Use of oncogene vgl l1 and the encoded protein thereof

By studying the expression and function of the VGLL1 gene and its encoded protein, we have provided reagents to reduce VGLL1 expression and to detect VGLL1, thus resolving the unclear mechanism of ovarian cancer metastasis. This has enabled us to inhibit the growth and metastasis of ovarian cancer cells and improve patient prognosis.

CN115466742BActive Publication Date: 2026-04-28SUN YAT SEN UNIV +1
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202210609994.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-05-31
Publication Date
2026-04-28
Estimated Expiration
2042-05-31

AI Technical Summary

Technical Problem

The metastasis mechanism of ovarian cancer is unclear, and existing treatment options are difficult to effectively inhibit metastasis, especially omental metastasis, resulting in poor patient prognosis and a lack of treatments with clearly defined targets.

Method used

By studying the expression and function of the VGLL1 gene and its encoded protein, we can provide reagents for reducing VGLL1 expression and for detecting VGLL1, which can be used to prepare drugs and kits for the treatment and diagnosis of ovarian cancer, and to target VGLL1 for treatment.

Benefits of technology

Inhibiting the growth and metastasis of ovarian cancer cells, improving patient prognosis, and providing new diagnostic and treatment strategies and drug screening platforms.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115466742B_ABST
    Figure CN115466742B_ABST
Patent Text Reader

Abstract

The application discloses an oncogene VGLL1 and application of a protein coded by the oncogene VGLL1, and particularly discloses application of a VGLL1 gene and / or a coded protein thereof in preparation of a medicine for treating cancer, and application of the VGLL1 gene and / or the coded protein thereof in preparation of a reagent or a kit for cancer diagnosis and / or prognosis judgment. It is found in the application that the oncogene VGLL1 has an important role in the occurrence and development process of tumors, and high expression of VGLL1 can induce malignant progression such as invasion and metastasis of ovarian cancer. It is also found in the research result that conditionally down-regulating VGLL1 can effectively relieve the growth of ovarian cancer cells and inhibit the invasion and metastasis ability of the ovarian cancer cells. The application provides a new diagnosis and treatment idea and a drug screening platform for solving clinical problems such as metastasis of ovarian cancer.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to the application of a novel oncogene and its encoded protein, particularly the application of the oncogene VGLL1 and its encoded protein. Background Technology

[0002] Currently, ovarian cancer ranks first among malignant tumors in women worldwide, and its incidence is showing a trend towards affecting younger women, becoming a significant threat to women's health. Treatment methods for ovarian cancer vary across regions and hospitals, generally including surgery, radiotherapy, and systemic therapy. 70% of ovarian cancer patients already have metastases at initial diagnosis. Even with cytoreductive surgery combined with adjuvant chemotherapy, metastasis is rarely achieved, and over 70% of patients experience recurrence. However, the specific mechanisms of ovarian cancer metastasis are unclear. The peritoneum is the most common site of metastasis, with a 5-year survival rate of less than 30% for patients with peritoneal metastases. The omentum, as an important component of the peritoneum, is most susceptible to involvement, and omental metastasis accompanied by ascites further accelerates tumor progression. Therefore, clarifying the specific mechanisms of omental metastasis in ovarian cancer and identifying targets to inhibit ovarian cancer metastasis are crucial for improving ovarian cancer treatment.

[0003] High-mobility group proteins (HMGs) are generally classified into three superfamilies: the HMG1 / HMG2 family, the HMG14 / HMG17 family, and the HMGA1 family. HMGA1 proteins function as structural transcription factors, participating in the structural activation of target gene promoters in multiple pathways and are involved in various cellular processes, including inducing the regulation of gene expression; HMGA1 proteins replace H1 histones at relevant sites, thereby altering chromatin structure; inducing tumorigenic transformation; and promoting tumor cell proliferation and migration. Recent studies have shown that HMGA1 participates in the transcriptional regulation of many tumor-related genes, binding to nuclear backbone-binding sequences (MARs / SARs). These sequences anchor chromatin in the central nucleus and organize independent DNA regions that play a role in both RNA transcription and translation into topological structures, thereby altering chromatin structure and further activating chromatin transcription. HMGA1 may contribute to malignant tumor progression through the transcriptional regulation of the aforementioned tumor-related genes.

