuracy of the methylation degree of the base is improved.

[0137] [Embodiment 2-2]

[0138] Figure 4 is a flowchart illustrating the flow of Embodiment 2-2. Embodiment 2-2 includes a stage shown by S221, a stage shown by S222, and a stage shown by S223.

[0139] In a case where the sequences of the pair of reads constituting one paired-end read are predicted to be the same, in a case where the sequences between the paired-end reads are different, it is presumed that a reading error of the sequencer has occurred in at least one of the reads of the paired-end read. Embodiment 2-2 performs the correction of the measurement error described above at the stage shown by S222.

[0140] Hereinafter, each stage will be described.

[0141] In the stage shown in S221, sequence analysis data obtained by performing sequence analysis on DNA using a next-generation sequencer by paired-end method is acquired. Then, the stage shown in S222 is entered.

[0142] In the stage shown in S222, read lengths are corrected based on quality information included in the sequence analysis data, and paired-end read lengths in which bases at the target position are inconsistent between paired-end read lengths are removed. The correction of read lengths is preferably the exclusion of read lengths in which the accuracy of the sequence of the entire read length or the accuracy of the base at the target position is absolutely or relatively low, or the selection of read lengths in which the accuracy of the sequence of the entire read length or the accuracy of the base at the target position is absolutely or relatively high. Next, paired-end read lengths in which bases at the target position are inconsistent between paired-end read lengths are removed. In the stage shown in S222, the original read lengths are reduced, forming a group of read lengths in which the reliability of the sequence is high.

[0143] Next, in the stage shown in S223, the degree of methylation of the base at the target position is calculated based on the remaining read lengths. Since the degree of methylation is calculated based on the set of read lengths in which the reliability of the sequence is high, the accuracy of the degree of methylation of the base is improved.

[0144] <Third Embodiment: Embodiment using molecular barcodes>

[0145] The third embodiment is a method of calculating the degree of methylation of a base at a target position in DNA based on sequence analysis data obtained by performing sequence analysis on DNA to which a molecular barcode has been added. The third embodiment improves the accuracy of the degree of methylation of a base by correcting read lengths based on quality information of the sequence analysis data when molecular barcodes are used. The third embodiment is divided into two modes (referred to as Embodiment 3-1 and Embodiment 3-2) according to the method using molecular barcodes.

[0146] [Embodiment 3-1]

[0147] Figure 5 is a flowchart illustrating the flow of Embodiment 3-1. Embodiment 3-1 includes the stage shown in S311, the stage shown in S312, the stage shown in S313, the stage shown in S314, and the stage shown in S315.

[0148] In the case where the read length group in which the molecular barcodes are the same is expected to be sequence-identical, in the case where the read length group includes read lengths in which the sequences are different, it is presumed that measurement errors (for example, amplification errors of PCR, reading errors of a sequencer) have occurred in the read lengths. Embodiment 3-1 reduces the influence of the above-described measurement errors on the calculation of the degree of methylation of a base by going through the series of stages shown in S311 to S315.

[0149] Hereinafter, each stage will be described.

[0150] In the stage shown in S311, sequence analysis data obtained by performing sequence analysis on the DNA to which the molecular barcode is attached using a sequencer is acquired. Then, the stage shown in S312 is entered.

[0151] In the stage shown in S312, the read length is corrected based on the quality information included in the sequence analysis data. The correction of the read length is preferably the exclusion of the read length in which the accuracy of the sequence of the entire read length or the accuracy of the base at the target position is absolutely or relatively low, or the selection of the read length in which the accuracy of the sequence of the entire read length or the accuracy of the base at the target position is absolutely or relatively high.

[0152] Next, in the stage shown in S313, the corrected read length is classified into read length groups in which the molecular barcodes are the same. Then, the stage shown in S314 is entered.

[0153] In the stage shown in S314, the most frequent base at the target position is determined in each read length group in which the molecular barcodes are the same. Then, the stage shown in S315 is entered.

