A method for detecting drug-resistant genes of Candida tropicalis based on nucleic acid mass spectrometry

Abstract

A method for detecting tropical Candida albicans resistance genes based on nucleic acid mass spectrometry technology, comprising: determining seven tropical Candida albicans resistance genes ERG11 , FKS1 , MDR1 , TAC1 , UPC2 , MRR1 , ERG3 and its SNP sites, design multiple PCR primers and MPE primers for the SNP sites therein; extract tropical Candida DNA and perform multiple PCR amplification, perform mass probe extension reaction and resin desalting after SAP digestion, and then perform mass spectrometry on a machine, use the difference in mass-to-charge ratio of nucleic acid fragments as the result detection signal, and quickly judge whether the tropical Candida resistance gene sequence has mutation. The present invention has the characteristics of short cycle, high throughput, high accuracy, high precision, low cost, etc., and provides a reliable and effective method for clinical detection of tropical Candida resistance genes.

Description

Technical Field

[0001] The invention belongs to biological detection technology and relates to nucleic acid mass spectrometry technology, in particular to a method for detecting tropical Candida drug-resistant genes based on nucleic acid mass spectrometry technology. Background Art

[0002] In recent years, the incidence of opportunistic fungal infections has been increasing in clinical practice. Candida is the most common pathogen causing opportunistic fungal infections in clinical practice, and the isolation rate of tropical Candida continues to increase. Due to the widespread use of antifungal drugs in the prevention and treatment of fungal diseases, the resistance rate of tropical Candida is gradually increasing. Tropical Candida has a high resistance rate to commonly used antifungal drugs in clinical practice, which often leads to ineffective antifungal treatment. At present, the research on the resistance mechanism of tropical Candida mainly involves azoles, echinocandin and amphotericin B, and the corresponding resistance genes mainly include ERG11, UPC2, MDR1, and FKS1.

[0003] The 14-α demethylase encoded by the ERG11 gene is a key enzyme for the synthesis of ergosterol in Candida cells. Ergosterol can maintain the normal structure of the cell membrane and is the main sterol in the Candida cell membrane. It is also an important structure for maintaining the integrity and fluidity of the cell membrane. The target of azole drugs is the 14-α demethylase on the Candida cell membrane, which affects the binding of the enzyme to the substrate, thereby blocking the biosynthesis of ergosterol in the Candida cell membrane and exerting an antifungal effect. Mutations in the ERG11 gene cause changes in the spatial structure and biological activity of the enzyme it encodes, resulting in a decrease in the affinity of Candida to azoles, thereby reducing sensitivity to azole drugs or even drug resistance.

[0004] The product encoded by the UPC2 gene is a zinc cluster transcription factor with transcriptional regulation function, which can regulate the expression of the ERG11 gene. Overexpression of the ERG11 gene is also a mechanism of azole resistance. Mutation of the UPC2 gene can cause upregulation of ERG11 gene expression, thereby leading to Candida resistance to azole drugs.

[0005] The ERG3 gene is also a member of the sterol pathway genes, and its mutation and inactivation are associated with both azole and amphotericin B resistance.

[0006] Drug efflux transporters encoded by Candida have a potential impact on azole drug sensitivity. They can serve as transport substrates for azole drugs, reducing the effective cellular concentration of drugs to below the target inhibitory threshold. Overexpression of multidrug efflux transporters is a recognized resistance mechanism that confers resistance to azole antifungal drugs. The two major efflux pumps in Candida are the ABC transporter encoded by the CDR gene and the MFS transporter encoded by the MDR1 gene.

[0007] Mutations in TAC1 and MRR1 genes, which encode zinc cluster transcription factors, can regulate the expression of CDR and MDR genes, respectively, and this potential overexpression mechanism is an important component of azole resistance.

[0008] Echinocandins are the first-line drugs for the clinical treatment of invasive candidiasis. With its widespread use, drug-resistant tropical Candida albicans have emerged. The protein Fks encoded by the FKS1, FKS2, and FKS3 genes is a subunit of the fungal cell wall β-1,3-D glucan synthase and is also the target of the antifungal effect of echinocandins. The resistance of tropical Candida albicans to echinocandins is mainly related to FKS1 gene mutations.

[0009] ERG11: GenBank accession number: M23673; SEQ ID NO.71

[0010] FKS1:GenBank accession number: EU676168.2; SEQ ID NO.72

[0011] MDR1: GenBank accession number: XM_002548069; SEQ ID NO.73

[0012] TAC1: GenBank accession number: XM_002550963.1; SEQ ID NO.74

[0013] UPC2:GenBank accession number: NW_003020056.1; SEQ ID NO.75

[0014] MRR1: GenBank accession number: XM_002547926.1; SEQ ID NO.76

[0015] ERG3: GenBank accession number: XM_002550136; SEQ ID NO.77.

[0016] Studying the resistance mechanism of Candida tropicalis to common antifungal drugs can not only provide prognostic value for antifungal treatment, but also help develop new antifungal drugs. Traditional resistance phenotypic detection technologies such as biochemical identification and drug sensitivity testing have disadvantages such as long time and slow identification speed, and often cannot meet clinical needs. With the in-depth study of resistance mechanisms, molecular biological detection methods have been gradually applied, mainly including polymerase chain reaction (PCR), restriction fragment length polymorphism (PCR-RFLP) analysis, PCR-SSCP analysis, fluorescence quantitative PCR technology (TaqMan probe), gene chip technology, and second-generation sequencing.

[0017] The principles and shortcomings of the above molecular biological detection technologies are as follows:

[0018] PCR technology is a method developed based on the semi-conservative replication mechanism of DNA to synthesize and amplify specific nucleic acid fragments in vitro, but it has low detection throughput and efficiency;

[0019] PCR-RFLP technology uses specific endonucleases to cut the target fragments obtained by PCR amplification. Due to the different restriction enzyme cutting sites of different alleles, DNA fragments of different lengths can be obtained, and finally resolved by gel electrophoresis. However, it has high requirements for sample purity, large sample volume, low RFLP polymorphism information content, and the polymorphism level is overly dependent on the type and amount of restriction endonucleases. In addition, the RFLP analysis technology has complicated steps, large workload, and high cost, so its application is subject to certain restrictions.

[0020] PCR-SSCP technology is to denature the DNA fragments after PCR amplification into single-stranded DNA. The single-stranded DNA forms different stereo conformations during neutral polyacrylamide gel electrophoresis and affects the migration rate. The difference of only one base in DNA fragments of the same length can affect the migration displacement, thereby identifying whether there is a gene mutation. However, this method can only detect whether there is a gene mutation, but cannot determine the location and type of the mutation.

[0021] Fluorescence quantitative PCR technology (TaqMan probe) designs a probe that specifically hybridizes with the target gene. The 5' end of the probe is labeled with a fluorescent group, and the 3' end is labeled with a quenching group. The system contains probes for different genotypes (carrying different fluorescent groups), thereby realizing the detection of gene mutations. However, this method has low throughput.

[0022] Gene chip technology uses a large number of specific oligonucleotide fragments or gene fragments as probes, which are hybridized with the sample to be tested according to the base pairing principle to detect specific genes, but this method has a high experimental cost;

[0023] Next-generation sequencing is a high-throughput sequencing method used to rapidly sequence base pairs of DNA or RNA samples, but its experimental operation and data analysis process is extremely time-consuming and costly.

[0024] At present, clinical detection of tropical Candida resistance is mainly based on traditional resistance phenotypic detection, PCR and second-generation sequencing. Traditional biochemical identification and drug sensitivity testing are time-consuming and slow, and PCR detection throughput is low. Second-generation sequencing is time-consuming, data analysis is complex and costly. Therefore, the above commonly used detection methods cannot meet the needs of large-scale and rapid clinical detection.

