A molecular marker related to immune traits of hu sheep, a detection method thereof and application thereof
By amplifying the PD-L1 gene in Hu sheep and detecting its polymorphic sites, KASP primer pairs were designed for PCR amplification and fluorescence signal detection, which solved the problem of unclear role of the PD-L1 gene in the immune traits of Hu sheep and enabled efficient screening and breeding of disease-resistant Hu sheep.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- MINQIN TONGZE AGRI CO LTD
- Filing Date
- 2023-02-20
- Publication Date
- 2026-04-21
AI Technical Summary
In the current technology, the role of the PD-L1 gene in the immune traits of Hu sheep is still unclear, especially in terms of hematological indicators. There is a lack of reports on its association with immune phenotype, which affects the development of effective molecular markers for disease resistance breeding in Hu sheep.
By amplifying the PD-L1 gene of Hu sheep and detecting its polymorphic sites, competitive allele-specific PCR (KASP) primer pairs were designed. High-throughput water bath PCR amplification was performed using KASPar primer pairs. Combined with fluorescence signal detection, a simple, accurate, and low-cost molecular marker detection method was established to screen for disease-resistant Hu sheep.
This method enables efficient identification of immune traits in Hu sheep, provides a means of breeding disease-resistant Hu sheep, improves the immunity and breeding efficiency of Hu sheep, and reduces testing costs.
Smart Images

Figure BDA0004086004090000081 
Figure BDA0004086004090000091 
Figure HDA0004086004110000011
Abstract
Description
Technical Field
[0001] This invention belongs to the technical field of molecular markers, specifically relating to a molecular marker related to the immune traits of Hu sheep, its detection method, and its application. Background Technology
[0002] Programmed death-ligand 1 (PD-L1) is an important immune co-signaling molecule, a type I transmembrane protein known to assist tumor cells in "immune escape" (Xue et al. 2018; Zhang et al. 2019). PD-L1 transmits inhibitory signals by binding to programmed death receptor 1 (PD-1) on immune cells such as T cells, thereby inhibiting T cell proliferation and activation (Vargas et al. 2020; Wang et al. 2020). Furthermore, PD-L1 gene expression significantly enhances fibroblast migration and invasion, leading to pulmonary fibrosis (Geng et al. 2019; Xue et al. 2018). Studies in cattle have confirmed that PD-L1 is associated with immune dysfunction during Mycobacterium bovis infection; in infected animals, PD-L1 expression inhibits the production of interferon-γ (IFN-γ) by anti-mycoplasma-specific cells in peripheral blood mononuclear cells (PBMCs) (Goto et al. 2017). However, the role of PD-L1 in the immune traits of Hu sheep remains unclear, especially in terms of hematological indicators. There are also no reports on the association between the PD-L1 gene and immune phenotype. Therefore, this invention uses the PD-L1 gene as a candidate gene and explores the association between different genotypes and immune-related traits in Hu sheep through PCR amplification, DNA sequencing, and sequence analysis, aiming to provide a new molecular marker for improving the disease resistance of Hu sheep breeding. Summary of the Invention
[0003] The purpose of this invention is to provide a molecular marker associated with the immune traits of Hu sheep, its detection method, and its application. The molecular marker of this invention is amplified from the PD-L1 gene of Hu sheep, and its specific nucleotide sequence is shown in SEQ ID NO.1. By amplifying and sequencing the DNA sequence of the Hu sheep PD-L1 gene, polymorphic sites of the PD-L1 gene are identified, the correlation between different genotypes and the immune traits of Hu sheep is analyzed, and a detection method for the molecular marker containing polymorphic sites is established. This molecular marker can also be applied to the breeding of new disease-resistant meat sheep breeds.
[0004] To achieve the above objectives, the present invention adopts the following technical solution:
[0005] This invention provides a molecular marker associated with immune traits in Hu sheep. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1. The R at position 135 bp of the sequence indicates G or A. Because there is a G / A mutation at position 135 of the above sequence, it leads to the G / A polymorphism of the Hu sheep PD-L1 gene at this site.