[0154] In the stage shown in S315, the methylation degree of the base at the target position is calculated based on the collection of the most frequent bases. By passing through the stages shown in S311 to S315, the accuracy of the base at the target position is improved, and thus the accuracy of the methylation degree of the base is improved.

[0155] [Embodiment 3-2]

[0156] Figure 6 is a flowchart illustrating the flow of Embodiment 3-2. Embodiment 3-2 includes the stage shown in S321, the stage shown in S322, the stage shown in S323, the stage shown in S324, and the stage shown in S325.

[0157] In the case where the read length group in which the molecular barcodes are the same is expected to be identical in sequence, in the case where the read length group includes read lengths different in sequence, it is presumed that a measurement error (for example, an amplification error of PCR, a reading error of a sequencer) has occurred in the read length. Embodiment 3-2 reduces the influence of the above-described measurement error on the calculation of the methylation degree of the base by passing through the series of stages shown in S321 to S325.

[0158] Hereinafter, each stage will be described.

[0159] In the stage shown in S321, sequence analysis data obtained by performing sequence analysis on the DNA to which the molecular barcode is attached using a sequencer is acquired. Then, the stage shown in S322 is entered.

[0160] In the stage shown in S322, the read length is corrected based on the quality information included in the sequence analysis data. The correction of the read length is preferably the exclusion of a read length in which the accuracy of the sequence of the entire read length or the accuracy of the base of the target position is absolutely or relatively low, or the selection of a read length in which the accuracy of the sequence of the entire read length or the accuracy of the base of the target position is absolutely or relatively high.

[0161] Next, in the stage shown in S323, the corrected read length is classified into read length groups having the same molecular barcode, and read lengths in which the sequence of the region including the target position is not identical are removed in each read length group, to obtain read length groups having the same molecular barcode and the same sequence of the region including the target position. Here, the region including the target position can be a part of the read length, or the entire read length. The region including the target position is preferably a region having a base length of 5 or more. The identity of the sequence can be determined using the information included in the sequence analysis data, and in a case where a prescribed determination criterion is not satisfied, the sequence is determined to be not identical. The identity of the sequence is preferably 90% or more, more preferably 95% or more, and further preferably 100%, and the value can be used as the determination criterion. The sequence satisfying the prescribed determination criterion regarding the identity of the sequence is set as the sequence identical.

[0162] Next, in the stage shown in S324, the base of the target position is determined in each read length group having the same molecular barcode and the same sequence of the region including the target position. Then, the stage shown in S325 is entered.

[0163] In the stage shown in S325, the degree of methylation of the base of the target position is calculated from the set of the determined bases. Through the stages shown in S321 to S324, the accuracy of the base of the target position is improved, and thus the accuracy of the degree of methylation of the base is improved.

[0164] <Fourth Embodiment: Embodiment using multiple sequence analysis data>

[0165] The fourth embodiment is a method of calculating the degree of methylation of the base of the target position in DNA from multiple sequence analysis data obtained by performing multiple sequence analyses of the DNA using a sequencer. The fourth embodiment improves the accuracy of the degree of methylation of the base by correcting the read length based on the quality information of the sequence analysis data when multiple sequence analysis data is used.

[0166] The details of the fourth embodiment are described in Embodiment 4-1 below. Also, as one example of Embodiment 4-1, Embodiment 4-2 is described.

[0167] [Embodiment 4-1]

[0168] Figure 7is a flowchart illustrating a flow of Embodiment 4-1. Embodiment 4-1 includes the stage shown by S411, the stage shown by S412, and the stage shown by S413.

