Construction and application of an engineered bacterium for efficient synthesis of 5-methylpyrazine-2-carboxylic acid
By constructing recombinant engineered bacteria expressing threonine dehydrogenase, xylene monooxygenase, benzyl alcohol dehydrogenase, and benzaldehyde dehydrogenase, a one-step, highly efficient synthesis of 5-methylpyrazine-2-carboxylic acid using L-threonine as a substrate was achieved. This solves the problems of low synthesis efficiency and high cost in existing technologies and realizes an efficient and environmentally friendly production method.
Patent Information
- Application Number
- CN202110596118.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2021-05-30
- Publication Date
- 2026-07-28
- Estimated Expiration
- 2041-05-30
AI Technical Summary
Existing technologies for the synthesis of 5-methylpyrazine-2-carboxylic acid suffer from problems such as high requirements for reaction conditions, high production costs, significant environmental pollution, and low yield. In particular, the efficiency and yield of chemical synthesis and biotransformation methods have not yet reached ideal levels.
A recombinant engineered bacterium was constructed to express threonine dehydrogenase, xylene monooxygenase, benzyl alcohol dehydrogenase, and benzaldehyde dehydrogenase. 5-methylpyrazine-2-carboxylic acid was produced by fermentation using L-threonine as a substrate, achieving a one-step, high-efficiency conversion.
A one-step, highly efficient conversion of L-threonine to 5-methylpyrazine-2-carboxylic acid was achieved, with a molar conversion rate of over 85%. The process is simple, has a short cycle time, produces little pollution, and is easy to separate and purify, making it suitable for industrial production.
Smart Images

Figure CN115478041B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biosynthesis technology, specifically relating to the construction and application of an engineered bacterium that efficiently synthesizes 5-methylpyrazine-2-carboxylic acid. Background Technology
[0002] 5-Methylpyrazine-2-carboxylic acid (MPCA) is a white, off-white crystalline solid with CAS number 5521-55-1, molecular formula C6H6N2O2, molecular weight 138.12, melting point 166-169℃, and a pungent odor. It slowly oxidizes upon exposure to air. MPCA has wide applications in the pharmaceutical industry, primarily in the synthesis of hypoglycemic drugs such as glipizide, novel antihypertensive drugs such as acilimib, and antituberculosis drugs such as methyl 5-methylpyrazine-2-carboxylic acid.
[0003] Currently, its synthesis mainly employs chemical synthesis methods, which can be categorized into intermolecular cyclization, multi-step synthesis of pyrazine side chains, direct oxidation, and electrochemical methods. However, chemical synthesis methods suffer from drawbacks such as demanding reaction conditions, the use of large amounts of oxidants, high production costs, and significant environmental pollution. Biotransformation methods, on the other hand, offer advantages such as simple synthesis processes, good substrate selectivity, high catalytic efficiency, fewer impurities, and less environmental pollution, making them highly promising for future development.
[0004] Lonza, a Swiss company, has successfully prepared 5-methylpyrazine-2-carboxylic acid in a batch-fed reactor using a strain containing xylene monooxygenase. Zheng Yuguo et al., Chemical and Biological Engineering, 2012, 29(9): 19-25, screened a strain of *Pseudomonas putida* containing xylene monooxygenase and used this strain for the bioprocessing of 5-methylpyrazine-2-carboxylic acid. After fed-batch fermentation, the yield reached 75.6%, the product concentration reached 20.41 g / L, and the cycle lasted up to 22 days.
[0005] CN106434434A discloses a strain HW-1 that produces xylene monooxygenase by catalyzing monooxygenation reactions with high regioselectivity. 5-methylpyrazine-2-carboxylic acid was prepared by fermentation using this strain. After shake-flask fermentation with timely feeding, the cumulative concentration of the product reached 34.19 g / L, with a yield of 81.4%.
[0006] CN107312806A discloses an enzymatic method for producing 5-methylpyrazine-2-carboxylic acid. The enzyme is an aldehyde dehydrogenase or a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of an aldehyde dehydrogenase. Using 5-methyl-2-pyrazinaldehyde as the reaction substrate, the reaction is carried out for 12 hours under the catalysis of the above enzyme to obtain 17.02 mM of 5-methyl-2-pyrazine carboxylic acid.
[0007] CN107974428A discloses a method for producing 5-methylpyrazine-2-carboxylic acid using recombinant Escherichia coli. This method primarily uses an endogenous granulated plasmid pWWO from Pseudomonasputida ATCC 33015 as a template to construct a recombinant plasmid. The recombinant E. coli is then induced by isopropyl thiogalactoside (IPTG) to express xylene monooxygenase and benzyl alcohol dehydrogenase. The entire cell is then transformed with the substrate 2,5-dimethylpyrazine, yielding 2.5 g / L with a molar conversion rate of 96.2%. This method has a short transformation time and a high molar conversion rate, but the yield is relatively low.
[0008] Existing technologies also exist for the catalytic synthesis of 2,5-dimethylpyrazine using L-threonine as a substrate. For example, CN111411067A discloses a recombinant Escherichia coli strain that produces high levels of 2,5-dimethylpyrazine. This recombinant strain uses Escherichia coli K-12 as a host, overexpresses L-threonine dehydrogenase, and heterologously expresses NADH oxidase and aminoacetone oxidase. Simultaneously, the 2-amino-3-ketobutyrate CoA ligase gene kb1 and the primary amine oxidase gene tynA of the recombinant strain are knocked out. Cao Yanli et al., Construction of a high-yield strain of 2,5-dimethylpyrazine using L-threonine as a fermentation substrate, Food and Fermentation Industries, 2020, 46(1): 1-10. They constructed a 2,5-dimethylpyrazine-producing strain using L-threonine as a fermentation substrate. By exogenously expressing L-threonine dehydrogenase (TDH) from different microbial species using Bacillus subtilis168 (B. subtilis 168), and comparing the yield of 2,5-DMP synthesized using L-threonine as a substrate, a high-yielding 2,5-DMP strain was selected. Based on this, NADH oxidase (NOX) was further exogenously expressed to promote cofactor regeneration. A high-yielding 2,5-DMP genetically engineered strain, B. subtilis168 / pMA0911-tdh(Ec)-nox, was constructed. Using 5.83 g / L L-threonine as a substrate, this strain achieved a 2,5-DMP yield of 616.04 mg / L after 24 h of fermentation.
[0009] In summary, existing technologies mostly use 2,5-dimethylpyrazine as a starting substrate, catalyzing the production of 5-methylpyrazine-2-carboxylic acid in three steps via xylene monooxygenase, benzyl alcohol dehydrogenase, and benzaldehyde dehydrogenase. Each method suffers from drawbacks such as operational instability, low production capacity, high production costs, and long production cycles. Therefore, a simple, environmentally friendly, and efficient production method for 5-methylpyrazine-2-carboxylic acid is urgently needed. Summary of the Invention
[0010] In order to overcome the shortcomings of the prior art, the present invention aims to provide an engineered bacterium that can efficiently synthesize 5-methylpyrazine-2-carboxylic acid. This bacterium can ferment L-threonine as a substrate to produce 5-methylpyrazine-2-carboxylic acid, realizing the one-step conversion of L-threonine into 5-methylpyrazine-2-carboxylic acid.
[0011] In a first aspect, the present invention provides a recombinant engineered bacterium for the biocatalytic synthesis of 5-methylpyrazine-2-carboxylic acid, wherein the recombinant engineered bacterium expresses threonine dehydrogenase (TDH), xylene monooxygenase (XMO), benzyl alcohol dehydrogenase (BADH), and benzaldehyde dehydrogenase (BZDH).
[0012] The threonine dehydrogenase described is a threonine dehydrogenase derived from Escherichia coli, the amino acid sequence of which is shown in SEQ ID NO: 1; the nucleotide sequence of which is shown in SEQ ID NO: 2.
[0013] The xylene monooxygenase described is a xylene monooxygenase derived from the Pseudomonas aeruginosa strain, and its amino acid sequence is shown in SEQ ID NO: 3; its nucleotide sequence is shown in SEQ ID NO: 4.
[0014] The benzyl alcohol dehydrogenase described is a benzyl alcohol dehydrogenase derived from Pseudomonas aeruginosa strain, and its amino acid sequence is shown in SEQ ID NO: 5; its nucleotide sequence is shown in SEQ ID NO: 6.
[0015] The benzaldehyde dehydrogenase described is a benzaldehyde dehydrogenase derived from Pseudomonas aeruginosa strain, and its amino acid sequence is shown in SEQ ID NO: 7; its nucleotide sequence is shown in SEQ ID NO: 8.
[0016] A second aspect of the present invention provides a method for constructing the recombinant engineered bacteria.
[0017] A method for constructing a recombinant engineered bacterium for the biocatalytic synthesis of 5-methylpyrazine-2-carboxylic acid includes cloning the threonine dehydrogenase gene tdh, the xylene monooxygenase gene xmo, the benzyl alcohol dehydrogenase gene badh, and the benzaldehyde dehydrogenase gene bzdh into an expression vector to construct a recombinant expression plasmid, and then transferring the constructed expression plasmid into a host cell for expression.
[0018] Preferably, the expression vector of the recombinant engineered bacteria is selected from one or more of pRSFDuet-1, pET-28a, pETDuet-1, and pCDFDuet-1; in one embodiment, the vector is pRSFDuet-1; in another embodiment, the vector is pET-28a and pETDuet-1; in another embodiment, the vector is pET-28a and pCDFDuet-1; in another embodiment, the vector is pET-28a, pETDuet-1, and pCDFDuet-1; in another embodiment, the vector is pETDuet-1; in another embodiment, the vector is pETDuet-1 and pET-28a.
[0019] The expression process involves ligating the gene of the corresponding enzyme into a recombinant expression plasmid of an expression vector, and then transferring the expression plasmid into a host cell for expression.
[0020] Preferably, the recombinant engineered bacteria is constructed using Escherichia coli BL21(DE3) as the host.