[0004] TEAD transcription factors, also known as transcription enhancers, are key components of Hippo-YAP signaling, regulating processes related to cell proliferation and differentiation. In mammals, TEAD possesses highly conserved domains. Its four members, TEAD1-4, each contain a DNA-binding TEA domain (DBD), a transactivation domain (YBD) that interacts with transcriptional coactivators (YAP / TAZ), and the expression of various apoptosis-related genes. Within the TEAD family, TEAD1 and TEAD4, in particular, are significantly associated with the development of various cancers, playing a dominant role in the family. For example, studies have shown that TEAD1 can regulate mesothelin, a cancer biomarker overexpressed in various tumors. The synergistic effect of TEAD1 and YAP can induce cell growth and upregulate oncogenes, leading to the progression of cutaneous melanoma and embryonal rhabdomyosarcoma. TEAD4 is also an important transcription factor that has been repeatedly reported in recent years, promoting cancer cell proliferation and metastasis in various cancers, including gastric and colorectal cancer. Furthermore, TEAD4 has been shown to exert transcriptional regulatory functions independently of YAP / TAZ. Changes in TEAD subcellular localization are an important mechanism by which TEAD regulates its transcriptional activity independently of the Hippo signaling pathway. Interestingly, whether YAP / TAZ dependent or independent, increased TEAD expression and activity are associated with the progression of several solid tumors (such as breast cancer, colorectal cancer, pancreatic cancer, and prostate cancer), thus TEADs also serve as important mediators of tumor progression and therapeutic targets.

[0005] VGLL1 (Vestigial-like 1) is a Drosophila transcriptional coactivator Vestigial (Vg), whose family mainly consists of VGLL1-4. It contains a TOUDU domain and mediates interactions with TEA domain transcription factors (TEADs). Studies have found that VGLL1 is highly expressed in gastric cancer, breast cancer, and ovarian cancer, and promotes malignant tumor progression. Our results indicate that VGLL1 can act as a transcriptional coactivator, binding to TEAD4, transcribedly activating HMGA1, and subsequently activating the Wnt / β-catenin signaling pathway, inducing ovarian cancer cell proliferation, invasion, metastasis, and other malignant progressions. Therefore, exploring its molecular mechanism will provide more practical theoretical basis for solving problems such as ovarian cancer invasion and metastasis. Constructing a VGLL1 expression detection kit and designing drugs targeting VGLL1 are particularly important for the diagnosis and treatment of ovarian cancer. Summary of the Invention

[0006] The purpose of this invention is to provide a novel oncogene VGLL1 (Vestigial Like Family Member 1) and the application of its encoded protein.

[0007] This invention investigates the expression characteristics and regulatory mechanisms of VGLL1 in tumor tissues, particularly ovarian cancer, explores new functions of VGLL1, and provides new applications of VGLL1.

[0008] To achieve the above objectives, the following technical solutions are adopted:

[0009] This invention provides the use of the VGLL1 gene and / or its encoded protein in the preparation of medicaments for treating cancer.

[0010] This invention provides the use of reagents for reducing VGLL1 gene expression and / or reducing VGLL1 protein in the preparation of drugs for treating cancer.

[0011] Preferably, the reagent for reducing VGLL1 gene expression includes shRNA that reduces VGLL1 gene expression; more preferably, the sequence of the shRNA is shown in SEQ ID NO: 4 and / or SEQ ID NO: 5.

[0012] Preferably, the cancer treatment includes inhibiting the growth of tumor cells, inhibiting the metastasis of tumor cells, inhibiting tumorigenesis of tumor cells, and / or inducing apoptosis of tumor cells.

[0013] This invention provides the use of the VGLL1 gene and / or its encoded protein in the preparation of reagents or kits for cancer diagnosis and / or prognosis.

[0014] This invention provides the use of reagents for detecting VGLL1 in the preparation of reagents or kits for cancer diagnosis and / or prognosis.

[0015] Preferably, the reagent for detecting VGLL1 includes primer pairs with sequences such as SEQ ID NO: 1 and SEQ ID NO: 2 and / or VGLL1 antibody.

[0016] Preferably, the cancer is ovarian cancer.

[0017] This invention provides a drug for treating cancer, comprising shRNA that reduces VGLL1 gene expression, the sequence of which is shown in SEQ ID NO: 4 and / or SEQ ID NO: 5. Preferably, the cancer is ovarian cancer.