[0169] In a case where the same DNA is used as a sample, it is desirable that the values of the methylation degree of a base calculated from a plurality of sequence analysis data respectively are consistent. However, since it is difficult to make measurement errors of read lengths (for example, conversion errors of bases at the time of bisulfite treatment, amplification errors of PCR, reading errors of a sequencer) always zero, there is a deviation in the values of the methylation degree of a base calculated from a plurality of sequence analysis data respectively. Embodiment 4-1 is a way of removing the deviation in the values of the methylation degree of a base and improving the accuracy of the methylation degree of a base.

[0170] Hereinafter, each stage will be described.

[0171] In the stage shown by S411, a plurality of sequence analysis data obtained by performing sequence analysis on DNA using a sequencer a plurality of times is acquired. Then, the stage shown by S412 is entered.

[0172] In the stage shown by S412, for each of the sequence analysis data, read lengths are corrected on the basis of quality information included in the sequence analysis data, and the methylation degree of a base at a target position is calculated on the basis of the corrected read lengths. The correction of read lengths is preferably at least one of the exclusion of read lengths in which the accuracy of the sequence of the entire read length or the accuracy of a base at a target position is absolutely or relatively low, the selection of read lengths in which the accuracy of the sequence of the entire read length or the accuracy of a base at a target position is absolutely or relatively high, and the correction of each base.

[0173] Next, in the stage shown by S413, a representative value is calculated on the basis of the set of the methylation degrees of all the times, and the representative value is taken as the methylation degree of a base at a target position. The representative value can be any one of an average value, a median value, a most frequent value, and an arbitrarily defined value. Since the representative value of the methylation degree of a base calculated from a plurality of sequence analysis data respectively is found, the accuracy of the methylation degree of a base is improved.

[0174] [Embodiment 4-2]

[0175] Embodiment 4-2 is a way of not outputting a methylation degree with low reliability and making a judgment that calculation is impossible, in a case where the set of the methylation degrees of all the times has a deviation from each other and includes one or both of a specifically large or small methylation degree, in the stage shown by S413 of Embodiment 4-1.

[0176] By performing at least one of the first embodiment, the second embodiment, the third embodiment, and the fourth embodiment described above, the methylation degree of a base can be more accurately calculated.

[0177] In order to calculate a more accurate methylation degree of a base, two or more embodiments selected from the group consisting of the first embodiment, the second embodiment, the third embodiment, and the fourth embodiment can be combined and performed.

[0178] The first embodiment, the second embodiment, the third embodiment, the fourth embodiment, and the combined embodiments thereof can be realized by causing the computer 100 to execute the program.

[0179] As shown in the hardware structure of Figure 8 , the computer 100 has a CPU (Central Processing Unit) 101, a ROM (Read Only Memory) 102, a RAM (Random Access Memory) 103, and a storage 104. Each structure is communicably connected to each other via a bus 109.

[0180] The CPU 101 is a central arithmetic processing unit that executes various programs or controls each part. That is, the CPU 101 reads out a program from the ROM 102 or the storage 104, and executes the program using the RAM 103 as a work area. The CPU 101 executes the program recorded in the ROM 102 or the storage 104, and performs control and various arithmetic processing in each stage.

[0181] The ROM 102 stores various programs and various data. The RAM 103 temporarily stores a program or data as a work area. The storage 104 is constituted by a HDD (Hard Disk Drive), a SSD (Solid State Drive), or a flash memory, and stores various programs including an operating system and various data. The sequence analysis data can also be saved in the storage 104.

[0182] In the computer 100, the CPU 101 in the above-described hardware structure executes the program shown in the flowchart of Figures 1-7 , whereby the calculation method of the methylation degree of a base is realized.

[0183] The smaller the difference from the true value of the methylation degree (%) of a base calculated by the embodiments of the present application is, the more preferable it is, and it is preferable that the difference be 0.2% or less, more preferably 0.1% or less, and particularly preferably 0%.

[0184] Example

[0185] Hereinafter, the embodiments of the present application will be further described by way of examples, but the embodiments of the present application are not limited to these examples.