[0021] In one embodiment, the expression involves ligating the threonine dehydrogenase gene tdh, the xylene monooxygenase gene xmo, the benzyl alcohol dehydrogenase gene badh, and the benzaldehyde dehydrogenase gene bzdh into the expression vector pRSFDuet-1 to obtain the recombinant expression plasmid pRSFDuet-1-tdhxmobadhbzdh. Specifically, the threonine dehydrogenase gene tdh and the xylene monooxygenase gene xmo are cloned between the SacI and NotI restriction sites at the first multiple cloning site of pRSFDuet-1, and the benzyl alcohol dehydrogenase gene badh and the benzaldehyde dehydrogenase gene bzdh are cloned between the NdeI and XhoI restriction sites at the second multiple cloning site of pRSFDuet-1. Under primer initiation, high-fidelity Pfu DNA polymerase was used to amplify the gene sequences of threonine dehydrogenase (tdh), xylene monooxygenase (xmo), benzyl alcohol dehydrogenase (badh), and benzaldehyde dehydrogenase (bzdh). After sequencing, the amplified fragments were processed in two steps using SacI and NotI, and NdeI and XhoI restriction endonucleases (TaKaRa). The fragments were then ligated to the vector pRSFDuet-1, which had been treated with the same restriction endonucleases, using T4 DNA ligase (TaKaRa) to construct the expression vector pRSFDuet-1-tdhxmobadhbzdh. The expression plasmid pRSFDuet-1-tdhxmobadhbzdh was then transformed into Escherichia coli BL21(DE3) for expression.
[0022] In one embodiment, the expression involves ligating the threonine dehydrogenase gene tdh into the expression vector pET28a to obtain the recombinant expression plasmid pET28a-tdh, and ligating the xylene monooxygenase gene xmo, the benzyl alcohol dehydrogenase gene badh, and the benzaldehyde dehydrogenase gene bzdh into the expression vector pETDuet-1 to obtain the recombinant expression plasmid pETDuet-1-xmobadhbzdh. Specifically, the threonine dehydrogenase gene tdh is cloned into the pET28a restriction site between SacI and NotI, the xylene monooxygenase gene xmo is cloned into the pETDuet-1 first multiple cloning site between SacI and NotI, and the benzyl alcohol dehydrogenase gene badh and the benzaldehyde dehydrogenase gene bzdh are cloned into the pETDuet-1 second multiple cloning site between NdeI and XhoI. Under primer initiation, high-fidelity Pfu DNA polymerase was used to amplify the gene sequences of threonine dehydrogenase (tdh), xylene monooxygenase (xmo), benzyl alcohol dehydrogenase (badh), and benzaldehyde dehydrogenase (bzdh). After sequencing, the amplified fragments were treated with SacI and NotI, NdeI and XhoI restriction endonucleases (TaKaRa), respectively. The fragments were then ligated with the vectors pET28a and pETDuet-1, which were treated with the same restriction endonucleases, using T4 DNA ligase (TaKaRa) to construct the expression vectors pET28a-tdh and pETDuet-1-xmobadhbzdh. The expression plasmids pET28a-tdh and pETDuet-1-xmobadhbzdh were then transformed into Escherichia coli BL21(DE3) for expression.
[0023] In one embodiment, the expression involves ligating the threonine dehydrogenase gene tdh into the expression vector pET28a to obtain the recombinant expression plasmid pET28a-tdh, and ligating the xylene monooxygenase gene xmo, the benzyl alcohol dehydrogenase gene badh, and the benzaldehyde dehydrogenase gene bzdh into the expression vector pCDFDuet-1 to obtain the recombinant expression plasmid pCDFDuet-1-xmobadhbzdh. Specifically, the threonine dehydrogenase gene tdh is cloned into the pET28a restriction site between SacI and NotI, the xylene monooxygenase gene xmo and the benzyl alcohol dehydrogenase gene badh are cloned into the pCDFDuet-1 first multiple cloning site between SacI and NotI, and the benzaldehyde dehydrogenase gene bzdh is cloned into the pCDFDuet-1 second multiple cloning site between NdeI and XhoI. Under primer initiation, high-fidelity Pfu DNA polymerase was used to amplify the gene sequences of threonine dehydrogenase (tdh), xylene monooxygenase (xmo), benzyl alcohol dehydrogenase (badh), and benzaldehyde dehydrogenase (bzdh). After sequencing, the amplified fragments were treated with SacI and NotI, NdeI and XhoI restriction endonucleases (TaKaRa), respectively. The fragments were then ligated with the vectors pET28a and pCDFDuet-1, which were treated with the same restriction endonucleases, using T4 DNA ligase (TaKaRa) to construct the expression vectors pET28a-tdh and pCDFDuet-1-xmobadhbzdh. The expression plasmids pET28a-tdh and pCDFDuet-1-xmobadhbzdh were then transformed into Escherichia coli BL21(DE3) for expression.
[0024] In one embodiment, the expression involves ligating the threonine dehydrogenase gene tdh into the expression vector pET28a to obtain the recombinant expression plasmid pET28a-tdh, ligating the xylene monooxygenase gene xmo into the expression vector pETDuet-1 to obtain the recombinant expression plasmid pETDuet-1-xmo, and ligating the benzyl alcohol dehydrogenase gene badh and the benzaldehyde dehydrogenase gene bzdh into the expression vector pCDFDuet-1 to obtain the recombinant expression plasmid pCDFDuet-1-badhbzdh. The specific operation is as follows: The threonine dehydrogenase gene tdh was cloned between the SacI and NotI restriction sites of pET28a; the xylene monooxygenase gene xmo was cloned between the SacI and NotI restriction sites of the first multiple cloning site of pETDuet-1; the benzyl alcohol dehydrogenase gene badh was cloned between the SacI and NotI restriction sites of the first multiple cloning site of pCDFDuet-1; and the benzaldehyde dehydrogenase gene bzdh was cloned between the NdeI and XhoI restriction sites of the second multiple cloning site of pCDFDuet-1. Under primer initiation, high-fidelity Pfu DNA polymerase was used to amplify the gene sequences of threonine dehydrogenase (tdh), xylene monooxygenase (xmo), benzyl alcohol dehydrogenase (badh), and benzaldehyde dehydrogenase (bzdh). After sequencing, the amplified fragments were treated with SacI and NotI, and NdeI and XhoI restriction endonucleases (TaKaRa), respectively. The fragments were then ligated with the vectors pET28a, pETDuet-1, and pCDFDuet-1, treated with the same restriction endonucleases, respectively, using T4 DNA ligase (TaKaRa) to construct expression vectors pET28a-tdh, pETDuet-1-xmo, and pCDFDuet-1-badhbzdh. The expression plasmids pET28a-tdh, pETDuet-1-xmo, and pCDFDuet-1-badhbzdh were then transformed into *E. coli* BL21(DE3) for expression.
[0025] In one embodiment, the expression involves ligating the threonine dehydrogenase gene tdh into the expression vector pET28a to obtain the recombinant expression plasmid pET28a-tdh, ligating the xylene monooxygenase gene xmo into the expression vector pCDFDuet-1 to obtain the recombinant expression plasmid pCDFDuet-1-xmo, and ligating the benzyl alcohol dehydrogenase gene badh and the benzaldehyde dehydrogenase gene bzdh into the expression vector pETDuet-1 to obtain the recombinant expression plasmid pETDuet-1-badhbzdh. Specific operations are described below. The threonine dehydrogenase gene tdh was cloned into the pET28a restriction site between SacI and NotI; the xylene monooxygenase gene xmo was cloned into the pCDFDuet-1 first multiple cloning site between SacI and NotI; the benzyl alcohol dehydrogenase gene badh was cloned into the pETDuet-1 first multiple cloning site between SacI and NotI; and the benzaldehyde dehydrogenase gene bzdh was cloned into the pETDuet-1 second multiple cloning site between NdeI and XhoI. Under primer initiation, high-fidelity Pfu DNA polymerase was used to amplify the gene sequences of threonine dehydrogenase (tdh), xylene monooxygenase (xmo), benzyl alcohol dehydrogenase (badh), and benzaldehyde dehydrogenase (bzdh). After sequencing, the amplified fragments were treated with SacI and NotI, and NdeI and XhoI restriction endonucleases (TaKaRa), respectively. These fragments were then ligated with the vectors pET28a, pETDuet-1, and pCDFDuet-1, treated with the same restriction endonucleases, respectively, using T4 DNA ligase (TaKaRa) to construct the expression vectors pET28a-tdh, pCDFDuet-1-xmo, and pETDuet-1-badhbzdh. The expression plasmids pET28a-tdh, pCDFDuet-1-xmo, and pETDuet-1-badhbzdh were then transformed into *E. coli* BL21(DE3) for expression.
[0026] In one embodiment, the expression involves ligating the threonine dehydrogenase gene tdh, the xylene monooxygenase gene xmo, the benzyl alcohol dehydrogenase gene badh, and the benzaldehyde dehydrogenase gene bzdh into the expression vector pETDuet-1 to obtain the recombinant expression plasmid pETDuet-1-tdhxmobadhbzdh. Specifically, the threonine dehydrogenase gene tdh and the xylene monooxygenase gene xmo are cloned between the SacI and NotI restriction sites at the first multiple cloning site of pETDuet-1, and the benzyl alcohol dehydrogenase gene badh and the benzaldehyde dehydrogenase gene bzdh are cloned between the NdeI and XhoI restriction sites at the second multiple cloning site of pETDuet-1. Under primer initiation, high-fidelity Pfu DNA polymerase was used to amplify the gene sequences of threonine dehydrogenase (tdh), xylene monooxygenase (xmo), benzyl alcohol dehydrogenase (badh), and benzaldehyde dehydrogenase (bzdh). After sequencing, the amplified fragments were treated with SacI and NotI, NdeI and XhoI restriction endonucleases (TaKaRa), and then ligated with the same restriction endonuclease-treated vector pETDuet-1 using T4 DNA ligase (TaKaRa) to construct the expression vector pETDuet-1-tdhxmobadhbzdh. The expression plasmid pETDuet-1-tdhxmobadhbzdh was then transformed into E. coli BL21(DE3) for expression.