[0006] The present invention provides a PCR primer pair for detecting the above-mentioned molecular markers, preferably comprising primer F and primer R, wherein the nucleotide sequence of primer F is as shown in SEQ ID NO.2 and the nucleotide sequence of primer R is as shown in RSEQ ID NO.3;
[0007] F(SEQ ID NO.2): 5′-GGCAAAACCAGCATCACCC-3′,
[0008] R (SEQ ID NO. 3): 5′-CATCCTCCTGTCATCCCCTT-3′.
[0009] This invention provides a KASPar primer pair for detecting the above-mentioned molecular marker, comprising a forward primer A1, a forward primer A2, and a reverse primer C. The nucleotide sequence of the forward primer A1 is shown in SEQ ID NO.4, the forward primer A2 is shown in SEQ ID NO.5, and the reverse primer C is shown in SEQ ID NO.6.
[0010] SEQ ID NO.4: 5′-GAAGGTGACCAAGTTCATGCTATTAGGTCATG AGGAAAACAACAC-3′;
[0011] SEQ ID NO.5: 5′-GAAGGTCGGAGTCAACGGATTGATTAGGTCAT GAGGAAAACAACACA-3′;
[0012] SEQ ID NO.6: 5′-GATGTTTCAAAATATTACCTGGGATGACC-3′.
[0013] A kit for detecting the above-mentioned molecular marker, the kit comprising PCR primer pairs or KASPar primer pairs for detecting the above-mentioned molecular marker.
[0014] A method for detecting molecular markers associated with growth traits in Hu sheep, wherein the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and the R at position 135 bp of the sequence represents T or C, the method comprising detecting the genomic DNA of Hu sheep using the primer pair or kit described above, and the specific detection method comprising the following steps:
[0015] a) Amplify the genomic DNA of Hu sheep using the PCR primer pairs, KASPar primer pairs, or kits containing the primer pairs described above;
[0016] b) Identify the polymorphic sites in the amplification products obtained in step a).
[0017] In step b), the above-mentioned typing and identification methods include, but are not limited to, direct sequencing, probe method, gene chip method, and high-resolution melting curve method.
[0018] The method for detecting molecular markers related to growth traits in Hu sheep using the above primer pairs includes the following steps:
[0019] a) Genomic DNA was extracted from the blood of Hu sheep and amplified by high-throughput water bath PCR using primer pairs with nucleotide sequences as shown in SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6;
[0020] b) After amplification, fluorescence signals were detected and genotyping results were viewed using a BMG PHERAstar instrument.
[0021] The application of the detection methods described above, such as molecular markers, PCR primer pairs, KASPar primer pairs, or kits, in the detection of immune traits in Hu sheep allows for the determination of the level of immune traits in Hu sheep by detecting the molecular markers of the present invention in the genomic DNA of the Hu sheep to be tested and analyzing the types of polymorphic sites, thereby screening out disease-resistant Hu sheep.
[0022] The application of the molecular markers and their polymorphic sites, PCR primer pairs, KASPar primer pairs or kits described above in the assisted breeding of Hu sheep allows for the amplification and detection of the genomic DNA of Hu sheep using the aforementioned primer pairs or kits. This determines the genotype of the PD-L1 gene in the sample to be tested, thereby enabling the selection of disease-resistant Hu sheep breeds.
[0023] Identifying gene variation sites and analyzing their association with traits to discover the relationship between genes and traits is an important method for studying gene function and a foundation for marker-assisted selection. This invention, through PCR amplification and sequencing of the PD-L1 gene in the representative Hu sheep breed, revealed a G / A polymorphism site at position 135 of the amplified fragment. By detecting polymorphisms in 898 Hu sheep and establishing a least-squares model, a molecular marker associated with the immune trait of Hu sheep was identified. This molecular marker can be used to breed new disease-resistant meat sheep breeds, providing an effective genetic engineering method for the genetic improvement of the immune trait in Hu sheep, and has significant practical application value.
[0024] This invention detects the aforementioned molecular markers by designing KASPar primers required for competitive allele-specific PCR (KASP). This detection method does not require the synthesis of specific fluorescent probes for each SNP site. Instead, it is based on its unique ARM PCR principle, allowing all site detections to ultimately use universal fluorescent primers for amplification. This significantly reduces reagent costs and provides high accuracy, offering a simple, accurate, and low-cost method for detecting the molecular markers of this invention.