[0186] [Preparation of DNA and primer pair for test]

[0187] As a DNA for test, a synthetic DNA corresponding to 99 bases from the 12516th base to the 12614th base of the phage DNA (SEQ ID NO: 1, 5'-TTGATGGTATTGCACAGAATATGGCGGCGATGCTGACCGGCAGTGAGCAGAACTGGCGCAGCTTCACCCGTTCCGTGCTGTCCATGATGACAGAAATTC-3') was prepared. The cytosine at the 25th base of SEQ ID NO: 1 is referred to as site A, and the cytosine at the 28th base of SEQ ID NO: 1 is referred to as site B.

[0188] As a primer pair for amplifying the synthetic DNA of SEQ ID NO: 1 by PCR, the following forward primer and reverse primer were prepared.

[0189] • Forward primer: 5'-TTGATGGTATTGTATAGAATATGG-3' (SEQ ID NO: 2)

[0190] • Reverse primer: 5'-AAATTTCTATCATCATAAACAACA-3' (SEQ ID NO: 3)

[0191] Example 1: Example of the first embodiment

[0192] It was intended to calculate the methylation degree of site A of the synthetic DNA. At the time of synthesis of the synthetic DNA, the methylation degree of site A was controlled to be 1.00%. Furthermore, the methylation state of site B was controlled to be the same as that of site A. By an algorithm in which two methylation sites having a distance of 10 bases or less between the bases were regarded as a co-methylation site, site A and site B were determined as a co-methylation site.

[0193] Bisulfite treatment was performed on 100 ng of the DNA. 10 ng of the recovered DNA was amplified by PCR using the above-described primer pair. The sequence of the amplified DNA fragment was analyzed using a next-generation sequencer. When the reads were grouped according to the kind of the bases (cytosine or thymine) of site A and site B, the details thereof were as follows.

[0194] • Read group 1:

[0195] Site A = cytosine / site B = cytosine... 1599 reads

[0196] • Read group 2: • Read group 3:

[0197] Site A = Thymine / Site B = Thymine... 1546 reads

[0198] • Read group 3:

[0199] Site A = Cytosine / Site B = Thymine... 15 reads

[0200] • Read group 4:

[0201] Site A = Thymine / Site B = Cytosine... 1558 reads

[0202] Total... 159323 reads

[0203] When the methylation degree of site A is calculated from the set of read group 1 to read group 4 described above, it is (number of reads of group 1 + number of reads of group 3) ÷ total number of reads × 100 = (1599 + 1546) ÷ 159323 × 100 = 1.97%.

[0204] Based on the sequence analysis data of read group 1 to read group 4 described above, the following Example 1-1 and Example 1-2 were performed, respectively.

[0205] [Example 1-1: Example of Embodiment 1-1]

[0206] In the reads in which the bases between site A and site B as the co-methylation sites are different, it was considered that measurement error occurred in one of the sites, and correction was performed in which the base of which the reliability was low was replaced with the base of which the reliability was high between site A and site B, based on the quality information contained in the sequence analysis data. By this correction, read group 3 was corrected to read group 3-1 (in which the base of site A was replaced with the base of site B) or read group 3-2 (in which the base of site B was replaced with the base of site A) described below, and read group 4 was corrected to read group 4-1 (in which the base of site A was replaced with the base of site B) or read group 4-2 (in which the base of site B was replaced with the base of site A) described below.

[0207] • Read group 3-1:

[0208] Site A = Cytosine / Site B = Cytosine... 15 reads

[0209] • Read group 3-2:

[0210] Site A = Thymine / Site B = Thymine... 1531 reads

[0211] • Read group 4-1:

[0212] Site A = Cytosine / Site B = Cytosine... 19 reads

[0213] • Read group 4-2:

[0214] Site A = Thymine / Site B = Thymine... 1539 reads

[0215] When the methylation degree of site A is calculated from the set of corrected reads, it is (number of reads of group 1 + number of reads of group 3-1 + number of reads of group 4-1) ÷ total number of reads x 100 = (1599 + 15 + 19) ÷ 159323 x 100 = 1.02%. By increasing the accuracy of the base at the target position in the read using the co-methylation site, a value close to the true value of 1.00% can be obtained.