[0018] This invention provides a reagent or kit for cancer diagnosis and / or prognosis, the reagent or kit comprising a primer pair for detecting VGLL1 and / or a VGLL1 antibody, the sequences of the primer pair being as shown in SEQ ID NO: 1 and SEQ ID NO: 2. Preferably, the cancer is ovarian cancer.

[0019] Beneficial effects:

[0020] This invention discovered a novel oncogene, VGLL1, in ovarian cancer cells. Detection in a large number of clinical samples revealed high expression levels of VGLL1 in ovarian cancer patients, which was closely associated with poor prognosis and resistance to endocrine therapy. In vivo and in vitro functional studies showed that VGLL1 effectively promotes the proliferation and apoptosis of ovarian cancer cells. Inhibiting VGLL1 expression in ovarian cancer cells suppressed their invasive and metastatic abilities. In summary, this study found that VGLL1 plays a crucial role in the malignant development of ovarian cancer, promoting malignant proliferation and metastasis of tumor cells. This invention provides a new diagnostic and treatment strategy and drug screening platform for ovarian cancer. Attached Figure Description

[0021] Figure 1 This figure shows the expression of VGLL1 in the public database TCGA and 10 fresh clinical samples from our center (5 cases of primary ovarian cancer lesions vs. 5 cases of peritoneal metastatic cancer tissues); in the figure, abundance of primary: expression abundance of primary lesions and abundance of metastasis: expression abundance of metastatic lesions. Figure 2 The expression of VGLL1 in 7 pairs of ovarian cancer patient tissues, normal ovarian tissues, and ovarian cancer cell lines was shown.

[0022] Figure 3 The results showed that high VGLL1 expression was closely associated with metastasis and poor prognosis in ovarian cancer patients, consistent with the results of KM-plotter analysis in the public database.

[0023] Figure 4 Stable ovarian cancer cell lines with high and low VGLL1 expression were constructed.

[0024] Figure 5 The study showed that changes in VGLL1 expression levels affect the proliferation and metastasis of ovarian cancer cells in vitro.

[0025] Figure 6 The diagram shows that changes in VGLL1 expression levels affect the in vivo tumorigenicity and the ability of ovarian cancer cells to form distant metastases; the sequence corresponding to shVGLL1#1 in the figure is sh-1, and shVGLL1#1 / VGLL1 is a sequence in which VGLL1 is first silenced and then overexpressed.

[0026] Figure 7Our study demonstrated that a doxycycline (Dox)-induced expression system was constructed in ovarian cancer cells to induce downregulate VGLL1 expression. In vivo animal experiments showed that Dox-induced low VGLL1 expression significantly inhibited tumor growth and distant metastasis. Therefore, we believe VGLL1 may serve as a potential therapeutic target for improving the clinical prognosis of ovarian cancer patients. Specific implementation methods:

[0027] To better illustrate the purpose, technical solution, and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments.

[0028] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field.

[0029] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.

[0030] 1. RNA-seq high-throughput sequencing (results as follows) Figure 1 AC

[0031] Methods: RNA was extracted from cancer tissues of 5 primary ovarian cancer lesions and 5 peritoneal metastases for high-throughput sequencing. VGLL1 was found to be significantly highly expressed in the cancer tissues of peritoneal metastases. Western blot analysis confirmed the results, which were consistent with the sequencing findings.

[0032] 2. IHC detection of VGLL1 expression in clinical specimens from ovarian cancer patients (results are shown in Figure 1). Figure 2 (AE)

[0033] Using a specific antibody against VGLL1, the results showed that VGLL1 was significantly upregulated in ovarian cancer tissue (metastatic lesions vs. primary lesions) and normal ovarian tissue sections. More importantly, VGLL1 expression was significantly upregulated in metastatic ovarian cancer tissue compared to non-metastatic ovarian cancer tissue.

[0034] 3. High expression of VGLL1 has clinical significance (results as follows). Figure 3 (AD)

[0035] Statistical analysis using SPSS revealed that high expression of VGLL1 in clinical samples was closely associated with low survival rates and low recurrence-free survival rates in ovarian cancer patients.

[0036] 4. Constructing stable ovarian cancer cell lines with high and low VGLL1 expression (results are shown in Figure 1). Figure 4 (A)

[0037] Ovarian cancer cell lines A2780 and OVCAR3 were cultured in DMEM medium (DMEM; Gibco BRL) with an additional 10% fetal bovine serum (Gibco BRL) in a CO2 incubator at 37°C.