[0025] In summary, the present invention aims to provide a rapid, accurate, high-throughput and low-cost method for detecting drug-resistant genes of Candida tropicalis. Summary of the invention

[0026] In view of the above-mentioned technical problems in the prior art, the present invention provides a method for detecting tropical Candida resistance genes based on nucleic acid mass spectrometry technology. The method for detecting tropical Candida resistance genes based on nucleic acid mass spectrometry technology is intended to solve the technical problems of long cycle, low throughput and high cost in the prior art methods for detecting tropical Candida resistance genes.

[0027] The present invention provides a method for detecting drug-resistant genes of Candida tropicalis based on nucleic acid mass spectrometry technology, which is characterized by comprising the following steps:

[0028] 1) Determine seven drug-resistant genes ERG11, FKS1, MDR1, TAC1, UPC2, MRR1, ERG3 and their SNP sites of Candida tropicalis; the gene sequence of ERG11 is shown in SEQ ID NO.71; the gene sequence of FKS1 is shown in SEQ ID NO.72; the gene sequence of MDR1 is shown in SEQ ID NO.73; the gene sequence of TAC1 is shown in SEQ ID NO.74; the gene sequence of UPC2 is shown in SEQ ID NO.75; the gene sequence of MRR1 is shown in SEQ ID NO.76; the gene sequence of ERG3 is shown in SEQ ID NO.77;

[0029] 2) Based on the reference strain sequences of the above seven drug-resistant genes, multiple PCR primers and MPE primers were designed targeting the SNP sites;

[0030] 3) Extraction of C. tropicalis DNA and multiplex PCR amplification, SAP digestion followed by mass probe extension reaction and resin desalting;

[0031] 4) The mass spectrometer is used to quickly determine whether the resistance gene sequence of Candida tropicalis has mutated, using the difference in the mass-to-charge ratio of nucleic acid fragments as the result detection signal.

[0032] Furthermore, the 38 SNP sites of the above seven drug resistance genes are as follows:

[0033]

[0034] Furthermore, the drug-resistance gene SNP sites included in the screening include confirmed sites with a clear causal relationship with drug resistance and related sites whose causal relationship has not yet been confirmed, which has application value for clinical rapid drug resistance detection and retrospective analysis.

[0035] Furthermore, the multiplex PCR primers and MPE primers are artificially designed, their sequences do not belong to any known nucleic acid primer sequences, and there is no mutual interference between the two primers.

[0036] The PCR primer and MPE primer combination comprises:

[0037] The multiplex PCR primers are 15 pairs, and the PCR primer sequence combinations are as described in Table 1;

[0038] Table 1: Multiplex PCR primer sequences

[0039]

[0040]

[0041] The number of MPE primers is 40, as shown in Table 2.

[0042] Table 2: MPE-quality probe sequences

[0043]

[0044]

[0045] Furthermore, the multiple PCR primers can effectively complete the amplification of all gene sequences under the same reaction temperature and time program.

[0046] Furthermore, the concentration and purity of the extracted DNA are relatively low, with a concentration greater than 0.1 ng / ul, a purity 260 / 280 of 1.6-2.0, and 260 / 230 greater than 1, which meets the subsequent detection requirements.

[0047] Specifically, the 38 SNP sites of the above seven drug-resistant genes were collected manually and were not derived from any known drug-resistant gene database.

[0048] Furthermore, after determining the target gene sequence and SNP site, Primer Primer6.0 and the gene locus analysis and design system were used to design multiple PCR primers and mass probes (MPE primers), respectively. The gene locus analysis and design system can automatically calculate the molecular weight of the MPE primers and each extension product while designing the MPE primers.

[0049] Specifically, in step 3),

[0050] Setting up a PCR amplification program, amplifying multiple PCR primers and sample DNA, and obtaining an amplification product;

[0051] Set up a digestion program to perform a digestion (SAP) reaction on the PCR product to remove excess dNTPs in the PCR amplification product and obtain a digestion product;

[0052] The mass probe extension program was set up to perform an extension reaction on the MPE primer and the digestion product. The substrates for this reaction were four ddNTPs, which terminated the MPE primer extension after one base, thereby obtaining the mass probe extension product.

[0053] Resin desalination steps:

[0054] The mass probe extension product is desalted using a resin to remove salt ions in the product and obtain a final sample to be analyzed.

[0055] Steps for spotting samples:

[0056] After the sample to be analyzed is mixed with the matrix solution in a ratio of 1:1, 1 ul of the mixed solution is dropped on the surface of a disposable target plate, and after drying and crystallization, it is tested on a mass spectrometer.

[0057] Specifically, in the data analysis and interpretation step of step 4):

[0058] Fully automatic analysis and identification software - QuanNUA genotyping system, is used for sample data analysis and result determination. The system can distinguish different MPE primers and the molecular weight after MPE primer extension, and present the peak position of each primer and extended base on the spectrum. This method can detect whether the corresponding site has mutated and the corresponding genotyping at the same time.

[0059] Compared with the prior art, the present invention has remarkable technological progress. Traditional drug resistance phenotype detection methods are long and slow in identification, often unable to meet clinical needs, and conventional molecular biological detection methods such as PCR, PCR-RFLP, PCR-SSCP, fluorescent quantitative PCR (TaqMan probe), gene chip and second generation sequencing, have problems such as low flux, long cycle and high cost. The present invention is a fast, accurate, high-flux and low-cost detection method for tropical Candida resistance genes, the nucleic acid mass spectrometry system integrates multiple PCR amplification technology and time-of-flight mass spectrometry technology, has the characteristics of high throughput, high sensitivity and high precision, and can achieve synchronous analysis of multiple sites when the sample dosage is small, and a single hole can detect up to 40 sites, which greatly improves the detection efficiency and effectively solves the drawbacks of conventional tropical Candida resistance detection methods. BRIEF DESCRIPTION OF THE DRAWINGS

[0060] Figure 1 It is a flowchart of the overall steps of the present invention;

[0061] Figure 2 The tropical Candida resistance gene locus information table described in Example 1 of the present invention;

[0062] Figure 3 The multiplex PCR amplification system and reaction procedure described in Example 1 of the present invention;

[0063] Figure 4 The SAP digestion system and reaction procedure described in Example 1 of the present invention;

[0064] Figure 5 The mass probe extension system and reaction procedure described in Example 1 of the present invention;

[0065] Figure 6 The QuanNUA genotyping system interface described in Example 1 of the present invention;

[0066] Figure 7 , 8 9 is a partial SNP site result spectrum diagram described in Example 1 of the present invention;

[0067] Fig.10 The result diagram of the traditional drug sensitivity test in the comparative experiment described in Example 2;

[0068] Fig.11 This is a diagram showing the sequencing results of the common PCR method in the comparative experiment described in Example 2;

[0069] Fig.12 This is the sequence comparison analysis interface of the common PCR method in the comparative experiment described in Example 2. DETAILED DESCRIPTION

[0070] The embodiments of the present invention are further described below in conjunction with the accompanying drawings.

[0071] Example 1

[0072] (1) Primer design: The present invention is to design 38 SNP sites of seven tropical Candida resistance genes, ERG11, FKS1, MDR1, TAC1, UPC2, MRR1, and ERG3 ( Figure 2 ) designed multiplex PCR primers and MPE primers, including 15 multiplex PCR primer pairs (Table 1) and 40 quality probes (Table 2).