[0216] [Example 1-2: Example of Embodiment 1-2]

[0217] Each read was corrected to remove reads whose reliability of the sequence of the entire read was lower than a reference value, based on the quality information contained in the sequence analysis data. By this correction, read group 1 to read group 4 were corrected to the following read group 1' to read group 4'.

[0218] • Read group 1':

[0219] Site A = Thymine / Site B = Thymine... 1539 reads

[0220] • Read group 2':

[0221] Site A = Thymine / Site B = Thymine... 1539 reads

[0222] • Read group 3':

[0223] Site A = Thymine / Site B = Thymine... 1539 reads

[0224] • Read group 4':

[0225] Site A = Thymine / Site B = Thymine... 1539 reads

[0226] Total... 155966 reads

[0227] Furthermore, reads in which the bases between site A and site B as co-methylation sites were different (i.e., read group 3' and read group 4') were removed. When the methylation degree of site A is calculated from the set of the remaining reads (i.e., read group 1' and read group 2'), it is number of reads of group 1' ÷ (number of reads of group 1' + number of reads of group 2') x 100 = 1567 ÷ (1567 + 151528) x 100 = 1.02%. By reducing the original reads to reads whose reliability of the sequence is high, a value close to the true value of 1.00% can be obtained.

[0228] <Example 2: Example of Second Embodiment>

[0229] The methylation degree of site A of the synthesized DNA was calculated. When the DNA was synthesized, the methylation degree of site A was controlled to be 1.00%.

[0230] The bisulfite treatment was performed on 100 ng of the DNA. Ten ng of the recovered DNA was amplified by PCR using the above-described primers. The sequence of the amplified DNA fragment was analyzed by the paired-end method using a next-generation sequencer. One of the paired-end reads is referred to as Rl, and the other is referred to as R2. When the combinations of Rl and R2 were grouped according to the kinds of the bases of site A (whether cytosine or thymine), the details thereof are as follows.

[0231] • Paired-end read group 5:

[0232] Rl = cytosine / R2 = cytosine ••• 1547 pairs

[0233] • Paired-end read group 6:

[0234] Rl = thymine / R2 = thymine ••• 153182 pairs

[0235] • Paired-end read group 7:

[0236] Rl = cytosine / R2 = thymine ••• 754 pairs

[0237] • Paired-end read group 8:

[0238] Rl = thymine / R2 = cytosine ••• 808 pairs

[0239] Total ••• 156291 pairs

[0240] When the methylation degree of site A was calculated from the union of the bases of Rl and the bases of R2 in the above-described paired-end read group 5 to paired-end read group 8, it was (the number of pairs of group 5 x 2 + the number of pairs of group 7 + the number of pairs of group 8) ÷ (the total number of pairs x 2) x 100 = (1547 x 2 + 754 + 808) ÷ (156291 x 2) x 100 = 1.49%.

[0241] Based on the sequence analysis data of the above-described paired-end read group 5 to paired-end read group 8, the following Example 2-1 and Example 2-2 were performed, respectively.

[0242] [Example 2-1: Example of Embodiment 2-1]

[0243] In paired-end reads in which the base at site A is not identical between the paired-end reads, it was considered that a read error occurred in one of the reads, and correction was performed in which, based on the quality information included in the sequence analysis data, a read in which the reliability of the sequence at site A was high was selected as a representative of the paired-end reads. By this correction, paired-end read group 7 was corrected to the following read group 7-1 (selecting R1 as the representative) and read group 7-2 (selecting R2 as the representative), and paired-end read group 8 was corrected to the following read group 8-1 (selecting R2 as the representative) and read group 8-2 (selecting R1 as the representative). Hereinafter, the reads representing paired-end read group 5 and paired-end read group 6 are represented as read group 5-1 and read group 6-1, respectively.