[0025] The beneficial effects of this invention are as follows:
[0026] This invention provides a molecular marker associated with the immune traits of Hu sheep, specifically the G / A polymorphic site at position 135 of the fragment in SEQ ID NO.1. It also provides primer pairs, detection kits, or detection methods for detecting this molecular marker in the detection of immune traits in Hu sheep. By determining the polymorphic genotype of this molecular marker, it is possible to effectively identify whether a sheep is disease-resistant, providing an effective detection method for breeding disease-resistant Hu sheep. Through the detection of this molecular marker and the site leading to the polymorphism, this invention can be used to select GG homozygous Hu sheep for breeding, thereby improving the immunity of Hu sheep and contributing to the improvement of the economic benefits of Hu sheep farming. Attached Figure Description
[0027] Figure 1 Gel electrophoresis image of the PD-L1 gene fragment of Hu sheep as a molecular marker.
[0028] Figure 2 The sequencing results are for the PD-L1 gene mutation site in the Hu sheep in this invention.
[0029] Figure 3 The KASPar SNP typing results for the g.11858G>A mutation site in the Hu sheep PD-L1 gene in this invention. Detailed Implementation
[0030] The following embodiments are used to further illustrate the present invention, but should not be construed as limiting the present invention. Any modifications or substitutions made to the present invention without departing from its spirit and essence are within the scope of the present invention.
[0031] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, the reagents used in the following embodiments are all analytical grade or higher.
[0032] Example 1: Amplification of the PD-L1 gene
[0033] Using Hu sheep PD-L1 gene DNA (GenBank accession number: NC_040253) as a template, a pair of primers was designed using Oligo 7.0 software: including forward primer F (SEQ ID NO.2) and reverse primer R (SEQ ID NO.3). The primer sequences are as follows.
[0034] F(SEQ ID NO.2): 5′-GGCAAAACCAGCATCACCC-3′,
[0035] R (SEQ ID NO.3): 5′-CATCCTCCTGTCATCCCCTT-3′
[0036] (2) Amplification and sequencing of the PD-L1 gene
[0037] Genomic DNA extracted from whole blood cells of Hu sheep was used as a DNA template for PCR amplification. The total reaction volume was 25 μL, including 1.5 μL of DNA template, 12.4 μL of 2×PCR Master Mix, 0.8 μL of forward primer F (10 μmol / L), 0.8 μL of reverse primer R (10 μmol / L), and 9.5 μL of ddH2O. The PCR amplification conditions were as follows:
[0038] Pre-denaturation at 94℃ for 3 min; denaturation at 94℃ for 30 s, annealing at 54.5℃ for 30 s, extension at 72℃ for 30 s, cycled 35 times; final extension at 72℃ for 10 min.
[0039] The PCR amplification product obtained above was subjected to electrophoresis (5 μL) on a 1.5% agarose gel. The results are as follows. Figure 1 As shown in the figure. Lane M: DL 2000 Marker; Lanes 1-10: PD-L1 gene amplification results. The results showed a 484bp specifically amplified fragment.
[0040] The amplified PCR fragment was sequenced, yielding a 484 bp sequence. The sequencing results were analyzed using Choromas (v2.3.0.0) and DNAMAN (6.0.3.99) software. As shown in SEQ ID NO.1, a polymorphic site exists within this fragment, specifically at position 335 bp where R is either G or A. This indicates that the amplified PD-L1 gene fragment exhibits G / A polymorphism at position 135 bp, located at position 11858 of the NC_040253 sequence, i.e., g.11858G>A (see...). Figure 2 ), where SEQ ID NO.1:
[0041] GGCAAAACCAGCATCACCCATTCTAAGAGGGAGGAAAAGCTTTTCAATGTGACCAGCACACTGAGAATCAACACAACAGCTGACAAAATTTTCTACTGCACTTTTCGGAGATTAGGTCATGAGGAAAACAACACRGCTGAGTTGGTCATCCCAGGTAATATTTTGAACATCTCAATTAAAATGTGCCTAGTATTGTCTCTTGGTATGTAGCCTGATGCCTGCTCATCATAAATTCATTGT TTGTTGAATGAATGAATGAATGAATAAACTATATTTATATGAATGAACTACATTTACAAAATGCATTCTTCTTCCTCACCTCCATTCATCTGAGTCATATTTCTACTTAGTAAACATAAGGACTGATGCTAAAGCTGAAACTCCAGTACTTTGGCCACCTCATGCAAAGAGTTGACTCATTGGAGAAGACTCTGATGCTGGGAGGGATTGGGGGCAGGAGGAGAAGGGGATGACAGAGGATG.