[0073] Table 1: Multiplex PCR primer sequences

[0074]

[0075]

[0076] Table 2: MPE-quality probe sequences

[0077]

[0078]

[0079] (2) DNA template: Extract the DNA of Candida tropicalis isolated clinically and store the extracted template in a -20℃ or -80℃ low-temperature refrigerator. The requirements for the DNA template are as follows: 0.1-100ng / ul DNA template can be detected, but the higher the concentration, the higher the risk of contamination. Generally, there is a risk of contamination when the concentration exceeds 50ng / ul. Therefore, the optimal detection concentration is set at 5-10ng / ul. At this concentration, it can be effectively and stably detected and the possibility of contamination can be minimized. The purity A260 / 280 is 1.6-2.0 and A260 / 230>1.

[0080] (3) Multiplex PCR amplification: There are 51 tropical Candida DNA templates, all of which are from the laboratory of Shanghai Oriental Hospital. Since the DNA templates of the present invention are extracted from bacterial liquid and the concentration is generally high, all DNA templates are first diluted to a concentration of 5-10 ng / ul. Figure 3 The system was prepared in the following manner, 2ul of template was added, no enzyme-free water was added to supplement the system, the total volume was 5ul, and the Figure 3 Multiplex PCR amplification was performed using the procedure described above.

[0081] (4) SAP digestion: The multiplex PCR amplification products were digested according to Figure 4 The system is prepared and used Figure 4The multiplex PCR products were digested using a program. Phosphatase (Shrimp Alkaline Phosphatase, SAP) can hydrolyze deoxyribonucleotides (dNTPs), mainly removing the remaining dNTPs in the multiplex PCR amplification process to avoid interference with the mass probe extension reaction.

[0082] (5) Mass probe extension reaction: The digested product is Figure 5 The system is prepared and used Figure 5 The mass probe extension reaction is carried out according to the procedure. The substrates used in this reaction are four dideoxyribonucleotides (ddNTPs). Therefore, the MPE primer stops extending one base forward, forming a calculable mass difference between the extension product and the primer, thereby achieving the purpose of typing detection.

[0083] (6) Resin desalting: ① Add 14ul of deionized water to each reaction well; ② Gently turn over the eight-tube strip containing the resin and place it on the sample plate to ensure that the resin wells are aligned with each sample well, and then tap the resin tube to make the resin fall into the wells of the sample plate; ③ Use a palm centrifuge to centrifuge instantly or use a plate centrifuge to centrifuge at 2000rpm for 1min to prevent the resin from adhering to the tube wall; ④ Place the sample plate with the resin in a flip mixer and mix at 20rpm for 30min; ⑤ After mixing, centrifuge the sample at 2000rpm for 1min, and the supernatant is ready for testing.

[0084] (7) Nucleic acid mass spectrometry detection: ① Take out the target plate and matrix solution, mix the matrix solution thoroughly before use, and preferably sonicate for 2 minutes; ② Prepare a mixture of matrix and sample supernatant in a volume ratio of 1:1, take 1 μL of the mixture and spot it on the matrix of the target plate, dry and crystallize it, and then test it; ③ Load the target plate into the mass spectrometer for on-machine collection and detection.

[0085] (8) Interpretation of test results: The QuanNUA genotyping system is used for sample data analysis and result interpretation, as shown in the attached Figure 6 As shown, the target plate amplification results can be displayed in the original result column. Expand the sample point, and the original result column can display the amplification results of the sample point. The marker lines of different colors in the spectrum are the corresponding positions of the MPE primers and their extension products. Select the target point to be viewed with the left mouse button to display the mass spectrum of the current target point. Select one of the sites, and the color marker line will mark the mass spectrum of the currently selected site and its corresponding extension product. The spectrum results of some sites in the present invention are shown in the attached Figure 7 , 8 As shown in Figure 9, the sensitive samples and the resistant (mutated) samples can be clearly distinguished in the spectrum, and the detected genotype can be given while distinguishing whether there is a mutation.

[0086] The leftmost marker line in the spectrum is the position of the MPE primer, the extension product is at the right tail marker line, and the presence or absence of a mass spectrum peak at the extension product position corresponds to the presence or absence of an amplified product.

[0087] Figure 7 The mutation type of the UPC2-751 site is G->A. The blank control extension products have no mass spectrometry peaks, indicating that there is no amplified product; the sensitive sample extension product A has no mass spectrometry peak, but G has a mass spectrometry peak, indicating that the amplified product is G, so the UPC2-751 genotype in this sample is G; the resistant sample extension product A has a mass spectrometry peak, and G also has a mass spectrometry peak, indicating that the amplified product is AG, so the UPC2-751 genotype in this sample is AG.

[0088] Figure 8 The mutation type of TAC1-491 site is A->T. The blank control extension products have no mass spectrometry peaks, indicating that there is no amplified product; the sensitive sample extension product A has a mass spectrometry peak, and T has no mass spectrometry peak, indicating that the amplified product is A, so the TAC1-491 genotype in this sample is A; the resistant sample extension product A has a mass spectrometry peak, and T also has a mass spectrometry peak, indicating that the amplified product is AT, so the TAC1-491 genotype in this sample is AT.

[0089] Fig. 9 The mutation type of ERG11-395 site is A->T. The blank control extension products have no mass spectrometry peaks, indicating that there is no amplified product; the sensitive sample extension product A has a mass spectrometry peak, and T has no mass spectrometry peak, indicating that the amplified product is A, so the ERG11-395 genotype in this sample is A; the resistant sample extension product A has no mass spectrometry peak, and T has a mass spectrometry peak, indicating that the amplified product is T, so the ERG11-395 genotype in this sample is T.

[0090] Example 2

[0091] The present invention adds two control groups, namely, a traditional drug sensitivity test and a common PCR method, to highlight the advantages of the method in terms of rapidity and high throughput.

[0092] The method for detecting drug-resistant genes of Candida tropicalis provided by the embodiment of the present invention was compared with the traditional clinical drug sensitivity test and the common PCR method for detecting drug-resistant genes (Table 3).

[0093] Table 3 Comparison of clinical tropical Candida resistance detection technology platforms

[0094] Technical Solution Difficulty of data analysis Ease of operation Flux time consuming Solution of the present invention Simple Simple high short Traditional drug sensitivity test Simpler Simple high long Conventional PCR difficulty difficulty Low long

[0095] The steps include:

[0096] (1) Take a strain of Candida tropicalis isolated from clinical practice and perform drug resistance testing using the above three methods.

[0097] (2) The steps of the tropical Candida resistance gene detection method provided in the embodiment of the present invention are the same as those in Example 1, including DNA extraction, multiplex PCR, SAP digestion, mass probe extension reaction, resin desalting, mass spectrometry and result interpretation. It takes about 6-8 hours to complete the 38-fold mutation site detection of tropical Candida resistance genes, and the result interpretation is performed by instrument automation, which is simple and easy to operate.

[0098] (3) The traditional clinical drug sensitivity test is carried out by the commercialized microbroth dilution method. A single clone is picked from the plate and prepared into a bacterial suspension. After dilution by a certain multiple, it is added to the pre-made drug sensitivity plate. After culturing in an incubator for 24 hours, the results are interpreted according to the growth concentration of the bacteria in each well (see Appendix). Fig.10 ). Therefore, although the traditional drug sensitivity test method is the gold standard for phenotypic experiments, its detection cycle is long, about 24-25 hours.

[0099] (4) Conventional PCR for drug resistance gene detection: each reaction system can only detect a certain fragment of a gene. For genes with a long full length or a long distance between the test sites, multiple pairs of primers need to be designed. After the PCR reaction, it is necessary to go through steps such as gel running, gel cutting and purification, design of sequencing primers, Sanger sequencing, result splicing and comparison with reference sequence, which takes more than 30 hours in total (see Appendix). Fig.11 , 12 ). Moreover, this method has high requirements on operation and instruments and low throughput.