[0244] • Read group 5-1: Site A = Cytosine • • • 1547 reads

[0245] • Read group 6-1: Site A = Thymine • • • 153182 reads

[0246] • Read group 7-1: Site A = Cytosine • • • 155 reads

[0247] • Read group 7-2: Site A = Thymine • • • 599 reads

[0248] • Read group 8-1: Site A = Cytosine • • • 165 reads

[0249] • Read group 8-2: Site A = Thymine • • • 643 reads

[0250] Total • • • 156291 reads

[0251] When the methylation degree at site A was calculated from the above-described set of reads, it was (the number of reads of group 5-1 + the number of reads of group 7-1 + the number of reads of group 8-1) ÷ the total number of reads x 100 = (1547 + 155 + 165) ÷ 156291 x 100 = 1.19%. By using paired-end reads to increase the accuracy of the base at the target position in the reads, a value close to the true value of 1.00% could be obtained.

[0252] [Example 2-2: Example of Embodiment 2-2]

[0253] Based on the quality information included in the sequence analysis data, correction was performed in which, for each read, a read in which the reliability of the sequence of the entire read was lower than a reference value was removed. By this correction, paired-end read group 5 to paired-end read group 8 were corrected to the following paired-end read group 5' to paired-end read group 8'.

[0254] • Paired-end read group 5':

[0255] R1 = Cytosine / R2 = Cytosine • • • 1516 pairs

[0256] • Paired end read group 6':

[0257] R1 = Thymine / R2 = Thymine • • • 150118 pairs

[0258] • Paired end read group 7':

[0259] R1 = Cytosine / R2 = Thymine • • • 716 pairs

[0260] • Paired end read group 8':

[0261] R1 = Thymine / R2 = Cytosine • • • 727 pairs

[0262] Total • • • 153077 pairs

[0263] Further, the paired end read groups in which the base at site A is not consistent between the paired end reads (i.e., paired end read group 7' and paired end read group 8') are removed. When the methylation degree at site A is calculated from the set of the remaining paired end read groups (i.e., paired end read group 5' and paired end read group 6'), the number of pairs for group 5' ÷ (the number of pairs for group 5' + the number of pairs for group 6') x 100 = 1516 ÷ (1516 + 150118) x 100 = 1.00%. By reducing the original reads to the reads in which the reliability of the sequence is high, a value close to the true value of 1.00% can be obtained.

[0264] <Example 3: Example of the third embodiment>

[0265] It is desired to calculate the methylation degree at site A of the synthetic DNA. When the synthetic DNA is made, the methylation degree at site A is controlled to be 1.00%.

[0266] Hydrogen sulfite treatment is performed on 100 ng of DNA. In 10 ng of the recovered DNA, molecular barcodes in which adenine, guanine, cytosine, and thymine are arranged randomly for 10 bases are added, and amplification is performed by PCR using random primers. The sequence of the amplified DNA fragments is analyzed using a next-generation sequencer.

[0267] Here, the methylation degree when the methylation degree is calculated from the base at site A of the total reads is: the number of cytosines ÷ (the number of cytosines + the number of thymine) x 100 = 184496 ÷ 13369344 x 100 = 1.38%.

[0268] Based on the sequence analysis data of the above reads, the following Example 3-1 and Example 3-2 are performed, respectively.

[0269] [Example 3-1: Example of the first embodiment]

[0270] Based on the quality information included in the sequence analysis data, correction was performed on each read length for read lengths in which the reliability of the sequence of the entire read length was lower than a reference value. 1310720 read lengths were removed.

[0271] Next, the remaining read lengths were divided into groups of read lengths having the same molecular barcode, and the most frequent base at the site A was determined in each group of read lengths having the same molecular barcode.