[0038] ① Constructing the expression plasmid for VGLL1

[0039] The full-length cDNA sequence of VGLL1 was amplified by PCR. The primer sequences are as follows:

[0040] F:GGATGAACACTTCTCCAGAGCTC

[0041] R:ATGGAGACGAGTAACGCCACTG

[0042] The purified full-length VGLL1 sequence was constructed into the pLVX-IRES-puro expression vector to obtain the VGLL1 expression plasmid pLVX-VGLL1.

[0043] (VGLL1 full-length sequence:

[0044] ATGGAAGAAATGAAGAAGACTGCCATCCGGCTGCCCAAAGGCAAACAGA AGCCTATAAAGACGGAATGGAATTCCCGGTGTGTCCTTTTCACCTACTTCCAAGGGGACATCAGCAGCGTAGTGGATGAACACTTCTCCAGAGCTCTGAG CAATATCAAGAGCCCCCAGGAATTGACCCCCTCGAGTCAGAGTGAAGGTGTGATGCTGAAAAACGATGATAGCATGTCTCCAAATCAGTGGCGTTACTC GTCTCCATGGACAAAGCCACAACCAGAAGTACCTGTCACAAACCGTGCCGCCAACTGCAACTTGCATGTGCCTGGTCCCATGGCTGTGAATCAGTTCTCAC CGTCCCTGGCTAGGAGGGCCTCTGTTCGGCCTGGGGAGCTGTGGCATTTCTCCTCCCTGGCGGGCACCAGCTCCTTAGAGCCTGGCTACTCTCATCCCTTC CCCGCTCGGCACCTGGTTCCAGAGCCCCAGCCTGATGGGAAACGTGAGCCTCTCCTAAGTCTCCTCCAGCAAGACAGATGCCTAGCCCGTCCTCAGGAAT CTGCCGCCAGGGAGAATGGCAACCCTGGCCAGATAGCTGGAAGCACAGGGTTGCTCTTCAACCTGCCTCCCGGCTCAGTTCACTATAAGAAACTATATGT ATCTCGTGGATCTGCCAGTACCAGCCTTCCAAATGAAACTCTTTCAGAGTTAGAGACACCTGGGAAATACTCACTTACACCACCAAACCACTGGGGCCAC CCACATCGATACCTGCAGCATCTTTAG)。

[0045] ② Transfect ovarian cancer cells

[0046] The obtained pLVX-VGLL1 and the control pLVX empty vector (pLVX-vector) were transfected into 293FT cells using Lipofectamine 2000 (Invitrogen, #11668) and an optimized packaging plasmid (Invitrogen, K4975-00), respectively. After 12 hours, DMEM medium supplemented with 10% fetal bovine serum was added. Lentiviral supernatant was collected at 48 and 72 hours and used to infect A2780 and OVCAR3 cell lines. Stable VGLL1 overexpressing cell lines A2780-VGLL1 and OVCAR3-VGLL1 were obtained after approximately 2 weeks of selection with puromycin (2 μg / mL; Thermo Fisher, A1113802). The control cell lines were A2780-Vec and OVCAR3-Vec.

[0047] 5. Constructing a stable ovarian cancer cell line with silenced VGLL1 expression.

[0048] Ovarian cancer cell lines A2780 and OVCAR3 were cultured in DMEM medium (DMEM; Gibco BRL) supplemented with 10% fetal bovine serum (Gibco BRL) at 37°C in a CO2 incubator. Stable expression of specific interfering sequences in VGLL1-shRNA (sh-1: 5'-GGTGATGGTCCAGAATTAAGA-3'; sh-2: 5'-GCCAGTACCAGCCTTCCAAAT-3) and a negative control (psiHIV-Ct1) was provided by GeneCopoeia. VGLL1-shRNA1,2 and the control psiHIV-Ct1 were transfected into 293FT cells using Lipofectamine 2000 (Invitrogen, 11668) and an optimized packaging plasmid (GeneCopoeia, HPK-LvTR). After 12 hours, the medium was replaced with DMEM (Gibco BRL) supplemented with 10% fetal bovine serum (Gibco BRL). Twenty-four hours later, retroviral supernatant was continuously collected and transduced into A2780 and OVCAR3 cell lines. Forty-eight hours after transfection, stable VGLL1-silenced cell lines A2780-sh1, A2780-sh2, OVCAR3-sh1, and OVCAR3-sh2, and their corresponding control cell lines A2780-Ct1 and OVCAR3-Ct1 were obtained after approximately two weeks of selection with 3 μg / mL G418 (Geneticin).