[0027] In another embodiment, the expression involves ligating the threonine dehydrogenase gene tdh into the expression vector pET28a to obtain the recombinant expression plasmid pET28a-tdh, and ligating the xylene monooxygenase gene xmo, the benzyl alcohol dehydrogenase gene badh, and the benzaldehyde dehydrogenase gene bzdh into the expression vector pETDuet-1 to obtain the recombinant expression plasmid pETDuet-1-xmobadhbzdh. Specifically, the threonine dehydrogenase gene tdh is cloned into the pET28a restriction site between SacI and NotI, the xylene monooxygenase gene xmo and the benzyl alcohol dehydrogenase gene badh are cloned into the first multiple cloning site of pETDuet-1 between SacI and NotI, and the benzaldehyde dehydrogenase gene bzdh is cloned into the second multiple cloning site of pETDuet-1 between NdeI and XhoI. Under primer initiation, high-fidelity Pfu DNA polymerase was used to amplify the gene sequences of threonine dehydrogenase (tdh), xylene monooxygenase (xmo), benzyl alcohol dehydrogenase (badh), and benzaldehyde dehydrogenase (bzdh). After sequencing, the amplified fragments were treated with SacI and NotI, and NdeI and XhoI restriction endonucleases (TaKaRa), respectively. These fragments were then ligated with the vectors pET28a and pETDuet-1, which were treated with the same restriction endonucleases, using T4 DNA ligase (TaKaRa) to construct the expression vectors pET28a-tdh and pETDuet-1-xmobadhbzdh. The expression plasmids pET28a-tdh and pETDuet-1-xmobadhbzdh were then transformed into *E. coli* BL21(DE3) for expression.
[0028] In a third aspect, the present invention provides a method for synthesizing 5-methylpyrazine-2-carboxylic acid, wherein the method utilizes L-threonine as a substrate and prepares 5-methylpyrazine-2-carboxylic acid by catalytic reaction using threonine dehydrogenase, xylene monooxygenase, benzyl alcohol dehydrogenase, and benzaldehyde dehydrogenase as catalysts.
[0029] A method for synthesizing 5-methylpyrazine-2-carboxylic acid, using the recombinant engineered bacteria described in this invention as the starting strain, and fermenting in a medium containing L-threonine to produce 5-methylpyrazine-2-carboxylic acid.
[0030] Preferably, the fermentation is carried out using L-threonine as the sole substrate.
[0031] The culture medium used for fermentation includes carbon sources, nitrogen sources, and inorganic salts. This invention does not specifically limit the fermentation culture medium; any medium that is conducive to the growth of the microorganisms is acceptable. Those skilled in the art can choose commercially available culture media or prepare their own as needed. In one embodiment, the culture medium used in the fermentation process comprises 1.2% peptone, 2.4% yeast extract, 17 mM K₂HPO₄, 72 mM KH₂PO₄, 0.5% glycerol, and 0.001% SAG630 antifoaming agent.
[0032] Preferably, the concentration of the substrate L-threonine is 6-12 g / L, more preferably 8-12 g / L, and even more preferably 10 g / L.
[0033] Preferably, the reaction time is 8-12 hours, more preferably 8 hours.
[0034] Preferably, the reaction temperature is 22-30℃, and more preferably 28℃.
[0035] Preferably, the pH of the reaction system is 6.5-7.5, and more preferably 7.0-7.2.
[0036] The following details a method for the efficient synthesis of 5-methylpyrazine-2-carboxylic acid. Recombinant engineered bacteria expressing threonine dehydrogenase, xylene monooxygenase, benzyl alcohol dehydrogenase, and benzaldehyde dehydrogenase are inoculated into a fermenter containing culture medium and cultured in a stepwise expansion manner. The inoculation is 1–10% of the fermentation broth volume. The mixture is then cultured at 37±0.5℃, with the pH controlled at 6.5–7.5. When the OD600 reaches 12 or higher, IPTG, the inducer, is added to a final concentration of 20–200 μg / ml. The mixture is then cultured at 22–30℃ for 3–5 hours. L-threonine substrate is fed in over 2–5 hours until a final concentration of 6–12 g / L is reached. Fermentation continues for 8–12 hours, at which point the reaction is complete.
[0037] Furthermore, the final concentration of the added inducing agent IPTG is 20–28 μg / ml, preferably 24 μg / ml.
[0038] Furthermore, the induction temperature is 22–30°C, preferably 28°C.
[0039] Compared with the prior art, the present invention has achieved the following beneficial effects:
[0040] This invention achieves a one-step, highly efficient synthesis of 5-methylpyrazine-2-carboxylic acid using L-threonine as a substrate by constructing a recombinant engineered bacterium that simultaneously expresses threonine dehydrogenase, xylene monooxygenase, benzyl alcohol dehydrogenase, and benzaldehyde dehydrogenase. The molar conversion rate is as high as 85% or more. The method of this invention is simple, has a short production cycle, high substrate conversion rate, and the product is easy to separate and purify from the reaction solution. It also has low process pollution, low energy consumption, and is easy to scale up for production. Attached Figure Description
[0041] Figure 1 Diagram showing the construction of the expression vector pRSFDuet-1-tdhxmobadhbzdh plasmid;
[0042] Figure 2 Diagram showing the construction of the expression vector pET28a-tdh plasmid;
[0043] Figure 3 Diagram showing the construction of the expression vector pETDuet-1-xmobadhbzdh plasmid;
[0044] Figure 4 Diagram showing the construction of the expression vector pCDFDuet-1-xmobadhbzdh plasmid;
[0045] Figure 5 : Construction diagram of expression vector pETDuet-1-xmo plasmid;
[0046] Figure 6 Diagram showing the construction of the expression vector pCDFDuet-1-badhbzdh plasmid;
[0047] Figure 7 Diagram showing the construction of the expression vector pCDFDuet-1-xmo plasmid;
[0048] Figure 8 Diagram showing the construction of the expression vector pETDuet-1-badhbzdh plasmid;
[0049] Figure 9 Diagram showing the construction of the expression vector pETDuet-1-tdhxmobadhbzdh plasmid;
[0050] Figure 10 Diagram of the construction of the expression vector pETDuet-1-xmobadhbzdh-1 plasmid;
[0051] Figure 11 The effect of different construction methods on substrate conversion efficiency;
[0052] Figure 12 Effect of different inducer concentrations on substrate conversion;
[0053] Figure 13 Effect of different induction temperatures on substrate conversion;
[0054] Figure 14 Effect of different induction times on substrate conversion rate;
[0055] Figure 15 Effect of different substrate concentrations on substrate conversion rate;
[0056] Figure 16 The effect of reaction time on product concentration; Detailed Implementation
[0057] The technical solution of the present invention will be described below with reference to specific embodiments. It should be understood that the following embodiments are only used to illustrate the present invention and not to limit the scope of protection of the present invention.
[0058] Unless otherwise specified, all reagents and materials used in the following examples are commercially available. Detailed experimental conditions and parameters not described in the experiments are standard techniques in the field. For gene cloning procedures, please refer to "Molecular Cloning: A Laboratory Manual" by J. Sambrook et al.
[0059] The one-step cloning kits used in the gene engineering operations of this invention were all purchased from Vazyme, Nanjing Vinozyme Biotechnology Co., Ltd.; plasmid extraction kits and DNA recovery and purification kits were purchased from Axygen Hangzhou Co., Ltd.; E. coli BL21(DE3), plasmids, etc., were purchased from Shanghai Sangon Biotech Co., Ltd.; DNA markers, FastPfu DNA polymerase, low molecular weight standard proteins, agarose gel electrophoresis reagents, primer synthesis, and gene sequencing were all performed by Shanghai Sangon Biotech Co., Ltd. The usage methods of the above reagents are as described in the product instructions.
[0060] This invention employs high-performance liquid chromatography (HPLC) for the quantitative detection of 5-methylpyrazine-2-carboxylic acid, under the following specific conditions:
[0061] Chromatographic column: YMC-Triart C18, 5μm, 4.6×250mm;
[0062] Column temperature: 25℃;
[0063] Mobile phase: methanol-0.01 mol / L tetrabutylammonium hydroxide solution (volume ratio 15:85) (adjusted to pH 6.0 with phosphoric acid);
[0064] Flow rate: 1.0 ml / min;
[0065] Detection wavelength: 264nm;
[0066] Injection volume: 20 μl.
[0067] The genes involved in the embodiments of this invention:
[0068] The threonine dehydrogenase is a threonine dehydrogenase derived from Escherichia coli, the amino acid sequence of which is shown in SEQ ID NO: 1; the nucleotide sequence of which is shown in SEQ ID NO: 2.
[0069] The xylene monooxygenase is a xylene monooxygenase derived from the Pseudomonas aeruginosa strain, the sequence of which is shown in SEQ ID NO: 3; the nucleotide sequence is shown in SEQ ID NO: 4.
[0070] The benzyl alcohol dehydrogenase is derived from the Pseudomonas aeruginosa strain, and its amino acid sequence is shown in SEQ ID NO: 5; its nucleotide sequence is shown in SEQ ID NO: 6.
[0071] The benzaldehyde dehydrogenase is derived from the Pseudomonas aeruginosa strain, and its amino acid sequence is shown in SEQ ID NO: 7; its nucleotide sequence is shown in SEQ ID NO: 8.
[0072] Primer descriptions:
[0073] Primer 1: GAGCTCATGAAAGCGTTATCCAAACTGA;
[0074] Primer 2: GCGGCCGCTCAAATGCTAGCCACCCG;
[0075] Primer 3: CATATGATGGAAATCAAAGCAGCAAT;
[0076] Primer 4: CTCGAGTCAAAATGGGTAATTAGCTG.
[0077] Primer 5: GCGGCCGCTTAATCCCAGCTCAGAATAA;
[0078] Primer 6: GAGCTCATGGACACGCTTCGTTATTA;
[0079] Primer 7: GCGGCCGCTCAACCAATCCGGAGTACCG;
[0080] Primer 8: CATATGATGCGGGAAACAAAAGAGCA;
[0081] Primer 9: GAGCTCATGGAAATCAAAGCAGCAAT.
[0082] Example 1: Construction of Recombinant Escherichia coli
[0083] (1) Preparation of competent cells
[0084] E. coli BL21(DE3) strain, preserved in glycerol tubes, was obtained from a -80℃ freezer. Strawberries were streaked onto antibiotic-free LB agar plates and incubated at 37℃ for 10 h to obtain single colonies. A single colony from the LB agar plate was picked and inoculated into a test tube containing 5 ml of LB medium, and incubated at 37℃ and 180 rpm for 9 h. 200 μl of the bacterial culture from the test tube was then inoculated into 50 μl of LB medium and incubated at 37℃ and 180 rpm for OD... 600 Adjust the concentration to 0.4-0.6; pre-cool the bacterial culture on ice, transfer the culture to a sterile centrifuge tube, place on ice for 10 min, centrifuge at 4℃ and 5000 rpm for 10 min; discard the supernatant, taking care to prevent contamination, resuspend the precipitated cells in pre-cooled 0.1 mol / L CaCl2 aqueous solution, and place on ice for 30 min; centrifuge at 4℃ and 5000 rpm for 10 min, discard the supernatant, resuspend the precipitated cells in pre-cooled 0.1 mol / L CaCl2 aqueous solution containing 15% glycerol, aliquot 100 μl of the resuspended cells into sterile 1.5 ml centrifuge tubes, and store at -80℃ for later use.