[0100] Therefore, the method for detecting drug-resistant genes of Candida tropicalis provided by the embodiment of the present invention has the advantages of simple data analysis, easy operation, high throughput and short detection cycle, and is of great significance for clinical rapid drug resistance screening and guiding medication. Sequence Listing <110> Shanghai Oriental Hospital (Oriental Hospital Affiliated to Tongji University) Rongzhi Biotechnology (Qingdao) Co., Ltd. <120> A method for detecting drug-resistant genes of Candida tropicalis based on nucleic acid mass spectrometry <160> 77 <170> SIPOSequenceListing 1.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <400> 1 tcctacttgt tgtggttcct 20 <210> 2 <211> twenty two <212> DNA <213> Artificial Sequence <400> 2 caagatacat caaacccaag ac 22 <210> 3 <211> twenty one <212> DNA <213> Artificial Sequence <400> 3 tacataaacc acatcataaa t 21 <210> 4 <211> twenty two <212> DNA <213> Artificial Sequence <400> 4 atgggaaaaa taatggatag at 22 <210> 5 <211> twenty one <212> DNA <213> Artificial Sequence <400> 5 aggatggaga tgacggagat g 21 <210> 6 <211> twenty three <212> DNA <213> Artificial Sequence <400> 6 tgccaaatct ttcttcccat att 23 <210> 7 <211> twenty four <212> DNA <213> Artificial Sequence <400> 7 tctaagagtc attcaactgg tgat 24 <210> 8 <211> twenty four <212> DNA <213> Artificial Sequence <400> 8 ttcaggttct tcatcttccg taat 24 <210> 9 <211> 18 <212> DNA <213> Artificial Sequence <400> 9 cgcgtctaat tcaacagc 18 <210> 10 <211> twenty two <212> DNA <213> Artificial Sequence <400> 10 agcaacaact ctaccaacac ct 22 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <400> 11 aaattatccg atgtttctgc 20 <210> 12 <211> 25 <212> DNA <213> Artificial Sequence <400> 12 caaaataatt caaaacttct tctct 25 <210> 13 <211> twenty one <212> DNA <213> Artificial Sequence <400> 13 tcccaaactt gccattacct c 21 <210> 14 <211> twenty two <212> DNA <213> Artificial Sequence <400> 14 tcaccgcttt ctcttcttct ct 22 <210> 15 <211> twenty four <212> DNA <213> Artificial Sequence <400> 15 gaagaagaga aagcggtgat attg 24 <210> 16 <211> twenty two <212> DNA <213> Artificial Sequence <400> 16 caacaagttg gtcaattctt cg 22 <210> 17 <211> 25 <212> DNA <213> Artificial Sequence <400> 17 gaagaattga ccaacttgtt gaaag 25 <210> 18 <211> twenty four <212> DNA <213> Artificial Sequence <400> 18 catagtgacc ttttggaata acat 24 <210> 19 <211> twenty one <212> DNA <213> Artificial Sequence <400> 19 acacccagaa catttcaacc c 21 <210> 20 <211> 25 <212> DNA <213> Artificial Sequence <400> 20 tcaccaatac atctgtgtct accac 25 <210> twenty one <211> 25 <212> DNA <213> Artificial Sequence <400> twenty one ttcaggacttttaagtgcagggaat 25 <210> twenty two <211> 16 <212> DNA <213> Artificial Sequence <400> twenty two attaccgaga cttgtg 16 <210> twenty three <211> twenty two <212> DNA <213> Artificial Sequence <400> twenty three ccacaacagc aacagcaacc ac 22 <210> twenty four <211> twenty two <212> DNA <213> Artificial Sequence <400> twenty four gttcattccc ggcaaatcca gc 22 <210> 25 <211> twenty two <212> DNA <213> Artificial Sequence <400> 25 gcaacagcag cttcaacttc tt 22 <210> 26 <211> 25 <212> DNA <213> Artificial Sequence <400> 26 cggtgaaata ttaggtatag atttc 25 <210> 27 <211> twenty two <212> DNA <213> Artificial Sequence <400> 27 gccattaacc gaagcatcca ga 22 <210> 28 <211> twenty two <212> DNA <213> Artificial Sequence <400> 28 agctccttca cgatcaatac cc 22 <210> 29 <211> 25 <212> DNA <213> Artificial Sequence <400> 29 gaaatacccc tacatccattccaac 25 <210> 30 <211> twenty one <212> DNA <213> Artificial Sequence <400> 30 gtgcttgtga ttgtgcttgc g 21 <210> 31 <211> twenty three <212> DNA <213> Artificial Sequence <400> 31 cgactctaga ttaatggaac aaa 23 <210> 32 <211> 15 <212> DNA <213> Artificial Sequence <400> 32 attaatagtg ttgtt 15 <210> 33 <211> 16 <212> DNA <213> Artificial Sequence <400> 33 gtcaattctt cgtaaa 16 <210> 34 <211> 18 <212> DNA <213> Artificial Sequence <400> 34 caaaagcaaa tttagcaa 18 <210> 35 <211> 17 <212> DNA <213> Artificial Sequence <400> 35 cccaagaaga tgggaat 17 <210> 36 <211> 17 <212> DNA <213> Artificial Sequence <400> 36 ctccatactt gccattc 17 <210> 37 <211> twenty three <212> DNA <213> Artificial Sequence <400> 37 gctttggaac ataggttttg aaa 23 <210> 38 <211> 25 <212> DNA <213> Artificial Sequence <400> 38 cgttgttcag ccaaatgcaa caaga 25 <210> 39 <211> 27 <212> DNA <213> Artificial Sequence <400> 39 ctcttcttct cttaatttcc ttcatgt 27 <210> 40 <211> twenty four <212> DNA <213> Artificial Sequence <400> 40 cgtcaaatcg ttcaagtcac cacc 24 <210> 41 <211> 18 <212> DNA <213> Artificial Sequence <400> 41 gagatactgt tgattatg 18 <210> 42 <211> 20 <212> DNA <213> Artificial Sequence <400> 42 gtttggtaaa ggtgttattt 20 <210> 43 <211> twenty one <212> DNA <213> Artificial Sequence <400> 43 agaacccatt gagagtccca a 21 <210> 44 <211> twenty three <212> DNA <213> Artificial Sequence <400> 44 ttttctgatt ggatctctta aaa 23 <210> 45 <211> 20 <212> DNA <213> Artificial Sequence <400> 45 gttggttgaa tcttatttct 20 <210> 46 <211> 19 <212> DNA <213> Artificial Sequence <400> 46 acattcaaca tcaccttca 19 <210> 47 <211> 20 <212> DNA <213> Artificial Sequence <400> 47 gctcccaccg caacagcaac 20 <210> 48 <211> 19 <212> DNA <213> Artificial Sequence <400> 48 aactgaaatg aacttatag 19 <210> 49 <211> twenty one <212> DNA <213> Artificial Sequence <400> 49 