[0042] DNA sequence homology retrieval and identification:
[0043] The DNA sequence obtained after sequencing was compared with known physiologically functional genes published in the GenBank database using BLAST software from the National Center for Biotechnology Information (NCBI, http: / / www.ncbi.nlm.nih.gov) to identify and obtain functional information of the DNA sequence. The search results showed that the sequence obtained had 99% homology with a partial sequence of the Hu sheep PD-L1 gene DNA (GenBank accession number: NC_040253).
[0044] Example 2: Establishment of a Genotyping Detection Method
[0045] 1. Primer sequence design
[0046] A KASPar primer pair was designed targeting the G / A polymorphic site in SEQ ID NO.1 of the amplified fragment in Example 1 for the specific detection of this polymorphic site. The nucleotide sequence of the KASPar primer pair is as follows:
[0047] The forward primer A1 used for detecting AlleleX has the nucleotide sequence shown in SEQ ID NO.4.
[0048] SEQ ID NO.4: 5′-GAAGGTGACCAAGTTCATGCTATTAGGTCATG AGGAAAACAACAC-3′;
[0049] The forward primer A2 used to detect AlleleY is shown in SEQ ID NO.5.
[0050] SEQ ID NO.5: 5′-GAAGGTCGGAGTCAACGGATTGATTAGGTCAT GAGGAAAACAACACA-3′
[0051] Universal reverse primer C, as shown in SEQ ID NO.6,
[0052] SEQ ID NO.6: 5′-GATGTTTCAAAATATTACCTGGGATGACC-3′.
[0053] The above primers were synthesized by Beijing Sangon Biotech Co., Ltd. Each primer in the KASPar primer pair was diluted to 10 μmol / L and mixed in a volume ratio of primer A1: primer A2: universal reverse primer C of 12:12:30 for later use.
[0054] 2. DNA quality control
[0055] Genomic DNA was extracted from whole blood of Hu sheep using a DNA extraction kit. The quality of the extracted genomic DNA was tested using 1% agarose gel electrophoresis and Nanodrop 2100. Acceptable DNA met the following requirements: (1) Agarose gel electrophoresis showed a single DNA band without significant diffusion; (2) Nanodrop 2100 showed A260 / 280 between 1.8 and 2.0; A260 / 230 between 1.8 and 2.0; and no significant light absorption at 270 nm. Based on the KASPar detection technology from LGC (UK) and the conversion of genome size, the required DNA volume was calculated to be 10–20 ng / sample. The extracted genomic DNA was diluted to a concentration of 10–20 ng / μL as a DNA template.
[0056] 3. Genotyping test
[0057] First, using a K-pette dispensing workstation, 1.5 μL of the diluted whole blood DNA template (10-20 ng / μL) and a blank control (No template control, NTC, using sterile water) were added to 384-well reaction plates respectively, and dried at 60°C for 30 min (drying oven, LGC Corporation) until the DNA became dry powder for later use.
[0058] Each primer in the above KASPar primer pair was diluted to 10 μmol / L and mixed with the primer in a volume ratio of 12:12:30 for forward primer A1:forward primer A2:universal reverse primer C to prepare a primer mixture for later use.
[0059] Then, using a Meridian loading station under the Kraken operating system, 1×Master mix (1536 microplate, catalog number: Part No. KBS-1016-011) and primer mixture were added to each reaction well. Immediately after mixing, the microplates were sealed sequentially using a Kube heat sealer and a Fusion laser sealer. High-throughput water bath PCR amplification was then performed using a Hydrocycler high-throughput water bath system. The specific procedure was as follows:
[0060] Pre-denaturation at 94℃ for 15 minutes;
[0061] 94℃, 20 seconds (denaturation) — 61℃-55℃, 1 minute (annealing & extension), amplify in touch-down order for 10 cycles, decreasing the temperature by 0.6℃ per cycle;
[0062] 94℃, 20 seconds (denaturation) — 55℃, 60 seconds, continue amplification for 26 cycles.