[0085] (2) Using the genomes of the selected Escherichia coli and Pseudomonas aeruginosa strains as templates, the threonine dehydrogenase gene tdh, xylene monooxygenase gene xmo, benzyl alcohol dehydrogenase gene badh, and benzaldehyde dehydrogenase gene bzdh were obtained by PCR. The threonine dehydrogenase gene tdh, xylene monooxygenase gene xmo, benzyl alcohol dehydrogenase gene badh, and benzaldehyde dehydrogenase gene bzdh were ligated together by one-step cloning technology to form a complete gene sequence and constructed into the pET28a plasmid (located between the SacI and NotI restriction sites) to obtain the plasmid pET28a-tdhxmobadhbzdh.
[0086] (3) Plasmid construction
[0087] Plasmid construction 1: The complete sequences of the threonine dehydrogenase gene tdh and the xylene monooxygenase gene xmo were cloned between the SacI and NotI restriction sites in the first multiple cloning site of pRSFDuet-1, and the benzyl alcohol dehydrogenase gene badh and the benzaldehyde dehydrogenase gene bzdh were cloned between the NdeI and XhoI restriction sites in the second multiple cloning site of pRSFDuet-1. Initiated by primers (1 and 2), the pET28a-tdhxmobadhbzdh plasmid was used as a template and amplified using high-fidelity Pfu DNA polymerase to obtain continuous gene sequences of threonine dehydrogenase (tdh) and xylene monooxygenase (xmo). After sequencing, the amplified fragments were treated with SacI and NotI restriction endonucleases (TaKaRa). Initiated by primers (3 and 4), the pET28a-tdhxmobadhbzdh plasmid was used as a template and amplified using high-fidelity Pfu DNA polymerase to obtain continuous gene sequences of benzyl alcohol dehydrogenase (badh) and benzaldehyde dehydrogenase (bzdh). After sequencing, the amplified fragments were treated with NdeI and XhoI restriction endonucleases (TaKaRa), and the two fragments, treated with the same restriction endonuclease, were ligated using T4 DNA ligase (TaKaRa) to construct the expression vector pRSFDuet-1-tdhxmobadhbzdh. Figure 1 As shown.
[0088] Plasmid Construction 2: The threonine dehydrogenase gene tdh was cloned into the pET28a restriction site between the SacI and NotI restriction sites. The xylene monooxygenase gene xmo was cloned into the pETDuet-1 first multiple cloning site between the SacI and NotI restriction sites. The benzyl alcohol dehydrogenase gene badh and the benzaldehyde dehydrogenase gene bzdh were cloned into the pETDuet-1 second multiple cloning site between the NdeI and XhoI restriction sites. Using the pET28a-tdhxmobadhbzdh plasmid as a template, the threonine dehydrogenase tdh gene sequence was amplified using high-fidelity Pfu DNA polymerase under the initiation of primers (1 and 5). After sequencing, the amplified fragment was treated with SacI and NotI restriction endonucleases (TaKaRa). Following sequencing, the fragment was ligated to the pET28a vector treated with the same restriction endonucleases using T4 DNA ligase (TaKaRa) to construct the expression vector pET28a-tdh. Initiated by primers (6 and 2), the pET28a-tdhxmobadhbzdh plasmid was amplified using high-fidelity Pfu DNA polymerase to obtain the xylene monooxygenase (xmo) gene sequence. After sequencing, the amplified fragments were treated with SacI and NotI restriction endonucleases (TaKaRa). Initiated by primers (3 and 4), the pET28a-tdhxmobadhbzdh plasmid was amplified using high-fidelity Pfu DNA polymerase to obtain the continuous gene sequences of benzyl alcohol dehydrogenase (badh) and benzaldehyde dehydrogenase (bzdh). After sequencing, the amplified fragments were treated with NdeI and XhoI restriction endonucleases (TaKaRa), and the two fragments, treated with the same restriction endonuclease, were ligated using T4 DNA ligase (TaKaRa) to construct the expression vector pETDuet-1-xmobadhbzdh. The expression vector pET28a-tdh is as follows. Figure 2 As shown, the expression vector pETDuet-1-xmobadhbzdh is as follows: Figure 3 As shown.
[0089] Plasmid Construction 3: The threonine dehydrogenase gene tdh was cloned into the pET28a restriction site between the SacI and NotI restriction sites. The xylene monooxygenase gene xmo and the benzyl alcohol dehydrogenase gene badh were cloned into the pCDFDuet-1 multiple cloning site between the SacI and NotI restriction sites. The benzaldehyde dehydrogenase gene bzdh was cloned into the pCDFDuet-1 multiple cloning site between the NdeI and XhoI restriction sites. Using the pET28a-tdhxmobadhbzdh plasmid as a template, the plasmid was amplified using high-fidelity Pfu DNA polymerase to obtain the threonine dehydrogenase tdh. After sequencing, the amplified fragment was treated with SacI and NotI restriction endonucleases (TaKaRa). Following sequencing, the fragment was ligated to the pET28a vector treated with the same restriction endonucleases using T4 DNA ligase (TaKaRa) to construct the expression vector pET28a-tdh. Initiated by primers (6 and 7), the pET28a-tdhxmobadhbzdh plasmid was used as a template for amplification using high-fidelity Pfu DNA polymerase to obtain the continuous gene sequences of xylene monooxygenase (xmo) and benzyl alcohol dehydrogenase (badh). After sequencing, the amplified fragments were processed with SacI and NotI restriction endonucleases (TaKaRa). Initiated by primers (8 and 4), the pET28a-tdhxmobadhbzdh plasmid was used as a template for amplification using high-fidelity Pfu DNA polymerase to obtain the gene sequence of benzaldehyde dehydrogenase (bzdh). After sequencing, the amplified fragments were processed with NdeI and XhoI restriction endonucleases (TaKaRa), and then ligated with the vector pCDFDuet-1, which had been treated with the same restriction endonucleases, using T4 DNA ligase (TaKaRa) to construct the expression vector pCDFDuet-1-xmobadhbzdh. The expression vector pET28a-tdh is as follows. Figure 2 As shown, the expression vector pCDFDuet-1-xmobadhbzdh is as follows: Figure 4 As shown.
[0090] Plasmid construction 4: The threonine dehydrogenase gene tdh was cloned into the pET28a restriction site between the SacI and NotI restriction sites; the xylene monooxygenase gene xmo was cloned into the pETDuet-1 first multiple cloning site between the SacI and NotI restriction sites; the benzyl alcohol dehydrogenase gene badh was cloned into the pCDFDuet-1 first multiple cloning site between the SacI and NotI restriction sites; and the benzaldehyde dehydrogenase gene bzdh was cloned into the pCDFDuet-1 second multiple cloning site between the NdeI and XhoI restriction sites. Initiated by primers (1 and 5), the pET28a-tdhxmobadhbzdh plasmid was amplified using high-fidelity Pfu DNA polymerase to obtain the threonine dehydrogenase tdh gene. After sequencing, the amplified fragment was treated with SacI and NotI restriction endonucleases (TaKaRa), and then ligated with the T4 DNA ligase (TaKaRa) to the vector pET28a treated with the same restriction endonucleases to construct the expression vector pET28a-tdh. Initiated by primers (6 and 2), the xylene monooxygenase xmo gene sequence was obtained by amplifying the pET28a-tdhxmobadhbzdh plasmid using high-fidelity Pfu DNA polymerase as a template, using primers (6 and 2). The amplified fragment was then treated with SacI and NotI restriction endonucleases (TaKaRa), and then ligated with the vector pETDuet-1 treated with the same restriction endonucleases using T4 DNA ligase (TaKaRa) to construct the expression vector pETDuet-1-xmo. Initiated by primers (9 and 7), the pET28a-tdhxmobadhbzdh plasmid was amplified using high-fidelity Pfu DNA polymerase to obtain the benzyl alcohol dehydrogenase (badh) gene sequence. The amplified fragment was then treated with SacI and NotI restriction endonucleases (TaKaRa). Initiated by primers (8 and 4), the pET28a-tdhxmobadhbzdh plasmid was amplified using high-fidelity Pfu DNA polymerase to obtain the benzaldehyde dehydrogenase (bzdh) gene sequence. The amplified fragment was then treated with NdeI and XhoI restriction endonucleases (TaKaRa). Finally, the two fragments, treated with the same restriction endonuclease, were ligated using T4 DNA ligase (TaKaRa) to construct the expression vector pCDFDuet-1-badhbzdh. The expression vector pET28a-tdh is as follows: Figure 2 As shown, the expression vector pETDuet-1-xmo is as follows Figure 5 As shown, the expression vector pCDFDuet-1-badhbzdh is as follows: Figure 6 As shown.
[0091] Plasmid construction 5: The threonine dehydrogenase gene tdh was cloned into the pET28a restriction site between the SacI and NotI restriction sites; the xylene monooxygenase gene xmo was cloned into the pCDFDuet-1 first multiple cloning site between the SacI and NotI restriction sites; the benzyl alcohol dehydrogenase gene badh was cloned into the pETDuet-1 first multiple cloning site between the SacI and NotI restriction sites; and the benzaldehyde dehydrogenase gene bzdh was cloned into the pETDuet-1 second multiple cloning site between the NdeI and XhoI restriction sites. Initiated by primers (1 and 5), the pET28a-tdhxmobadhbzdh plasmid was used as a template and amplified using high-fidelity Pfu DNA polymerase to obtain threonine dehydrogenase tdh. After sequencing, the amplified fragment was treated with SacI and NotI restriction endonucleases (TaKaRa), and then ligated with T4 DNA ligase (TaKaRa) to the vector pET28a treated with the same restriction endonucleases to construct the expression vector pET28a-tdh. Initiated by primers (6 and 2), the xylene monooxygenase xmo gene sequence was amplified using high-fidelity Pfu DNA polymerase as a template with pET28a-tdhxmobadhbzdh plasmid as a template. The amplified fragment was then treated with SacI and NotI restriction endonucleases (TaKaRa), and then ligated with the vector pCDFDuet-1 treated with the same restriction endonucleases using T4 DNA ligase (TaKaRa) to construct the expression vector pCDFDuet-1-xmo. Initiated by primers (9 and 7), the pET28a-tdhxmobadhbzdh plasmid was amplified using high-fidelity Pfu DNA polymerase to obtain the benzyl alcohol dehydrogenase (badh) gene sequence. The amplified fragment was then treated with SacI and NotI restriction endonucleases (TaKaRa). Initiated by primers (8 and 4), the pET28a-tdhxmobadhbzdh plasmid was amplified using high-fidelity Pfu DNA polymerase to obtain the benzaldehyde dehydrogenase (bzdh) gene sequence. The amplified fragment was then treated with NdeI and XhoI restriction endonucleases (TaKaRa). Finally, the two fragments, treated with the same restriction endonuclease, were ligated using T4 DNA ligase (TaKaRa) to construct the expression vector pETDuet-1-badhbzdh. The expression vector pET28a-tdh is as follows: Figure 2 As shown, the expression vector pCDFDuet-1-xmo is as follows Figure 7 As shown, the expression vector pETDuet-1-badhbzdh is as follows: Figure 8 As shown.