acaattattt taccatcatc a 21 <210> 50 <211> 25 <212> DNA <213> Artificial Sequence <400> 50 cggagcagat acttatgctt taaat 25 <210> 51 <211> 18 <212> DNA <213> Artificial Sequence <400> 51 cgctaacttc tcaaagta 18 <210> 52 <211> twenty three <212> DNA <213> Artificial Sequence <400> 52 agactctaga ttaatggaac aac 23 <210> 53 <211> twenty one <212> DNA <213> Artificial Sequence <400> 53 cacttgcaaa aattaccatt g 21 <210> 54 <211> 19 <212> DNA <213> Artificial Sequence <400> 54 cgatctgtgt ctaccacca 19 <210> 55 <211> 19 <212> DNA <213> Artificial Sequence <400> 55 ctcaattctg aagatactg 19 <210> 56 <211> 25 <212> DNA <213> Artificial Sequence <400> 56 cccaaactct agattaatgg aacaa 25 <210> 57 <211> twenty four <212> DNA <213> Artificial Sequence <400> 57 cttataccca tttgactact cctg 24 <210> 58 <211> 16 <212> DNA <213> Artificial Sequence <400> 58 attgatccaa agagag 16 <210> 59 <211> 20 <212> DNA <213> Artificial Sequence <400> 59 atcttatttc ttcttgactt 20 <210> 60 <211> 17 <212> DNA <213> Artificial Sequence <400> 60 ttatttctcc ttgactt 17 <210> 61 <211> 16 <212> DNA <213> Artificial Sequence <400> 61 attggatctc ttaaag 16 <210> 62 <211> 18 <212> DNA <213> Artificial Sequence <400> 62 aagatgatgt aggcatag 18 <210> 63 <211> twenty four <212> DNA <213> Artificial Sequence <400> 63 cgattactta aatcccctaa acct 24 <210> 64 <211> 19 <212> DNA <213> Artificial Sequence <400> 64 tgttgcaaat cagatactg 19 <210> 65 <211> 20 <212> DNA <213> Artificial Sequence <400> 65 ggcaaatcca gctgtgaagc 20 <210> 66 <211> twenty two <212> DNA <213> Artificial Sequence <400> 66 ccaagcccca tctcaaccac aa 22 <210> 67 <211> 26 <212> DNA <213> Artificial Sequence <400> 67 ctacatccat tccaacgaat atcaac 26 <210> 68 <211> 19 <212> DNA <213> Artificial Sequence <400> 68 ctttgtactc cttttgcat 19 <210> 69 <211> 18 <212> DNA <213> Artificial Sequence <400> 69 cactggatgg aaagcatg 18 <210> 70 <211> 20 <212> DNA <213> Artificial Sequence <400> 70 gaggtataga tttcgctgag 20 <210> 71 <211> 1587 <212> DNA <213> Homo sapiens <400> 71 atggctattg ttgatactgc cattgatggc atcaattatt tcttatcctt atcattaact 60 caacaaatca ccatcttggt tgttttccca ttcatctaca acatagcatg gcaattactt 120 tactccttaa gaaaagatag agttccaatg gttttctact ggatcccatg gtttggttct 180 gctgctagtt atggtatgca accatacgaa ttctttgaaa agtgtagatt gaaatatggt 240 gatgtttttt catttatgtt attgggtaaaa gttatgactg tttatttggg tccaaaaggt 300 cacgaattca tttacaatgc taaattatcc gatgtttctg ctgaagaagc ttatacccat 360 ttgactactc ctgtttttgg taaaggtgtt atttatgatt gtccaaactc tagattaatg 420 gaacaaaaga agtttgctaa atttgctttg actactgatt ctttcaaaac ctatgttcca 480 aagatcagag aagaagtttt gaattatttt gttaacgatg ttagtttcaa aaccaaggaa 540 agagaccatg gtgttgctag tgttatgaaa actcaaccag aaatcactat tttcactgct 600 tctcgttgtt tatttggtga tgaaatgaga aagagtttcg acagatcatt tgctcaattg 660 tatgctgact tggataaagg tttcacccca atcaactttg ttttcccaaa cttgccatta 720 cctcattact ggagacgtga cgctgctcaa agaaagatat ctgctcatta catgaaggaa 780 attaagagaa gaagagaaag cggtgatatt gatccaaaga gagatttgat tgattccttg 840 ttggttaact ctacttataa agatggtgtt aaaatgactg atcaagaaat tgctaacctt 900 ttattggtg ttttgatggg tggtcaacat acttctgctt ccacttctgc ctggttcttg ttgcatttgg ctgaacaacc acaattacaa gatgatcttt acgaagaatt gaccaacttg ttgaaagaaa agggtggtga cttgaacgat ttgacttacg aagacttgca aaaattacca ttggttaaca acactattaa agaaactttg agaatgcaca tgccattgca ttctattttc agaaaagtta tgaacccatt gagagtccca aataccaat atgttattcc aaaaggtcac tatgtcttag tttctgccgg ttatgctcat accagtgata gatggtttga acacccagaa catttcaacc caagaatg ggaatctgat gataccaagg ctagtgctgt ttctttcaat tctgaagata ctgttgatta tggtttcggt aaaatttcca agggtgtctc ctctccatac ttgccattcg gtggtggtag acacagatgt attggtgaac aatttgctta tgttcaattg ggaactattt tgaccactta tatctacaac ttcaaatgga gattaaacgg tgataaggtt ccagatgttg attackc catggttacc ttaccattag aacctgctga aattgtttgg gaaaagagag atacttgtat ggtttag <210> 72 <211> 5715 <212> DNA <213> Homo sapiens <400> 72 atgtcgtata acgataacaa taacaatcat tattacgacc ctaaccaaca gggcggtgtt 60 ccaccgcaac aaggtgatgg gtactaccaa caacaatatg acgatatgag tcaacaacaa 120 caatatgaca acatgggtca acaaccacat caacaagact actacgatcc aaatgttcaa 180 tacaaccaac aaccatatga catggatgga tatcaagatc aagcccaata tggtggccaa 240 ccaatgaatg cccaagggta caatgctgat ccagaagcat tttccgattt tagctacggt 300 ggccaaactc ctggtactcc aggttatgat caatatggta ctcaatacac accatcccaa 360 atgagctatg gtggagatcc tagatcttct ggtgcatcta caccaattta cggtggtcaa 420 ggtcaaggtt acgatccaac ccaattcaac atgtcttcaa atttgccata cccagcatgg 480 tcagctgatc cacaagctcc aattaaagta gaacacattg aagatatttt cattgatttg 540 actaataaat ttggtttcca aagagattct atgagaaata tgtttgatta ctttatgact 600 ttgttagatt ctagatcttc tcgtatgtct ccagcccaag ctttgttgag tttacatgcc 660 gattacattg gtggtgacaa tgccaactat agaaaatggt tctttgcttc ccaacaagat 720 ttggatgatt ccttgggttt tgccaatatg actttgggta aacttggtag aaaagccaga 780 aaggcatcca agaatccaa gaaagccaga aaagcagccg aagaacacgg tgaagatgtc 840 gatgctcttg caaacgaatt agaaggcgat tactccttag aagctgccga aatcagatgg 900 aaggccaaga tgaactcttt aaccccagaa gaagagtca gagacattgc cctttattta 960 ttgttgtggg gtgaagccaa tcaagtccgt tttactccag aatgtttatg ttacatttac 1020 aaaactgcta tggattactt gcaatcacca ttgtgccaac aaagacaaga accagttcca 1080 gaaggtgact acttgaaccg tgttattact ccattgtaca gattcatcag atcccaagtt 1140 tatgaaattt acgacggtag atttgtgaaa cgtgaaaaag atcaataa ggttattggt 1200 tatgatgacg ttaatcaatt gttctggtac ccagaaggta