[0272] For example, in a group of read lengths in which the sequence of the molecular barcode was 5'-ATGATCGATC-3' (SEQ ID NO: 4), the details of the base at the site A were as follows. The most frequent base at the site A in this group of read lengths was cytosine.

[0273] • Cytosine ••• 6853 read lengths

[0274] • Thymine ••• 52 read lengths

[0275] • Adenine ••• 32 read lengths

[0276] • Guanine ••• 44 read lengths

[0277] For example, in a group of read lengths in which the sequence of the molecular barcode was 5'-CTGATCCAAT-3' (SEQ ID NO: 5), the details of the base at the site A were as follows. The most frequent base at the site A in this group of read lengths was thymine.

[0278] • Cytosine ••• 43 read lengths

[0279] • Thymine ••• 8652 read lengths

[0280] • Adenine ••• 5 read lengths

[0281] • Guanine ••• 21 read lengths

[0282] As described above, when the most frequent base at the site A was determined in each group of read lengths having the same molecular barcode, there were 2700 groups of cytosine and 259444 groups of thymine. When the degree of methylation was calculated from the set of the most frequent base at the site A, it was 2700 ÷ (2700 + 259444) x 100 = 1.03%. The read lengths were corrected based on the quality information included in the sequence analysis data, and the influence of measurement errors on the calculation of the degree of methylation of the base was reduced using the molecular barcode, whereby a value close to the true value of 1.00% could be obtained.

[0283] [Example 3-2: Example of Embodiment 3-2]

[0284] Based on the quality information included in the sequence analysis data, correction was performed on each read length for read lengths whose sequence of the entire read length had reliability lower than a reference value. 1310720 read lengths were removed.

[0285] Next, the remaining read lengths were divided into groups of read lengths having the same molecular barcode, and read lengths whose sequence of the region including site A in each group of read lengths did not have identity were removed.

[0286] For example, in a group of read lengths whose sequence of the molecular barcode was 5'-ATGATCGATC-3' (SEQ ID NO: 4) (total 6981 read lengths), the most frequent sequence of the sequence other than the sequence of the molecular barcode was 5'-TTGATGGTATTGTATAGAATATGGCGGCGATGTTGATCGGTAGTGAGTAGAATTGGCGTAGTTTTATTCGTTTCGTGTTGTTTATGATGATAGAAATTT-3' (SEQ ID NO: 6), and when read lengths different from this most frequent sequence were removed (in this example, perfect identity of the sequence of the entire read length was taken as the same.), 5724 read lengths remained. The base of site A of these 5724 read lengths was cytosine.

[0287] As described above, when the base of site A was determined in each group of read lengths having the same molecular barcode and the same sequence, the cytosine group was 2673 groups, and the thymine group was 259471 groups. When the methylation degree was calculated from the collection of the base of site A, it was 2673 ÷ (2673 + 259471) x 100 = 1.02%. The read lengths were corrected based on the quality information included in the sequence analysis data, and the influence of measurement errors on calculation of the methylation degree of the base was reduced using the molecular barcode, whereby a value close to the true value of 1.00% could be obtained.

[0288] <Example 4: Example of the fourth embodiment>

[0289] It was desired to calculate the methylation degree of site A or the methylation degree of site B of the synthetic DNA. When the synthetic DNA was synthesized, control was performed independently to make the methylation degree of site A 1.00% and the methylation degree of site B 1.00%, respectively.

[0290] The DNA was divided into 3 parts as sample 1, sample 2, and sample 3.

[0291] Hydrogen sulfite treatment was performed on 100 ng of DNA of each sample. Each 10 ng of the recovered DNA was amplified by PCR using the above-described primers. The sequence of the amplified DNA fragment was analyzed using a next-generation sequencer.

[0292] Based on the sequence analysis data of 3 times, Example 4-1 and Example 4-2 were performed, respectively.