[0092] Plasmid construction 6: The threonine dehydrogenase gene tdh and the xylene monooxygenase gene xmo were cloned between the SacI and NotI restriction sites of the first multiple cloning site of pETDuet-1, and the benzyl alcohol dehydrogenase gene badh and the benzaldehyde dehydrogenase gene bzdh were cloned between the NdeI and XhoI restriction sites of the second multiple cloning site of pETDuet-1. Initiated by primers (1 and 2), using pET28a-tdhxmobadhbzdh plasmid as a template, high-fidelity Pfu DNA polymerase was used to amplify the continuous gene sequences of threonine dehydrogenase (tdh) and xylene monooxygenase (xmo). After sequencing, the amplified fragments were processed with SacI and NotI restriction endonucleases (TaKaRa). Initiated by primers (3 and 4), using pET28a-tdhxmobadhbzdh plasmid as a template, high-fidelity Pfu DNA polymerase was used to amplify the continuous gene sequences of benzyl alcohol dehydrogenase (badh) and benzaldehyde dehydrogenase (bzdh). After sequencing, the amplified fragments were processed with NdeI and XhoI restriction endonucleases (TaKaRa), and then processed with T4 polymerase. The DNA ligase (TaKaRa) ligates two fragments treated with the same restriction endonuclease into the vector pETDuet-1, constructing the expression vector pETDuet-1-tdhxmobadhbzdh. The expression vector pETDuet-1-tdhxmobadhbzdh is as follows: Figure 9 As shown.
[0093] Plasmid Construction 7: The threonine dehydrogenase gene tdh was cloned into the pET28a restriction site between the SacI and NotI restriction sites. The xylene monooxygenase gene xmo and the benzyl alcohol dehydrogenase gene badh were cloned into the pETDuet-1 first multiple cloning site between the SacI and NotI restriction sites. The benzaldehyde dehydrogenase gene bzdh was cloned into the pETDuet-1 second multiple cloning site between the NdeI and XhoI restriction sites. Using the pET28a-tdhxmobadhbzdh plasmid as a template, the plasmid was amplified using high-fidelity Pfu DNA polymerase to obtain the threonine dehydrogenase tdh. After sequencing, the amplified fragment was treated with SacI and NotI restriction endonucleases (TaKaRa). Following sequencing, the fragment was ligated to the pET28a vector treated with the same restriction endonucleases using T4 DNA ligase (TaKaRa) to construct the expression vector pET28a-tdh. Initiated by primers (6 and 7), the pET28a-tdhxmobadhbzdh plasmid was used as a template and amplified using high-fidelity Pfu DNA polymerase to obtain continuous gene sequences of xylene monooxygenase (xmo) and benzyl alcohol dehydrogenase (badh). After sequencing, the amplified fragments were treated with SacI and NotI restriction endonucleases (TaKaRa). Initiated by primers (8 and 4), the pET28a-tdhxmobadhbzdh plasmid was used as a template and amplified using high-fidelity Pfu DNA polymerase to obtain gene sequences of benzaldehyde dehydrogenase (bzdh). After sequencing, the amplified fragments were treated with NdeI and XhoI restriction endonucleases (TaKaRa), and the two fragments, treated with the same restriction endonuclease, were ligated using T4 DNA ligase (TaKaRa) to construct the expression vector pETDuet-1-xmobadhbzdh-1. The expression vector pET28a-tdh is as follows. Figure 2 As shown, the expression vector pETDuet-1-xmobadhbzdh-1 is as follows: Figure 10 As shown.
[0094] (4) Construction of recombinant E. coli co-expressing tdh, xmo, badh and bzdh
[0095] First, E. coli BL21(DE3)(Invitrogen) competent cells stored at -80℃ were placed in an ice bath at 0℃ for 10 min. Then, 5 μl of enzyme-linked product system was added to each cell in a clean bench, and the cells were placed in an ice bath at 0℃ for 30 min, then heat-shocked in a water bath at 42℃ for 90 s, and then placed in an ice bath at 0℃ for 2 min. 600 μl of LB medium was added, and the cells were cultured in a shaker at 37℃ and 200 rpm for 1 h. The cells were then plated on LB plates containing 50 μg / ml of the corresponding resistance (pET28a for kanamycin resistance, pRSFduet-1 for kanamycin resistance, pCDFduet-1 for streptomycin resistance, and pETduet-1 for ampicillin resistance) and cultured at 37℃ for 8-12 h. Ten clones were randomly selected from each plate, and plasmids were extracted for sequencing and identification. Each plate was screened to obtain one recombinant E. coli strain containing each recombinant expression plasmid in step (3). The recombinant Escherichia coli strains obtained from plasmid construction 1-7 in step (3) are numbered sequentially as strains 1-7.
[0096] (5) Screening of the strain bank
[0097] Seed bottles: The above 7 recombinant Escherichia coli strains were inoculated into seed bottles (culture medium components: 1.2% peptone, 2.4% yeast extract, 17mM K2HPO4, 72mM KH2PO4, 0.5% glycerol) and cultured at 37℃ for 12h.
[0098] Screening system: The above seed bottles were inoculated at 1% into fermentation flasks (culture medium components: 1.2% peptone, 2.4% yeast extract, 17mM K₂HPO₄, 72mM KH₂PO₄, 0.5% glycerol, 0.6% L-threonine), and cultured at 37℃ with pH controlled at 7.0 until OD₂O₃ was obtained. 600 When the concentration reached 12, IPTG was added as an inducer, with a final IPTG concentration of 24 μg / ml. The temperature was lowered to 28℃ and cultured for 10 h to induce the reaction. After the reaction was completed, the content of the product 5-methylpyrazine-2-carboxylic acid was detected by HPLC. The detection results are as follows: Figure 11 As shown. From Figure 11 The results showed that strain BL21(DE3)-AXMS7 had the highest molar conversion rate.
[0099] Example 2: Establishment of fermentation and catalytic conditions for recombinant Escherichia coli BL21(DE3)-AXMS7
[0100] Fermentation medium components: 1.2% peptone, 2.4% yeast extract, 17mM K2HPO4, 72mM KH2PO4, 0.5% glycerol, and 0.001% SAG630 defoamer.
[0101] The fed culture medium consists of: 1.5% peptone, 1% yeast extract, and 3% glycerol.
[0102] Substrate L-threonine solution: concentration 500 g / L.
[0103] Recombinant Escherichia coli BL21(DE3)-AXMS7 was inoculated into a 30 ml primary seed bottle containing 50 μg / ml kanamycin and ampicillin resistance medium and cultured at 37°C and 220 rpm for 8 h. Then, it was inoculated at a 1% (v / v) inoculation rate into a 150 ml secondary seed bottle containing 50 μg / ml kanamycin and ampicillin resistance medium and cultured at 37°C and 220 rpm for 10 h. Finally, it was inoculated at a 3% (v / v) inoculation rate into a fermenter containing 15 L of culture medium.
[0104] (1) Screening of inducer concentration
[0105] During the fermentation process, the culture was carried out at 37°C and pH 7.0 until OD... 600 When the concentration reached 12, the temperature was lowered to 28℃, and IPTG was added as an inducer. The final IPTG concentrations were 20, 22, 24, 26, and 28 μg / ml. When dissolved oxygen (DO) rapidly increased, feed culture medium was added to maintain DO between 30% and 40%. After induction culture at 28℃ for 3 hours, L-threonine substrate was fed to a final concentration of 10 g / L at a feed rate of 100 ml / h. After the feeding was completed, fermentation culture was continued at 28℃ for 8 hours. The reaction was then terminated, and the content of the product 5-methylpyrazine-2-carboxylic acid was determined by HPLC. The results are as follows: Figure 12 As shown. From Figure 12 It can be seen that the product conversion rates are similar when the inducer concentrations are 20, 22, 24, 26, and 28 μg / ml, with a slightly higher conversion rate when the inducer concentration is 24 μg / ml.
[0106] (2) Screening of induction temperature
[0107] During the fermentation process, the culture was carried out at 37°C and pH 7.0 until OD... 600 When the concentration reached 12, the temperature was lowered to 22, 25, 28, and 30℃ respectively, and IPTG, the inducer, was added to a final concentration of 24 μg / ml. When dissolved oxygen rapidly increased, supplemental culture medium was added to maintain dissolved oxygen (DO) between 30% and 40%. After culturing for 3 hours, L-threonine was added to a final concentration of 10 g / L at a flow rate of 100 ml / h. Incubation was continued at 22, 25, 28, and 30℃ for 8 hours respectively. The content of the product 5-methylpyrazine-2-carboxylic acid was determined by HPLC. The results are as follows: Figure 13 As shown. From Figure 13 It can be seen that the product conversion rate is higher when the induction temperature is 28℃.
[0108] (3) Screening of induction time
[0109] During the fermentation process, the fermenter was incubated at 37°C and pH 7.2 until OD... 600 When the concentration reached 12, the temperature was lowered to 28℃, and IPTG, the inducer, was added to a final concentration of 24 μg / ml. When dissolved oxygen rapidly increased, feed culture medium was added to maintain dissolved oxygen (DO) between 30% and 40%. After 3, 4, 5, and 6 hours of induction, L-threonine was added to a final concentration of 10 g / L at a feed rate of 100 ml / h. Fermentation was continued at 28℃ for 8 hours, after which the reaction was completed. HPLC analysis was performed to determine the content of the product 5-methylpyrazine-2-carboxylic acid. The results are as follows: Figure 14 As shown. From Figure 14 It can be seen that the induction time has a relatively small impact on the conversion rate.