tttctagaat catgtttgaa 1260 gacggaacca gattggttga tattccacaa gaagaacgtt tcttgagatt aggtgaagtt 1320 gaatggaaga atgtgttctt taaaacctat aaagaaatta gaacctggtt acatttcatc 1380 actaacttta atagaatttg gatcatccat ggtactatct actggatgta tactgcttat 1440 aactccccaa ccttgtatac taaacattat gtccaaacca gaaaccaaca accacttgct 1500 tcttctagat gggctgcttg tgccattggt ggtgtttttg cttgtcttgt tcaaatcttt 1560 gctacccttt tcgaatggat gtttgttcca agagaatggg ccggtgctca acatttgact 1620 cgtcgtatga tgtttttgat tttgatttc cttgccaact tggttccacc agtttatact 1680 ttcaaagtca ctaaattggt tttgtattcc aagtctgctt acgctgtttc cgtgtcggt 1740 ttctttattg ctattgccac tttagttttc tttgctgtca tgccattggg tggtttattc 1800 acttcataca tgaacaagag atctagaaga tacatttctt ctcaaacttt tactgccagt 1860 tatatcaaat tgcatggttt agatatgtgg atgtcctact tgttgtggtt ccttgttttc 1920 cttgctaaat tggttgaatc ttatttcttc ttgactttgt cttaagaga tccaatcaga 1980 aacttgtcta ccatgaccat gagatgtgtc ggtgaagtttt ggtacggtga cgttgtttgt 2040 agaaatcaag ccaaaattgt cttgggtttg atgtatcttg ttgatttgtt attgttcttc 2100 ttggatactt atatgtggta cattatctgt aactgtatct tctccattgg tcgttccttc 2160 tacttgggta tttccatctt gactccatgg agaaacattt tcaccagatt gccaaagaga 2220 atctactcca agattttggc caccactgaa atggaaatca agtacaaacc aaaggttttg 2280 atctcccaaa tttggaatgc tattgtcatt tccatgtaca gagaacattt attggctatt 2340 gatcacgttc aaaaattgtt gtaccaccaa gttccatctg aaattgaagg taagagaact 2400 ttgagagccc caactttctt tgttcccaa gatgacaaca atttgaaac agaattcttc 2460 ccaagaaact ctgaagctga aagaagaatt tctttctttg ctcaatcctt ggctactcca 2520 atgccagaac ctttgccagt cgacaacatg ccaactttca ctgttttcac tcctcattat 2580 tccgaaaaga ttttgttatc tttaagagaa attattagag aagatgatca attctccaga 2640 gtcactttat tggaatactt gaaacaattg cacccagttg aatgggattg ttttgttaag 2700 gacacaaaga ttttggctga agaaactgct gcttatgaaa acggtgatga ttctgaaaaa 2760 tttcagaag atggtttgaa atccaagatt gatgacttgc cattctactg tattggttc 2820 aaatccgctg ctccagata tactttgaga actagaattt gggcttcttt gagatcccaa actttgtaca gaactgtttc cggtttcatg aacttgcca gagctatcaa attgttgtat aggregate accctgaatt agttcaatac tttggaggtg atccagaagg tttagaattg gctttggaaa gaatggccag aagaaagttc agatttttgg tttctatgca aagattatcc aaattcaaag atgatgaat ggaaatgcc gaattcttgt tgcgtgccta cccagacttg caaattgctt acttagatga agaaccagct ttgaatgaag acgaagaacc aagagtctat tcttccttga ttgatggtca ttgtgaaatg ttagaaaatg gtagacgtcg tcctaaattc aggtgcaat tgtctggtaa cccaatcttg ggtgatggta aatctgataa ccaaaatcat gctgttattt tccacagagg tgaatatc caattgattg atgccaatca agataactat ttggaagaat gtttgaagat tagatctgtt ttggctgagt ttggaagaatt gaatgttgaa catgttaacc catatgctcc aaccatgaag aatgatgaa aacacatcaa aaccatcca gttgcattct tgggtgctag agaattatt ttctctgaaa actctggtgt tttgggtgat gtcgctgccg gtaaagaaca aactttcggt actttgtttg ctagaacttt ggctcaaatt 3600 ggtggtaaat tgcattatgg tcaccccggat ttcttgaatg ctacatttat gttgaccaga 3660 ggtggtgttt ccaaggcaca aaagggattg catttgaatg aagatattta tgccggtatg 3720 aatgccatga tgagaggtgg taagatcaag cattgtgaat actaccaatg tggtaaaggt 3780 agagatttgg gtttcggttc tattttgaat ttcactacca agattggtgc tggtatgggt 3840 gaacaaatgt tgtctagaga atatttctac ttgggtactc aacttccatt ggacagattc 3900 ttgtcattct actacggtca tccaggtttc catatcaata acttgtttat tcaattgtct 3960 ttacaagttt tcatcttggt tttggcaaac ttgaactctt tggctcatga atctattatc 4020 tgttcttaca ataaagatgt cccaattact gatgtcttgt atccatttgg ttgttacaat 4080 ctttctccag ctgttgattg gattagacgt tatactttgt ctatctttat tgttttctt 4140 atttccttca tcccattggt tgtccaagaa ttgatcgaaa gaggtgtttg gaaagcattc 4200 caaagattcg ttagacactt tatttcattg tctccaatgt ttgaagttt cgttgctcaa 4260 atctattctt catctgtttt cactgatttg actgttggtg gtgctagata tatttccact 4320 ggtagaggtt ttgctacttc tagaattcca ttttcaatct tgtactcacg ttttgctgat 4380 tcatctattt acatgggtgc tagattgatg ttgattttgt tgtttggtac tgtttcccac 4440 tggcaagcac cattgttgtg gttctgggct tcattgtctt cattgatgtt ctcaccattt 4500 attttcaacc cacatcaatt tgcttgggaa gatttcttta ttgattacag agatttcatc 4560 agatggttgt ctagaggtaa caccaaatgg cacagaaact cctggattgg ttacgttaga 4620 ctttctagat ctcgtatcac tggtttcaaa cgtaagttga ctggtgatgt ttctgaaaag 4680 gctgctggtg atgcttcaag agcccacaga tccaatgtgt tctttgccga ctttttgcca 4740 actttgattt acactgctgg tctttatgtc gcctacactt ttatcaatgc tcaaactggt 4800 gtcacttcat atagttatga aatcaatggt tctactgatc cacaagaagt caatgctaca 4860 ttgagactta tcatttgtgc cttggccccg gttgttattg actgtggttg tttggccgtt 4920 tgtgttggta tggcctgttg tgctggtcca atgttgggct tgtgttgtaa aaagactggt 4980 gccgtcattg ctggtattgc ccatggtgtt gctgtcattg tccacattgt ctttttcatt 5040 gtcatgtggg ttactgaagg tttcaacttt gctagaatgt tgttaggttt agccaccatg 5100 gtttatgttc aaagattat gttcaagttc ttgaccttgt gtttcttgac tagagaattc 5160 aagaatgata aagccaacac tgctttctgg actggtaaat ggtacaacac tggtatgggt 5220 tggatggcat ttactcaacc atctcgtgaa tttgttgcca agatcattga aatgtctgaa 5280 tttgctggtg atttcatgtt ggcccatatt atcttgttct gtcaattacc aatcttgtgt 5340 attccattaa ttgatagatg gcactccatg atgttgttct ggttgaaacc atccagatta 5400 atcagacctc caatctattc cttaaaacaa gccagattaa gaaaagagaat ggttagaaaa 5460 tactgtgttt tgtactttac tgttttgatt atgcttgttg ttattattgc cgctccagct 5520 gctgccctctg gtcaaattgc tgttgatcaa tttgccaata ttggtggttc tggatccatt 5580 gctaatggtt tgttccaacc aagaaatgtc agtaataatg atactggtaa tcataaacca 5640 aaatcataca cttggagttt cttgagtacc cgtttcactg gtactaccaa gggttattcc 5700 acaaatccat tttag 5715 <210> 73 <211> 1659 <212> DNA <213> Homo sapiens <400> 73 atgcattata