[0049] 6. Detection of VGLL1 gene expression

[0050] All cell lines established above should have their VGLL1 expression detected at the protein level using Western blot.

[0051] VGLL1 antibody: 10124-2-AP (Proteintech Group, Inc., USA)

[0052] 7. Ovarian cancer cell proliferation detection (results as follows) Figure 5 )

[0053] (1) In vitro experiments: Cell growth experiment (results are as follows) Figure 5 (A)

[0054] The changes in cell growth rate between cells expressing high levels of VGLL1 and those with silenced VGLL1 were detected using the MTT assay. The experimental procedures were performed according to the instructions for the MTT assay kit for cell proliferation (Roche, Mannheim). A brief description is as follows: Cells in the experimental group and the control group were cultured at 1×10⁶ cells / year. 4 Cells were seeded per well in a 24-well culture plate. Every 24 hours, 100 μL of a 10.3 mg / mL MTT-labeled mixture was added to each group of cells. After 4 hours of incubation, the absorbance (OD value) was measured using a microplate reader (Tecan). This experiment was repeated in triplicate.

[0055] Results analysis: MTT assay results showed that high expression of VGLL1 promoted the growth of ovarian cancer cells, while silencing VGLL1 inhibited cell growth.

[0056] (2) In vitro experiments: Plate colony formation experiment (results are as follows) Figure 5 (B)

[0057] The experimental group cells and the control group cells were seeded into 6-well plates, 1×10⁶ cells per well. 3 After 10 days of routine culture, clones were counted by staining with crystal violet. This experiment was repeated three times in parallel, and the mean and standard deviation were calculated.

[0058] Results analysis: Experimental results show that VGLL1 promotes the clonal formation of ovarian cancer cells.

[0059] (2) In vitro experiments: EdU proliferation assay (results are shown in the figure) Figure 5 Medium CD)

[0060] The experimental group cells and the control group cells were seeded into 96-well plates, with 1 × 10⁶ cells per well. 3 After adhesion, the cells were stained with EdU (5-ethynyl-2'-deoxyuridine) and the number of EdU+ cells was counted. This experiment was repeated in triplicate, and the mean and standard deviation were calculated.

[0061] (3) In vivo experiments: Subcutaneous tumor formation experiment (results as follows) Figure 6 AC

[0062] 1×10 6 Two experimental group cells and control group cells (A2780-vector) were injected into the left back of eight approximately four-week-old nude mice. Tumors that had grown on the mice were removed 35 days later, and tumor volume, tumor size, and survival rate were recorded 25 days later.

[0063] Results analysis: The results showed that high VGLL1 expression was significantly negatively correlated with survival rate after tumor resection in mice, and high VGLL1 expression clearly indicated a poor prognosis. Therefore, VGLL1 may serve as a potential indicator of poor prognosis in ovarian cancer patients.

[0064] 8. Analysis of the metastatic ability of ovarian cancer cells in vivo

[0065] In vivo experiments: In vivo tumor metastasis model in nude mice (results as follows) Figure 6 DK)

[0066] (1) 1×10⁻⁶ mg of the drug was injected into 10 nude mice via the tail vein. 6 Cells from the experimental group and the control group were used. The formation of metastatic tumor nodules in the lungs and the survival of nude mice were detected 3 months after injection. After the animals died, the lungs of each group were collected and the number of tumor clones formed in the lungs was further determined by picric acid staining and H&E staining. (2) 1×10 cells were injected into each of the 10 nude mice via intraperitoneal injection. 6 Cells from the experimental group and control group were analyzed. Two months after injection, the presence of metastatic nodules in the peritoneum, mesentery, and greater omentum of nude mice, as well as the survival status of the mice, were examined. Results analysis: High expression of VGLL1 inhibited the tumor formation of ovarian cancer cells in the lungs and peritoneum, indicating that VGLL1 has an inhibitory effect on ovarian cancer cell metastasis.