[0063] After amplification, fluorescence signals were detected and genotyping was performed using a BMG PHERAstar instrument. Specific results are as follows: Figure 3 As shown in the figure, each dot represents a sample to be tested. The red (dark gray) dot near the upper left indicates that the locus is homozygous genotype "AA"; the green (light) dot near the middle indicates that the locus is heterozygous genotype "AG" or "GA"; and the blue (dark gray) dot near the right indicates that the locus is homozygous genotype "GG".
[0064] 4. Application of the molecular markers of this invention in the association analysis of growth traits in Hu sheep
[0065] The polymorphism of 898 Hu sheep was detected using the above method, their genotypes were determined, and association analysis between genotype and immune traits was performed. A least squares model was established as described below to conduct association analysis between genotype and immune traits.
[0066] Y ijkl =μ+Genotype i +P j +F k +M l +ε ijkl
[0067] Among them, Yijkl These are observed values of growth traits, where μ is the population mean and Genotype. i For genotype effect, P j Due to the batch effect, F k Due to the paternal effect, M l Maternal effect, ε ijkl Assuming random error, let ε ijkl They are independent of each other and follow an N(0, σ2) distribution.
[0068] Immune parameters in the blood of six-month-old male Hu sheep were detected using a complete blood count (CBC) system (ProCyte Dx, IDEXX, Westbrook, ME, USA). Detailed hematological parameters of 898 animals were obtained, and the results showed that all sheep's hematological parameters remained within the normal range. Genotyping results indicated that among the 898 individuals, there were 505 AA genotypes, 303 AG genotypes, and 90 GG genotypes. The results of genotype-trait association analysis are shown in Table 1. In the table, RBC represents red blood cell count (M / μL); HGB represents hemoglobin concentration (g / dL); HCT represents hematocrit (%); MPV represents mean platelet volume (fL); PLT represents platelet count (K / μL); WBC represents white blood cell count (K / μL); LYMPH represents lymphocyte count (K / μL); MONO represents monocyte count (K / μL); and EO represents... Eosinophil count (K / μL); NEUT (neutrophil count) (K / μL); BASO (basophil count) (K / μL); MCHC (mean corpuscular hemoglobin concentration) (g / dL); MCV (mean corpuscular volume) (fL); MCH (mean coronary hemoglobin) (pg); RDW_SD (standard deviation of mean corpuscular volume distribution width) (fL); RDW_CV (coefficient of variation of mean corpuscular volume distribution width) (%).
[0069] Table 1
[0070]
[0071]
[0072] Note: Different lowercase superscripts in the same row indicate significant differences (P<0.05), while the same superscript indicates no significant differences (P>0.05).
[0073] Many newly generated red blood cells replace aging red blood cells, maintaining a dynamic balance in red blood cell count to meet the body's normal metabolic needs. Various factors can disrupt this balance, resulting in either a decrease or increase in red blood cell count, leading to anemia or polycythemia; and altering the quality of red blood cells. Normal or high hemoglobin levels indicate abundant iron in the body. Low hemoglobin levels indicate iron deficiency, which in turn affects hemoglobin synthesis and oxygen-carrying capacity, leading to anemia and hindering normal physiological activities in animals. The results in the table above show that the G / A polymorphism site at position 135 of the amplified fragment SEQ ID NO.1 is significantly correlated with the red blood cell count (RBC) and mean corpuscular hemoglobin concentration (MCHC) of Hu sheep (P<0.05). Specifically, Hu sheep carrying the GG genotype had significantly higher RBC and MCHC than those carrying the AA and AG genes (P<0.05). The normal range for RBC is 310–370 g / L, and the normal range for MCHC is 310–370 g / L. Therefore, during breeding, the GG genotype should be selected for conservation purposes, and during reproduction, GG genotype sheep should be used as breeding stock for crossbreeding with other sheep. In particular, artificial insemination using semen from GG genotype rams can be used for disease-resistant sheep breeding, ensuring sheep health and increasing economic benefits.