gattttcag agacagtttt gttggtagaa tggtttacca tttatccaaa cataaatatt tcagtcataa agaagaatcc cctgattata tcgttccaga aagaatctt tctgagttca aacaattacc tagatcagaa tcaaatcaag aaaatttcga taaagataaa 240. snowflake gtctaattca acagcaactg snowflake snowflake ataattgtta cttgggatgg tgatgatgat cctgaaaatc cacttaattg gccattttat 360. caaaagctt tttttatttt ccaaatttca ttcttgacta cttctgtata tatgggttct gcagtttata ctcctggtat tgaagaatta atgcatgaat tagtgttgg tagagttgtt gctactttgc cattaacatt atttgttctt ggttatggat tagtccaat gatatttagt ccaatgtctg aaaatgccat tttcggtaga acttcaattt atattgttac attggctata tttgtcattt tacaagttcc aacagctttg gtgaagaata ttgcaggatt atgtatttta cgtttcttgg gtggattttt tgcaagtcct tgtttagcca ctggtggtgc tagtgttgct 660 gatgttgtta atttttggaa tgctccaatt ggtattagtg tatggagtct tggtgctgtt 720 tgtggacctt cattgggtcc attttttgga tcaattttaa cagttaaagc aggctggaga 780 tggacttttt ggtttatgtg tattattagt ggattttcat tattcatgtt ggcattcacc 840 cttcctgaat ctttcagtaa gactttattg cgtcgtaagg ctcaacgttt aagagcagtt 900 actggtaatg atagaatcac tagtgatggt gaagttgaaa attccaaaat gacaactcat 960 gaattgattg ttgatacttt atggagacca ttggagatta caatcatgga accggttgtt 1020 ttgttgattg atatttacat tgctatggtt tacagtattc tttatctttt ctttgaagtt 1080 ttcccaattt attttgttgg agttagagga tttactttgg ttgaacttgg taccactttc 1140 ttttccgtgt tgattggtat tgttgttgcc tgctctattt acttgcctat catcaaacga 1200 attttcactg atagaattct cagaaaagaa caggttttcc cagaagtttt cattccatta 1260 gctatagttg gaggttgttt gttaaccgga ggactattca tatttggatg gtcagcaact 1320 agaactactc attggattgg gcccttattt ggtgctgcag ttacctcatc tggagcattt 1380 ataattttcc aaacattat taattatatg ggtgcatcat tccagcctat ttatattgca 1440 tctgtgtttg catctaatga tttatttaga tctacagttg cttctgtgtt cccattgttt 1500 ggtgctccat tgtttaataa tttagcaacg ccaaattatc ctgttggttg gggtagttca 1560 gttttgggat tcattacact cgtgatgatt gccatcccag tgttttcta tttgaatggt 1620 ccaaaattaa gagctagatc caaatatgct aatcattag 1659 <210> 74 <211> 2832 <212> DNA <213> Homo sapiens <400> 74 atgtcatttg aagaaactac tatgggtgat tcttgtagtg agtcatattc tgaaattat 60 tccaatcaaa tcgaattaac aggaaatgat ccaaatgata caacgagaaa aagaattcga 120 gttgcttgtg atacatgtcg aggaaaaag ataaaatgta acgggacatt tccttgtgca 180 aattgtgttc aaactaaaaaa tgaatcaagt tgtcattata ctgaacgtcc tatgaagaaa 240 tcaaaaattg tcaaagataa gaaggaaact ctgatatcta acaaaaaaga tgatgtaata 300 tctgttacaa gtagtaatgg cgacaataat gaattaaaac caaaagataa acccacaaca 360 aagtctaaat ccaaatctaa gagtcattca actggtgata ttgaatctag actaagctca 420 atagaaaatt ctattctgag aatgatgtca gttatggaga aacttctggg gaagctaact 480 tctcaaagta atggagaaca aaatattacg gaagatgaag aacctgaaat tcgagatcac 540 acaacaacac catcagattt acaaaatccc aagaaagatt ttaatgattt agtaaattta 600 agaaattggg acgagtttgt gggtactcat tcaatagctt gtattttctc aagggattct 660 ttagcatgga tggaacgtgc tttaggagaa tatggagtgg aatatctaac acccataaga 720 aacttaccac ttgtattttt ctcggagatg aaaccgtata ttttaaaatg ggtggatcct 780 cctgttgttg atagacacca aaaaagaagg ttgatggaga ctccattccc tttggatgag 840 aagttggtca tgggattggt taatttgtat tatgaagaaa catcaattgt gaatacaatt 900 gtagaggagt cttggatgag agaattgttt actagttatt ttaagaattt aaaagaaacg 960 gatgcccgaa aaaggcgaag atacaggtta ccagaattat tatctatgac ttgtgtttta 1020 cttatagcat tgacttgcaa tacagaagat ggtttgttta attatgatcc taaaaaattc 1080 cccaatgagt attctccagc tggtgcatta ttagatggtt atagcagaaa aatgttgaca 1140 gagttgcagg aaaaattatt tgataatgca atttattatt accaacgtgt atcagtagtt 1200 agtgaaggta ttgaaacaat tgaagccttg ttgttgttga ttatttgcat agagtctaat 1260 tggttgacaa gttttcttaa tagttctcca atagcggttg ccattcgatt tgcacaagac 1320 cttggattac atcgtgcaga atcctattta aataaaccat tgaaggaaca agaaaggaga 1380 agaagagtat ggtggttctg ttatttcttt gatattgagt tttgtttcaa gtcaggtaaa 1440 ccgccaatga ttaactcaag tgatgttact acgaatagtg atgaagattt gttgcagtat 1500 ttcaaactaa ctgctgctga agcaccacaa tcttcggcat tgacttcggt atttcaatcg 1560 attgtcgatg atgtattaag atcaaccaca gaacaatcgt caatgagttt aggcatattg 1620 cgacagatcc aatatggagg gtacatcaat aatccgatgt atttcattt cagtgttttg 1680 ttgttgcta aaattagtc aaactcgtat cacgaacttt ttgttgcatc agctcagaaa 1740 aaaagcttca atgaaatatc aaatactttg gaaaaattga atcaagaaat gatgcagttg 1800 gcagctcatt cagcagaggc aatcaaacca agatttcata atgatttgag attccaagtt 1860 tctgacacag acaattctat ttcaagaaaa gagacaattt tgtcattcaa gctttcattt 1920 ttctgtcatt tgatgattat taatagatat ccatttatga ttagtaccaa agattcatta 1980 ttagatgata gaattttaca atatagaaat ctttcattag actcggcaag aaccattctt 2040 ttgcttgtca aactgtggga tagatcatca gcaacggcga ttttcttcaa ttgggcactt 2100 tattttcctg ttgcagcatt tcttgtatta tcagctgcta ttttgaatca tccatcatta 2160 gcagaatcgc aacgagattt atacttgttg attgatattg ctttatctta tttcagttgt 2220 tccaatgaat ggaaacatag tgatctgttc atcaacaaga agacagtcat atatacaaat 2280 aaggcattgt cgatagaatt aattattaga ttgatgttaa ggatagttat taaagtgttt 2340 gaaactcaaa ctggtatttc aattttggac aacaatcaaa ttttgaaaga ttatttgaaa 2400 gaagccgaga caaagtttcc tgaaattttc cagaatcatc aagaattcac ttcgcgaatg 2460 atgcaggtag ttggtgcgtc gccatttggt agttctggtg atgagtatac caacaaaaga 2520 actggtgcta gtccaagaaa tgcatcagca tatagtgcca aatctcctag ttataatcct 2580 tctttgtcaa atattattaa taatgatgta aatggagtca caaatggaag ttctggtagt 2640 gttacaggaa gtagtaatag tccaaataat ggtgttaatt tgcaacatgc atcaactccg 2700 aatggaggta tacccatttc caacggttat gattttctaa atgaatatgt gggtggcgat 2760 gcatcgtcgt taccgtttgg gcaatttgat aatttaccga actttttctt tgataataat 2820 cttggtgtat aa 2832 <210> 75 <211> 