[0067] 9. Therapeutic effects targeting VGLL1:

[0068] In the ovarian cancer cell lines A2780 and OVCAR3, a doxycycline (Dox)-induced expression system was constructed to induce downregulate VGLL1 expression. Western blot analysis confirmed the successful construction of the Dox system. Figure 7 (A). Through in vivo animal experiments, we observed that Dox-induced low expression of VGLL1 significantly inhibited tumor growth, distant metastasis, and malignant progression. Figure 7 (BI). Therefore, we believe that VGLL1 may serve as a potential therapeutic target for improving the clinical prognosis of ovarian cancer patients.

[0069] This invention discloses the clinical applications of the oncogene VGLL1 and its encoded protein. The inventors conducted in vivo and in vitro functional studies on the oncogene VGLL1, revealing its crucial role in tumor development and progression. High expression of VGLL1 can induce invasion, metastasis, and other malignant progression in ovarian cancer. To further investigate whether targeting VGLL1 in ovarian cancer can inhibit its invasion and metastasis, a doxycycline (Dox)-induced expression system was constructed in ovarian cancer cells to induce conditional downregulation of VGLL1 expression. The results showed that inducing conditional downregulation of VGLL1 effectively alleviated the growth of ovarian cancer cells and inhibited their invasion and metastasis. This invention provides a new diagnostic and therapeutic approach and drug screening platform for addressing clinical problems such as ovarian cancer metastasis.

[0070] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention. sequence list <110> Sun Yat-sen University, Sun Yat-sen University Cancer Center <120> Applications of oncogene VGLL1 and its encoded protein <160> 5 <170> PatentIn version 3.3 <210> 1 <211> twenty three <212> DNA <213> Artificial sequence <400> 1 ggatgaacac ttctccagag ctc 23 <210> 2 <211> twenty two <212> DNA <213> Artificial sequence <400> 2 atggagacga gtaacgccac tg 22 <210> 3 <211> 777 <212> DNA <213> Artificial sequence <400> 3 atggagaaa tgagagac tgccatccgg ctgcccaag gcaacagaa gcctataag 60 acggaatgga attcccggtg tgtccttttc acctacttcc aagggacat cagcagcgta 120 gtggatgaac acttctccag agctctgagc atatcaaga gcccccagga attgaccccc 180 tcgagtcaga gtgaaggtgt gatgctgaaa aacgatgata gcatgtctcc aaatcagtgg 240 cgttactcgt ctccatggac aaagccacaa ccagaagtac ctgtcacaaa ccgtgccgcc 300 aactgcaact tgcatgtgcc tgtcccatg gctgtgaatc agttctcacc gtccctggct 360 agggaggcct ctgttcggcc tgggagctg tggcatttct cctccctggc gggcaccagc 420 tccttagagc ctggctactc tcatccctc cccgctcggc acctgttcc agagccccag 480 cctgatggga aacgtgagcc tctcctaagt ctcctccagc aagacagatg cctagcccgt 540 cctcaggaat ctgccgccag ggagaatggc aaccctggcc agatagctgg aagcacaggg 600 ttgctcttca acctgcctcc cggctcagtt cactataaga aactatatgt atctcgtgga 660 tctgccagta ccagccttcc aaatgaaact cttcagagt tagagacacc tgggaatac 720 tcacttacac caccaaacca ctggggccac ccacatcgat acctgcagca tctttag 777 <210> 4 <211> twenty one <212> DNA <213> Artificial sequence <400> 4 ggtgatggtc cagaattaag a 21 <210> 5 <211> twenty one <212> DNA <213> Artificial sequence <400> 5 gccagtacca gccttccaaa t 21

Claims

1. Application of reagents that reduce VGLL1 gene expression in the preparation of drugs for treating cancer; The cancer in question is ovarian cancer; The reagent for reducing VGLL1 gene expression includes shRNA that reduces VGLL1 gene expression; the sequence of the shRNA is shown in SEQ ID NO: 4 and / or SEQ ID NO:

5.

2. The application according to claim 1, characterized in that, The cancer treatment includes inhibiting the growth of tumor cells, inhibiting the metastasis of tumor cells, and / or inhibiting the tumorigenicity of tumor cells.

3. A drug for treating cancer, characterized in that, Including shRNA that reduces VGLL1 gene expression, the sequence of which is shown in SEQ ID NO: 4 and / or SEQ ID NO: 5; The cancer in question is ovarian cancer.

Citation Information

Patent Citations

  • Hla-restricted VGLL1 peptides and use thereof

    CN110352067A

  • Use of VGLL1 as a target for the treatment of cancer or inhibition of metatasis

    KR1020150050681A

  • KR20200045131A