Claims
1. A molecular marker related to immune traits of Hu sheep in the application of Hu sheep assisted breeding, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.
1. The R at position 135 bp of SEQ ID NO.1 represents G or A, which leads to the G / A polymorphism of the PD-L1 gene in Hu sheep at position 135 bp. Among them, the RBC and MCHC of Hu sheep carrying the GG genotype are significantly higher than those of Hu sheep carrying the AA and AG genotypes.
2. The PCR primer pair for detecting the molecular marker related to the immune traits of Hu sheep in the application of assisted breeding of Hu sheep, characterized in that, It includes primer F and primer R, the nucleotide sequence of primer F is shown in SEQ ID NO.2, and the nucleotide sequence of primer R is shown in SEQ ID NO.3; the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, where R at position 135 bp in SEQ ID NO.1 represents G or A, resulting in G / A polymorphism of the Hu sheep PD-L1 gene at position 135 bp; among them, the RBC and MCHC of Hu sheep carrying the GG genotype are significantly higher than those of Hu sheep carrying the AA and AG genotypes.
3. The application of KASPar primer pairs for detecting molecular markers related to immune traits of Hu sheep in assisted breeding of Hu sheep, characterized in that, It includes forward primer A1, forward primer A2, and reverse primer C. The nucleotide sequence of forward primer A1 is shown in SEQ ID NO.4, the nucleotide sequence of forward primer A2 is shown in SEQ ID NO.5, and the nucleotide sequence of reverse primer C is shown in SEQ ID NO.
6. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.
1. The R at position 135 bp of SEQ ID NO.1 represents G or A, resulting in G / A polymorphism of the Hu sheep PD-L1 gene at position 135 bp. Among them, the RBC and MCHC of Hu sheep carrying the GG genotype are significantly higher than those of Hu sheep carrying the AA and AG genotypes.
4. A detection kit for detecting a molecular marker related to an immune trait of Hu sheep for application in assisted breeding of Hu sheep, the detection kit comprising a PCR primer pair as shown in SEQ ID NO. 2 and SEQ ID NO. 3 or a PCKAS Par primer pair as shown in SEQ ID NO. 4-SEQ ID NO. 6; the nucleotide sequence of the molecular marker is shown in SEQ ID NO. 1, R at position 135 bp of SEQ ID NO. 1 represents G or A, resulting in G / A polymorphism of the PD-L1 gene of Hu sheep at position 135 bp; wherein, The RBC and MCHC of Hu sheep carrying the GG genotype were significantly higher than those of Hu sheep carrying the AA and AG genotypes.
5. A method for detecting a molecular marker related to the immune traits of Hu sheep, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, where the base R at position 135 bp represents G or A. The method includes amplifying and detecting sheep whole blood genomic DNA using PCR primer pairs shown in SEQ ID NO.2 and SEQ ID NO.3 or KASPar primer pairs shown in SEQ ID NO.4–SEQ ID NO.6; identifying the polymorphic sites of the obtained amplification products; wherein, the RBC and MCHC of Hu sheep carrying the GG genotype are significantly higher than those of Hu sheep carrying the AA and AG genotypes.
6. The method of claim 5, wherein, The typing and identification methods include direct sequencing, probe method, gene chip method, and KASP genotyping technology.
7. The method of claim 5, wherein, The method includes the following steps: S1. Genomic DNA was extracted from whole blood of Hu sheep. The extracted genomic DNA was then amplified by PCR using primer pairs shown in SEQ ID NO.2 and SEQ ID NO.
3. S2. Sequencing and sequence analysis of the PCR amplification products were performed to determine the genotype of the polymorphic sites.
8. The method of claim 5, wherein, Includes the following steps: a) Genomic DNA was extracted from whole blood of Hu sheep and amplified by high-throughput water bath PCR using the primer sets shown in SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6; b) After amplification, KASP genotyping technology was used, and fluorescence signals were detected and genotyping results were viewed using a BMG PHERAstar instrument.
9. The use of the method according to any one of claims 5-8 in the assisted breeding of Huzhou sheep, characterized in that, The application is to select Hu sheep breeds with high immunity.