[0293] [Example 4-1: Example of Embodiment 4-1]

[0294] For each of the sequence analysis data of the samples, correction was performed to remove read lengths in which the reliability of the base at site A was lower than a reference value, based on the quality information included in the sequence analysis data. 1736 read lengths were removed for sample 1, 1803 read lengths were removed for sample 2, and 1781 read lengths were removed for sample 3.

[0295] When the methylation degree at site A was calculated for each sample based on the set of the remaining read lengths, it was 1.14% in sample 1, 0.79% in sample 2, and 1.45% in sample 3. 1.14%, which was the median of the 3 values, was calculated as the methylation degree at site A.

[0296] [Example 4-2: Example of Embodiment 4-2]

[0297] For each of the sequence analysis data, correction was performed to remove read lengths in which the reliability of the base at site B was lower than a reference value, based on the quality information included in the sequence analysis data. 1632 read lengths were removed for sample 1, 1338 read lengths were removed for sample 2, and 1305 read lengths were removed for sample 3.

[0298] When the methylation degree at site B was calculated for each sample based on the set of the remaining read lengths, it was 1.25% in sample 1, 5.32% in sample 2, and 1.32% in sample 3. In the case where there was a difference of 3% or more in the methylation degree between the measurements, it was considered that the measurement was not stable, and the methylation degree at site B could not be calculated.

[0299] Industrial applicability

[0300] The method and program of the present application for calculating the methylation degree of a base can be used as a scheme for studying the methylation of a nucleic acid in academic fields such as embryology, pathophysiology, brain neuroscience, and regenerative medicine.

[0301] The method and program of the present application for calculating the methylation degree of a base can be used as a scheme for detecting methylation abnormalities of a gene associated with a disease. The methylation abnormalities of a gene detected by the method and program of the present application for calculating the methylation degree of a base can be used as information to assist a physician in diagnosis, a basis for a physician to determine whether a precise examination (e.g., an image examination) is necessary, a basis for a physician to select a treatment method or a treatment drug, a determination of a treatment effect, a prediction of a prognosis of a patient, and the like.

[0302] The disclosure of Japanese Application No. 2020-055116, filed March 25, 2020, is incorporated herein by reference in its entirety.

[0303] All of the documents, patent applications and technical standards cited in this specification are hereby incorporated by reference to the same extent as if each individual document, patent application, or technical standard were specifically and individually indicated to be incorporated by reference.

Claims

1. A method of calculating a methylation degree of a base at a target position in DNA having a co-methylation site, the method comprising the steps of: acquiring sequence analysis data obtained by performing sequence analysis on DNA having a co-methylation site using a sequencer; performing correction of a base at a position of which the reliability of a sequence is low with a base at a position of which the reliability of a sequence in the co-methylation site in a read is high, based on quality information included in the sequence analysis data; and calculating a methylation degree of a base at the target position based on the corrected read.

2. A method of calculating a methylation degree of a base at a target position in DNA having a co-methylation site, the method comprising the steps of: acquiring sequence analysis data obtained by performing sequence analysis on DNA having a co-methylation site using a sequencer; performing correction of a base at a position of which the reliability of a sequence is low with a base at a position of which the reliability of a sequence in the co-methylation site in a read is high, based on quality information included in the sequence analysis data, and removing a read in which bases are not consistent between the co-methylation sites; and calculating a methylation degree of a base at the target position based on the remaining read.

3. A computer that operates by a program for causing the computer to execute the method of calculating a methylation degree of a base according to claim 1 or 2.

Citation Information

Patent Citations

  • A method for detection of cytosine-methylation patterns by exponential ligation of hybridized probe oligonucleotides (mla).

    JP2005514035A

  • Methods for methylation and detection of cytosines in DNA

    JP2007502126A

  • Particulate matter feeding device

    JP2020055116A

  • Methods and compositions for differentiating tissues for cell types using epigenetic markers

    US20060183128A1