[0110] (4) Screening of substrate concentration
[0111] During the fermentation process, the fermenter was incubated at 37°C and pH 7.2 until OD... 600 When the concentration reached 12, the temperature was lowered to 28℃, and IPTG, the inducer, was added to a final concentration of 24 μg / ml. When dissolved oxygen rapidly increased, feed culture medium was added to maintain dissolved oxygen (DO) between 30% and 40%. Substrate was fed in at a rate of 100 ml / h after 3 hours of induction, with final concentrations of L-threonine added at 4, 6, 8, 10, and 12 g / L, respectively. Fermentation was continued at 28℃ for 8 hours, after which the reaction was terminated. The content of the product 5-methylpyrazine-2-carboxylic acid was determined by HPLC. The results are as follows: Figure 15 As shown. From Figure 15 It can be seen that the conversion rate decreases with increasing substrate concentration. To obtain a high concentration of the product 5-methylpyrazine-2-carboxylic acid, the preferred concentration of the substrate L-threonine is 10 g / L.
[0112] (5) Screening of reaction time
[0113] During the fermentation process, the fermenter was incubated at 37°C and pH 7.2 until OD... 600 When the concentration reached 12, the temperature was lowered to 28℃, and IPTG, the inducer, was added to a final concentration of 24 μg / ml. As dissolved oxygen rapidly increased, fed culture medium was added to maintain dissolved oxygen (DO) between 30% and 40%. After 3 hours of induction, L-threonine was fed to a final concentration of 10 g / L at a flow rate of 100 ml / h. Fermentation was continued at 28℃ for 12 hours. Samples were taken hourly, and the content of the product 5-methylpyrazine-2-carboxylic acid was determined by HPLC. The results are as follows: Figure 16 As shown. From Figure 16 It can be seen that as the reaction time increases, the product concentration gradually increases, but after 8 hours, the increase in product concentration is extremely slow. Therefore, the preferred reaction time is 8 hours.
[0114] Example 3 Synthesis of 5-methylpyrazine-2-carboxylic acid
[0115] Fermentation medium components: 1.2% peptone, 2.4% yeast extract, 17mM K2HPO4, 72mM KH2PO4, 0.5% glycerol, and 0.001% SAG630 defoamer.
[0116] The fed culture medium consists of: 1.5% peptone, 1% yeast extract, and 3% glycerol.
[0117] Substrate L-threonine solution: concentration 500 g / L.
[0118] Recombinant *E. coli* BL21(DE3)-AXMS7 was inoculated into a 30 ml primary seed bottle containing 50 μg / ml kanamycin and ampicillin resistance medium and cultured at 37°C and 220 rpm for 8 h. Then, it was inoculated at a 1% (v / v) inoculum into a 150 ml secondary seed bottle containing 50 μg / ml kanamycin and ampicillin resistance medium and cultured at 37°C and 220 rpm for 10 h. Finally, it was inoculated at a 3% (v / v) inoculum into a fermenter containing 15 L of medium. OD was then calculated. 600 When the concentration reached 12, the temperature was lowered to 28℃ and IPTG, the inducer, was added to a final concentration of 24 μg / ml. When dissolved oxygen rose rapidly, feed culture medium was added to maintain DO between 30% and 40%. After 3 hours of induction, L-threonine substrate was fed to a final concentration of 10 g / L at a feed rate of 100 ml / h. Fermentation was continued at 28℃ for 8 hours until the reaction ended. HPLC analysis showed that the content of the product 5-methylpyrazine-2-carboxylic acid reached 9.97 g / L, with a conversion rate of 85.99%.
[0119] Example 4 Synthesis of 5-methylpyrazine-2-carboxylic acid
[0120] Fermentation medium composition adjustment: peptone 1.0%, yeast extract 2.5%, K2HPO4 17mM, KH2PO4 72mM, glycerol 0.8%, and defoamer SAG630 0.001%.
[0121] The fed culture medium consists of: 1.5% peptone, 1% yeast extract, and 3% glycerol.
[0122] Substrate L-threonine solution: concentration 500 g / L.
[0123] Recombinant *E. coli* BL21(DE3)-AXMS7 was inoculated into a 30 ml primary seed bottle containing 50 μg / ml kanamycin and ampicillin resistance medium and cultured at 37°C and 220 rpm for 8 h. Then, it was inoculated at a 1% (v / v) inoculum into a 150 ml secondary seed bottle containing 50 μg / ml kanamycin and ampicillin resistance medium and cultured at 37°C and 220 rpm for 10 h. Finally, it was inoculated at a 3% (v / v) inoculum into a fermenter containing 15 L of medium. OD was then calculated. 600 When the concentration reached 12, the temperature was lowered to 28℃ and IPTG, the inducer, was added to a final concentration of 24 μg / ml. When dissolved oxygen rose rapidly, feed culture medium was added to maintain DO between 30% and 40%. After 3 hours of induction, L-threonine substrate was added to a final concentration of 10 g / L at a feed rate of 150 ml / h. Fermentation was continued at 28℃ for 8 hours until the reaction ended. HPLC analysis showed that the content of the product 5-methylpyrazine-2-carboxylic acid reached 9.86 g / L, with a conversion rate of 85.04%. sequence list <110> Shandong New Era Pharmaceutical Co., Ltd. <120> Construction and Application of an Efficient Engineered Bacterium for Synthesizing 5-Methylpyrazine-2-carboxylic Acid <130> 2021 <160> 8 <170> SIPOSequenceListing 1.0 <210> 1 <211> 341 <212> PRT <213> Unknown <400> 1 Met Lys Ala Leu Ser Lys Leu Lys Ala Glu Glu Gly Ile Trp Met Thr 1 5 10 15 Asp Val Pro Val Pro Glu Leu Gly His Asn Asp Leu Leu Ile Lys Ile 20 25 30 Arg Lys Thr Ala Ile Cys Gly Thr Asp Val His Ile Tyr Asn Trp Asp 35 40 45 Glu Trp Ser Gln Lys Thr Ile Pro Val Pro Met Val Val Gly His Glu 50 55 60 Tyr Val Gly Glu Val Val Gly Ile Gly Gln Glu Val Lys Gly Phe Lys 65 70 75 80 Ile Gly Asp Arg Val Ser Gly Glu Gly His Ile Thr Cys Gly His Cys 85 90 95 Arg Asn Cys Arg Gly Gly Arg Thr His Leu Cys Arg Asn Thr Ile Gly 100 105 110 Val Gly Val Asn Arg Pro Gly Cys Phe Ala Glu Tyr Leu Val Ile Pro 115 120 125 Ala Phe Asn Ala Phe Lys Ile Pro Asp Asn Ile Ser Asp Asp Leu Ala 130 135 140 Ala Ile Phe Asp Pro Phe Gly Asn Ala Val His Thr Ala Leu Ser Phe 145 150 155 160 Asp Leu Val Gly Glu Asp Val Leu Val Ser Gly Ala Gly Pro Ile Gly 165 170 175 Ile Met Ala Ala Ala Val Ala Lys His Val Gly Ala Arg Asn Val Val 180 185 190 Ile Thr Asp Val Asn Glu Tyr Arg Leu Glu Leu Ala Arg Lys Met Gly 195 200 205 Ile Thr Arg Ala Val Asn Val Ala Lys Glu Asn Leu Asn Asp Val Met 210 215 220 Ala Glu Leu Gly Met Thr Glu Gly Phe Asp Val Gly Leu Glu Met Ser 225 230 235 240 Gly Ala Pro Pro Ala Phe Arg Thr Met Leu Asp Thr Met Asn His Gly 245 250 255 Gly Arg Ile Ala Met Leu Gly Ile Pro Pro Ser Asp Met Ser Ile Asp 260 265 270 Trp Thr Lys Val Ile Phe Lys Gly Leu Phe Ile Lys Gly Ile Tyr Gly 275 280 285 Arg Glu Met Phe Glu Thr Trp Tyr Lys Met Ala Ala Leu Ile Gln Ser 290 295 300 Gly Leu Asp Leu Ser Pro Ile Ile Thr His Arg Phe Ser Ile Asp Asp 305 310 315 320 Phe Gln Lys Gly Phe Asp Ala Met Arg Ser Gly Gln Ser Gly Lys Val 325 330 335 Ile Leu Ser Trp Asp 340 <210> 2 <211> 1026 <212> DNA <213> Unknown <400> 2 atgaaagcgt tatccaaact gaaagcggaa gagggcatct ggatgaccga cgttcctgta 60 ccggaactcg ggcataacga tctgctgatt aaaatccgta aaacagccat ctgcgggact 120 gacgttcaca tctataactg ggatgagtgg tcgcaaaaaa ccatcccggt gccgatggtc 180 gtgggccatg aatatgtcgg tgaagtggta ggtattggtc aggaagtgaa aggcttcaag 240 atcggcgatc gcgtttctgg cgaaggccat atcacctgtg gtcattgccg caactgtcgt 300 ggtggtcgta cccatttgtg ccgcaacacg ataggcgttg gtgttaatcg cccgggctgc 360 tttgccgaat atctggtgat cccggcattc aacgccttca aaatccccga caatatttcc 420 gatgacttag ccgcaatttt tgatcccttc ggtaacgccg tgcataccgc gctgtcgttt 480 gatctggtgg gcgaagatgt gctggtttct ggtgcaggcc cgattggtat tatggcagcg 540 gcggtggcga aacacgttgg tgcacgcaat gtggtgatca ctgatgttaa cgaataccgc 600 cttgagctgg cgcgtaaaat gggtatcacc cgtgcggtta acgtcgccaa agaaaatctc 660 aatgacgtga tggcggagtt aggcatgacc gaaggttttg atgtcggtct ggaaatgtcc 720 ggtgcgccgc cagcgtttcg taccatgctt gacaccatga atcacggcgg ccgtattgcg 780 atgctgggta ttccgccgtc tgatatgtct atcgactgga ccaaagtgat ctttaaaggc 840 ttgttcatta aaggtattta cggtcgtgag atgtttgaaa cctggtacaa gatggcggcg 900 ctgattcagt ctggcctcga tctttcgccg atcattaccc atcgtttctc tatcgatgat 960 ttccagaagg gctttgacgc tatgcgttcg ggccagtccg ggaaagttat tctgagctgg 1020 gattaa 1026 <210> 3 <211> 369 <212> PRT <213> Unknown <400> 3 Met Asp Thr Leu Arg Tyr Tyr Leu Ile Pro Val Val Thr Ala Cys Gly 1 5 10 15 Leu Ile Gly Phe Tyr Tyr Gly Gly Tyr Trp Val Trp Leu Gly Ala Ala 20 25 30 Thr Phe Pro Ala Leu Met Val Leu Asp Val Ile Leu Pro Lys Asp Phe 35 40 45 Ser Ala Arg Lys Val Ser Pro Phe Phe Ala Asp Leu Thr Gln Tyr Leu 50 55 60 Gln Leu Pro Leu Met Ile Gly Leu Tyr Gly Leu Leu Val Phe Gly Val 65 70 75 80 Glu Asn Gly Arg Ile Glu Leu Ser Glu Pro Leu Gln Val Ala Gly Cys 85 90 95 Ile Leu Ser Leu Ala Trp Leu Ser Gly Val Pro Thr Leu Pro Val Ser 100 105 110 His Glu Leu Met His Arg Arg His Trp Leu Pro Arg Lys Met Ala Gln 115 120 125 Leu Leu Ala Met Phe Tyr Gly Asp Pro Asn Arg Asp Ile Ala His Val 130 135 140 Asn Thr His His Leu Tyr Leu Asp Thr Pro Leu Asp Ser Asp Thr Pro 145 150 155 160 Tyr Arg Gly Gln Thr Ile Tyr Ser Phe Val Ile Ser Ala Thr Val Gly 165 170 175 Ser Val Lys Asp Ala Ile Lys Ile Glu Ala Glu Thr Leu Arg Arg Lys 180 185 190 Gly Gln Ser Pro Trp Asn Leu Ser Asn Lys Thr Tyr Gln Tyr Val Ala 195 200 205 Leu Leu Leu Ala Leu Pro Gly Leu Val Ser Tyr Leu Gly Gly Pro Ala 210 215 220 Leu Gly Leu Val Thr Ile Ala Ser Met Ile Ile Ala Lys Gly Ile Val 225 230 235 240 Glu Gly Phe Asn Tyr Phe Gln His Tyr Gly Leu Val Arg Asp Leu Asp 245 250 255 Gln Pro Ile Leu Leu His His Ala Trp Asn His Met Gly Thr Ile Val 260 265 270 Arg Pro Leu Gly Cys Glu Ile Thr Asn His Ile Asn His His Ile Asp 275 280 285 Gly Tyr Thr Arg Phe Tyr Glu Leu Arg Pro Glu Lys Glu Ala Pro Gln 290 295 300 Met Pro Ser Leu Phe Val Cys Phe Leu Leu Gly Leu Ile Pro Pro Leu 305 310 315 320 Trp Phe Ala Leu Ile Ala Lys Pro Lys Leu Arg Asp Trp Asp Gln Arg 325 330 335 Tyr Ala Thr Pro Gly Glu Arg Glu Leu Ala Met Ala Ala Asn Lys Lys 340 345 350 Ala Gly Trp Pro Leu Trp Cys Glu Ser Glu Leu Gly Arg Val Ala Ser 355 360 365 Ile <210> 4 <211> 1110 <212> DNA <213> Unknown <400> 4 atggacacgc ttcgttatta cctgattcct gttgttactg cttgcgggct gatcggattt 60 tactatggtg gctattgggt ttggcttggg gcggcaacat tccctgcact gatggtgctt 120 gatgtcattt taccgaagga tttttcggcc agaaaggtaa gtcccttttt cgcagacctt 180 acccagtatt tgcagttacc attaatgatc ggtctatatg ggctccttgt cttcggagtt 240 gaaaacgggc gtatcgaact tagtgagccg ttacaagtgg cagggtgcat tctttctttg 300 gcttggctta gtggtgtgcc aactcttccg gtttcgcatg agttgatgca tcgtcgccac 360 tggttgcctc ggaaaatggc gcagctattg gctatgtttt atggtgatcc gaaccgagac 420 attgcccatg tcaacacgca tcacctttac ttagatacgc ctctcgatag cgatactccg 480 taccgtggtc agacaattta cagtttcgtg atcagtgcga cagttggttc cgtcaaagat 540 gcgataaaga ttgaggctga aactttacgt agaaaaggac agtcaccgtg gaatttgtcc 600 aacaaaacat atcaatatgt cgcacttctg ctcgctctgc ctggcctggt ttcttatctg 660 ggcgggccag cattagggtt ggttacgatt gcttcgatga ttattgcgaa agggatagtc 720 gagggtttta attactttca gcactatggt ttagtacgcg atttagatca gcctatcctc 780 ctgcaccacg cgtggaatca tatgggaaca attgtgcgcc cgctgggttg cgaaattact 840 aaccatatca atcatcatat tgacggctat acacggttct atgagttgcg tccggaaaaa 900 gaagccccgc agatgccttc gctctttgtg tgtttccttc tagggcttat tccgcctctt 960 tggttcgctc tcattgcaaa accaaagttg agagactggg accagcggta cgcaactcca 1020 ggtgagcgcg aactggctat ggctgcaaat aaaaaagcgg gatggccact gtggtgtgaa 1080 agtgaactgg gtcgggtggc tagcatttga 1110 <210> 5 <211> 366 <212> PRT <213> Unknown <400> 5 Met Glu Ile Lys Ala Ala Ile Val Arg Gln Lys Asn Gly Pro Phe Leu 1 5 10 15 Leu Glu His Val Ala Leu Asn Glu Pro Ala Glu Asp Gln Val Leu Val 20 25 30 Arg Leu Val Ala Thr Gly Leu Cys His Thr Asp Leu Val Cys Arg Asp 35 40 45 Gln His Tyr Pro Val Pro Leu Pro Met Val Phe Gly His Glu Gly Ala 50 55 60 Gly Val Val Glu Arg Val Gly Ser Ala Val Lys Lys Val Gln Pro Gly 65 70 75 80 Asp His Val Val Leu Thr Phe Tyr Thr Cys Gly Ser Cys Asp Ala Cys 85 90 95 Leu Ser Gly Asp Pro Thr Ser Cys Ala Asn Ser Phe Gly Pro Asn Phe 100 105 110 Met Gly Arg Ser Val Thr Gly Glu Cys Thr Ile His Asp His Gln Gly 115 120 125 Ala Glu Val Gly Ala Ser Phe Phe Gly Gln Ser Ser Phe Ala Thr Tyr 130 135 140 Ala Leu Ser Tyr Glu Arg Asn Thr Val Lys Val Thr Lys Asp Val Pro 145 150 155 160 Leu Glu Leu Leu Gly Pro Leu Gly Cys Gly Ile Gln Thr Gly Ala Gly 165 170 175 Ser Val Leu Asn Ala Leu Asn Pro Pro Ala Gly Ser Ala Ile Ala Ile 180 185 190 Phe Gly Ala Gly Ala Val Gly Leu Ser Ala Val Met Ala Ala Val Val 195 200 205 Ala Gly Cys Thr Thr Ile Ile Ala Val Asp Val Lys Glu Asn Arg Leu 210 215 220 Glu Leu Ala Ser Glu Leu Gly Ala Thr His Ile Ile Asn Pro Ala Ala 225 230 235 240 Asn Asp Pro Ile Glu Ala Ile Lys Glu Ile Phe Ala Asp Gly Val Pro 245 250 255 Tyr Val Leu Glu Thr Ser Gly Leu Pro Ala Val Leu Thr Gln Ala Ile 260 265 270 Leo Ser Ser Ala Ile Gly Gly Glu Ile Gly Ile Val Gly Ala Pro Pro 275 280 285 Met Gly Ala Thr Val Pro Val Asp Ile Asn Phe Leu Leu Phe Asn Arg 290 295 300 Lys Leu Arg Gly Ile Val Glu Gly Gln Ser Ile Ser Asp Ile Phe Ile 305 310 315 320 Pro Arg Leu Val Glu Leu Tyr Arg Gln Gly Lys Phe Pro Phe Asp Lys 325 330 335 Leu Ile Lys Phe Tyr Pro Phe Asp Glu Ile Asn Arg Ala Ala Glu Asp 340 345 350 Ser Glu Lys Gly Val Thr Leu Lys Pro Val Leu Arg Ile Gly 355 360 365 <210> 6 <211> 1101 <212> DNA <213> Unknown <400> 6 atggaaatca aagcagcaat agttcgccaa aaaaatggcc cgttcttact tgagcatgta 60 gctcttaatg agccagctga agatcaggtt ctcgttagat tggttgcaac cgggctgtgt 120 catacggatc tggtttgtcg cgatcagcat tatccggttc cactaccgat ggtatttggg 180 catgaagggg ctggtgtggt tgagcgggtt gggtccgcgg tcaaaaaggt tcagccgggc 240 gaccatgttg ttttgacatt ttatacctgc gggagttgtg atgcttgtct ttccggagac 300 cctaccagtt gtgcaaactc atttggccct aactttatgg ggcgctcggt aaccggggag 360 tgcaccatcc acgatcacca aggggcagag gtgggagcaa gcttttttgg gcagtcctcc 420 tttgcgacat atgcgctatc ttatgaacgt aacactgtga aggttacaaa agacgtaccg 480 cttgagttgc ttgggcctct tggttgtggc attcaaactg gcgcagggtc tgttctgaat 540 gcgcttaatc cgccagcggg ttctgctatc gcaatttttg gtgctggggc agttggtctt 600 tcggccgtga tggctgccgt tgtagcaggt tgtaccacca tcatcgctgt cgacgttaag 660 tcggccgtga tggctgccgt tgtagcaggt tgtaccacca tcatcgctgt cgacgttaag 660 gaaaaccggc tggaactagc cagtgaactt ggggcgacgc acattattaa cccggccgct 720 gaaaaccggc tggaactagc cagtgaactt ggggcgacgc acattattaa cccggccgct 720 aacgatccca ttgaggcgat caaagagata ttcgctgacg gtgttccgta tgtattggag 780 aacgatccca ttgaggcgat caaagagata ttcgctgacg gtgttccgta tgtattggag 780 actagcggtt tgcccgccgt gcttacgcag gcgatcctca gctctgctat aggcggtgag 840 actagcggtt tgcccgccgt gcttacgcag gcgatcctca gctctgctat aggcggtgag 840 atcggtattg taggggcgcc acctatgggg gccacggtgc ccgttgacat taacttcctg 900 atcggtattg taggggcgcc acctatgggg gccacggtgc ccgttgacat taacttcctg 900 ctattcaatc gtaagcttcg tggaatcgtt gagggtcagt cgatctcgga tattttcatt 960 ctattcaatc gtaagcttcg tggaatcgtt gagggtcagt cgatctcgga tattttcatt 960 cccaggctgg tggagcttta tcgccagggg aagtttccgt ttgacaagct gattaagttt 1020 cccaggctgg tggagcttta tcgccagggg aagtttccgt ttgacaagct gattaagttt 1020 tatccttttg atgaaatcaa tcgagccgcc gaagattcgg aaaaaggcgt gacgcttaag 1080 tatccttttg atgaaatcaa tcgagccgcc gaagattcgg aaaaaggcgt gacgcttaag 1080 ccggtactcc ggattggttg a 1101 ccggtactcc ggattggttg a 1101 <210> 7<210> 7 <211> 487<211> 487 <212> PRT <212> PRT <213> 未知(Unknown) <213> Unknown <400> 7 <400> 7 Met Arg Glu Thr Lys Glu Gln Pro Ile Trp Tyr Gly Lys Val Phe Ser Met Arg Glu Thr Lys Glu Gln Pro Ile Trp Tyr Gly Lys Val Phe Ser 1 5 10 15 1 5 10 15 Ser Asn Trp Val Glu Ala Arg Gly Gly Val Ala Asn Val Val Asp Pro Ser Asn Trp Val Glu Ala Arg Gly Gly Val Ala Asn Val Val Asp Pro 20 25 30 20 25 30 Ser Asn Gly Asp Ile Leu Gly Ile Thr Gly Val Ala Asn Gly Glu Asp 35 40 45 Val Asp Ala Ala Val Asn Ala Ala Lys Arg Ala Gln Lys Glu Trp Ala 50 55 60 Ala Ile Pro Phe Ser Glu Arg Ala Ala Ile Val Arg Lys Ala Ala Glu 65 70 75 80 Lys Leu Lys Glu Arg Glu Tyr Glu Phe Ala Asp Trp Asn Val Arg Glu 85 90 95 Cys Gly Ala Ile Arg Pro Lys Gly Leu Trp Glu Ala Gly Ile Ala Tyr 100 105 110 Glu Gln Met His Gln Ala Ala Gly Leu Ala Ser Leu Pro Asn Gly Thr 115 120 125 Leu Phe Pro Ser Ala Val Pro Gly Arg Met Asn Leu Cys Gln Arg Val 130 135 140 Pro Val Gly Val Gly Val Ile Ala Pro Trp Asn Phe Pro Leu Phe 145 150 155 160 Leu Ala Met Arg Ser Val Ala Pro Ala Leu Ala Leu Gly Asn Ala Val 165 170 175 Ile Leu Lys Pro Asp Leu Gln Thr Ala Val Thr Gly Gly Ala Leu Ile 180 185 190 Ala Glu Ile Phe Ser Asp Ala Gly Met Pro Asp Gly Val Leu His Val 195 200 205 Leu Pro Gly Gly Ala Asp Val Gly Glu Ser Met Val Ala Asn Ser Gly 210 215 220 Ile Asn Met Ile Ser Phe Thr Gly Ser Thr Gln Val Gly Arg Leu Ile 225 230 235 240 Gly Glu Lys Cys Gly Arg Met Leu Lys Lys Val Ala Leu Glu Leu Gly 245 250 255 Gly Asn Asn Val His Ile Val Leu Pro Asp Ala Asp Leu Glu Gly Ala 260 265 270 Val Ser Cys Ala Ala Trp Gly Thr Phe Leu His Gln Gly Gln Val Cys 275 280 285 Met Ala Ala Gly Arg His Leu Val His Arg Asp Val Ala Gln Gln Tyr 290 295 300 Ala Glu Lys Leu Ala Leu Arg Ala Lys Asn Leu Val Val Gly Asp Pro 305 310 315 320 Asn Ser Asp Gln Val His Leu Gly Pro Leu Ile Asn Glu Lys Gln Val 325 330 335 Val Arg Val His Ala Leu Val Glu Ser Ala Gln Arg Ala Gly Ala Gln 340 345 350 Val Leu Ala Gly Gly Thr Tyr Gln Asp Arg Tyr Tyr Gln Ala Thr Val 355 360 365 Ile Met Asp Val Lys Pro Glu Met Glu Val Phe Lys Ser Glu Ile Phe 370 375 380 Gly Pro Val Ala Pro Ile Thr Val Phe Asp Ser Ile Glu Glu Ala Ile 385 390 395 400 Glu Leu Ala Asn Cys Ser Glu Tyr Gly Leu Ala Ala Ser Ile His Thr 405 410 415 Arg Ala Leu Ala Thr Gly Leu Asp Ile Ala Lys Arg Leu Asn Thr Gly 420 425 430 Met Val His Ile Asn Asp Gln Pro Ile Asn Cys Glu Pro His Val Pro 435 440 445 Phe Gly Gly Met Gly Ala Ser Gly Ser Gly Gly Arg Phe Gly Gly Pro 450 455 460 Ala Ser Ile Glu Glu Phe Thr Gln Ser Gln Trp Ile Ser Met Val Glu 465 470 475 480 Lys Pro Ala Asn Tyr Pro Phe 485 <210> 8 <211> 1464 <212> DNA <213> Unknown <400> 8 atgcgggaaa caaaagagca gcctatctgg tacgggaagg tgtttagttc taattgggta 60 gaggcgcggg gaggtgttgc caatgttgtc gatccgtcca atggagacat tcttggcatt 120 acgggtgttg ctaacggcga agatgtcgat gctgctgtga acgcagctaa gagagcgcaa 180 aaaggaatggg ccgcaatacc atttagtgaa agagccgcca ttgtccgcaa ggctgccgaa 240 aaaaaagg agcgcgaata tgaattcgcc gattggaacg tacgggaatg cggcgcaatt 300 cgtccgaagg gcttatggga ggccggaatt gcgtatgagc aaatgcatca agctgcgggt 360 ctagcttctt tgcctaacgg tacattgttt ccatcggcag ttccagggcg catgaatctt 420 tgtcagcgcg ttccagttgg cgtggtcggc gtaattgcac cttggaattt cccgttgttt 480 ctagcaatgc gttcggtagc accagcctta gcgttgggta atgcggtgat cttaaagccc 540 gaccttcaga ctgctgtcac cggggggggcg ctcattgccg aaatcttttc cgacgctggc 600 atgccggacg gtgttcttca cgttcttcct ggtggagcgg acgtaggaga gtcaatggtt 660 gcgaactccg gaattaacat gatttctttt accgggtcca cacaggtggg ccggttgatc 720 ggagagaaat gcgggagaat gctgaaaaag gttgcgcttg aactgggtgg taataatgtc 780 cacatcgtgt tgcctgacgc cgatttagaa ggggctgtca gctgcgctgc ttggggtacg 840 tttttgcatc agggccaagt gtgcatggcc gccggacgtc atttagtaca tagggacgtt 900 gctcagcaat atgcagagaa actggcgcta cgtgccaaga acttagtggt gggggatcca 960 aactcggatc aagtgcatct cggcccgctt atcaatgaga aacaggtagt tcgcgtccac 1020 gcgctcgttg aatctgcgca aagggccggt gctcaggttt tggcgggagg tacgtatcaa 1080 gatcgctact accaagctac cgtaatcatg gatgtgaagc cggagatgga ggttttcaaa 1140 tctgaaattt tcggcccggt ggctccgatc actgtatttg acagtattga agaggcgatt 1200 gaattggcaa actgttcgga gtatgggttg gccgcatcta tccatactag ggcgttggcg 1260 actggtctag acatcgcaaa gcgtctaaat accggtatgg tccatattaa tgaccagcca 1320 attaactgtg agccgcatgt tcccttcgga ggaatgggtg cctcgggtag cggaggccgg 1380 tttggcggac ctgcaagtat tgaagaattt actcaatctc aatggattag tatggttgag 1440 aagccagcta attacccatt ttga 1464
Claims
1. A recombinant engineered bacterium for the efficient synthesis of 5-methylpyrazine-2-carboxylic acid, characterized in that, The recombinant engineered bacteria express threonine dehydrogenase tdh, xylene monooxygenase xmo, benzyl alcohol dehydrogenase badh, and benzaldehyde dehydrogenase bzdh; the threonine dehydrogenase is... Escherichia coli The threonine dehydrogenase from the source has the amino acid sequence shown in SEQ ID NO:1; the xylene monooxygenase is... Pseudomonas aeruginosa The xylene monooxygenase from this source has the amino acid sequence shown in SEQ ID NO:3; the benzyl alcohol dehydrogenase is... Pseudomonas aeruginosa The benzyl alcohol dehydrogenase from this source has the amino acid sequence shown in SEQ ID NO:5; the benzaldehyde dehydrogenase is... Pseudomonas aeruginosa The benzaldehyde dehydrogenase from the source has the amino acid sequence shown in SEQ ID NO:
7. The construction method of the recombinant engineered bacteria is as follows: the threonine dehydrogenase gene tdh is ligated into the expression vector pET28a to obtain the recombinant expression plasmid pET28a-tdh; the xylene monooxygenase gene xmo and the benzyl alcohol dehydrogenase gene badh are ligated into the first cloning site of the expression vector pETDuet-1, and the benzaldehyde dehydrogenase gene bzdh is ligated into the second cloning site of the expression vector pETDuet-1 to obtain the recombinant expression plasmid pETDuet-1-xmobadhbzdh. Then, all the constructed expression plasmids are transformed into Escherichia coli BL21(DE3) for expression.
2. A method for the efficient synthesis of 5-methylpyrazine-2-carboxylic acid, characterized in that, The method uses the recombinant engineered bacteria described in claim 1 as the starting strain to produce 5-methylpyrazine-2-carboxylic acid through fermentation in a medium containing L-threonine.
3. The method according to claim 2, characterized in that, The concentration of L-threonine is 8-12 g / L.
4. The method according to claim 2, characterized in that, The reaction time is 8-12 hours, and the reaction temperature is 22-30℃.