2349 <212> DNA <213> Homo sapiens <400> 75 atgacagtca aacaagagtc ggccaattca acattcaatg ccctcgatat cgcgtttggt 60 gaaaatgacg cgtcactttc aaaagcaacc atggctccat ccatgattc tagaaaacaa 120 tccaaatcat ctactggtaa acgaaaatat catcaaaaat ccagaaatgg gtgttcaacc 180 tgtaaaagaa gacgtgtcaa atgtgatgaa caaaaacctg tatgtggaaa ctgtaccaag 240 ttaaaactcg actgtggtta tcttcatgtt acagcagatg atattgaagc taacaaaaaa 300 tcagaagcta atggcccaca accaaagaag agaaagagaa aatcatccct gagtcttgat 360 ttacctatga gtggaacaac aacacaacaa gcaaccccat ctatgacacc aagtccagaa 420 gctaccgcca ctacaaatgc tgccaagatg aatatccctt ctttaccaca attaaaccca 480 ttaaatgcat tgtcttcagg acttttaagt gcagggaatt tgaacaattt gaatattgct 540 catttggtga ataatctttc aggtttaggg gatttaagta atctcacaag tctcggtaat 600 ttagcaagtc tatcgaattt ggcaacgttg gctcaattac caatagattt gagtaatttg 660 ggtgctttgt tggatcctct gatggcaaac aatcttgctg caactgcctt gggaggaaat 720 acccctacat ccattccaac gaatatcaac gctcaacaaa atggatttga ttcaagaaaa 780 tcactggcag tatctgattt gcaacaatct tcaattcaac aacaacaaca acaatctcag 840 atgccgctcc caccgcaaca gcaacagcaa gccccatctc aaccacaagc acaagcgcaa 900 gcacaatcac aagcacaatc gcaaccacgt ccacaacagc aacagcaacc accaccacag 960 tcacagcaac aatcaccgac aatgcaatg ggcaatagcc ccattcaca tcaccttcaa 1020 ccaacattgg cttcacagct ggatttgccg ggaatgact atccaggattg tactccagt 1080 acgaccacaca gaaatcctt tgcacagca gcttcaactt cttcaactaa caatattgga 1140 actatgccta catcatctgc tgatgtact gctggaacct cagcgaatc tatacctaat 1200 atttcaccga atactacaca ttctacaat ccattgaaca atcctctttc acaaggaatg 1260 caacaagtc ttaatatgct tgatttgaa ttaatgttcc attacktactc acaggttgcg 1320 atactatca ccggtgctgg tattcggag actacatct ggaaccatga tattccatta 1380 ttagccttg aacacccctt tttaatgcat tcaatattag ccttagtgc tactcacttg 1440 tcaagaactg aaaaggggtt agatcaatgt gttactccc atcgtgtga tgccttgcga 1500 ttattgcgtg aggcggtatt gatatcaat gcggataca cggacgcatt agttgctagt 1560 gcattgatct taattatgga ttcattggca aatgcatctt tccctcgtc aacatctcct 1620 aaatctttac ctgcttctgc atggattc catgttaaag gtgcagccac tattttgact 1680 gccgtatggc cattaaccga agcatccaga ttctataagt tcatttcagt tgatttggga 1740 gatttaggag atataatcaa ccaaggagtc aattcaaata aaccaaaggg tattgatcgt 1800 gaaggagctt cttattacac agatttggaa tgtcacgatg ctgatattgc tgatttatat 1860 ccggttaaga ttgattctcc ttatttaatc accctcgcct atttgaataa attacacaag 1920 gaaagataca agtctgactt tatattacga atctttgcct ttccagcact tttggacaaa 1980 cagttatgg cattattaat gtctggggac gtcaaggcta tgagaatcat gagaagctat 2040 tacaagttgt tgcgttcttt cactactgaa atgaaggata aagtctggtt tttggaagga 2100 gttcgctgg tattaccagt taatgttgaa gaatatgctg gtggagctgg aggtatgcac 2160 atgatgatgg atttccttgg tggagggcca gcgattattg atgatcatga aattgataaa 2220 gaaatgacga aattcgatcc aaatggatca cttactaata attaattga tacgaataat 2280 ttacctagtg atataacaag caatttagat atcatgcaag gagatacggg gttcatgaac 2340 ttgaaatag 2349 <210> 76 <211> 3453 <212> DNA <213> Homo sapiens <400> 76 atgtcatttt taccacccaa ataccagct agtttcatcc atgaatcaat gcaaatcat 60 ggaggtgcta accaaagg aaataatacc ataatggtc atcaggaga tcaaaaaag 120 aaaaaaaaaaaaagttc agtttgtact aactgtagaa gacgtaagat aaatgtaat 180 agggaatatc catgttcaaa ttgtgttaaa gctaaacgtc aaacaagttg tgtttatgat 240 gatgggatta ttcatactgc tactact aatgctagta gtacaatga gaatagaat 300 aaaatgtctt caatacctga gatagttca aattattatt tgtctgtgt tagaactcca 360 attaagttg attagttgt gactcaat tcatcagtga actatgata tattcaa 420 aagaatcaa aaactagttc tattcaagt ctgattagta atggttcaa tattaatgga 480 540 attgaatcta gatttaatgg tgaacaact cctattccat tagtagctcc tccatcaca 600 acaaatatt ccaataatgg taataattt ttaccaccac ctgttaaatt caatagttta 660 agtccacaaa ataaacctga atcacttag ttcaccac cttgtccaac tcctcctagt 720 accataccctc atcgtccacc accttcaatg atagatttc aaacaactta taatgtatca 780 catactagag ggaccccatc tcctggtatt cattacccc cattaatgt agagaacaa 840 gataacagaa ataataca tatgattcca acaatgtttt catatagttc agtatccaat 900 aattctgatc catatttca aactccggat tcatcagtttt ccaatagtc tcctcataat 960 agtattagtt ctgttcgcac agacacgac atacattaa ttggagttaa tccatatttg 1020 gatgaaaatg aaacattaa tttttgaa ggatatactt caatttgtat whaagattat 1080 cgaagaatca atcatggtcc atttgcctgg agttccttaa tgaaaagga taaagcgttg 1140 agtttgttat ggttacatat ttgtaattg aagaggaaa agtcaca aaatttcata 1200 tttggactgt ctgttagtga aattaatcaa gaaatacgt cattagtaac atccgaatca 1260 aatgaaagtg aagttaattt taaaaagaag actttagaaa gttttggata whaagattatt 1320 gttccatatg atgtgttgaa gaaaaaactc aagaaagaat taaatcaagt ttcattaccc 1380 ttgggattaa ctttatatga agaacaagtt aatgctgaat tacaattagt tgatagaatt 1440 catcagttat tacctaaaca aaaagttat tggaaatctt tggatagatt tttctcttta 1500 ctttatccat tcatgccatt tattgatgaa tatgatttca ctgattcaat aagtaaaata 1560 attggatcca aaaattataa agatgaaaag attaaagaaa ttaaagttga aaaacgatta 1620 gatttggcat atttgggatt attattgatt gttttaagat taagttatt atcattattt 1680 tcaaataaag aaagtgttaa tgaaatgaga ctcaattcaa ctgatcctt agaagaagca 1740 caagatttga agtatttaat tcaaaatcca attggtattt catttattga tactgctcat 1800 ttatgtttaa atcaatttga tattttccga aaagctgcaa tgtcagtatt gcaacttgca 1860 ttttatttac aattatacca tgtgtttgca cctgaggatg gagatgacgg agatggagca 1920 gatacttatg ctttaaatgc aatgattgta caaatggcgt attcacttgg gttaaacaga 1980 gatccagata atttccccga tgtcttaaat aataaaacgag aaaataatat gggaagaaag 2040 atttggcatt ttatgatttt aacagatatt catcattctt atagttttgg taatccaaga 2100 actatatgtg atcaatattt tgatacaaaa ttaccctttg ttgaagaagg agctgaaaat 2160 ttacgtgaca agaaattgga taattttgtc actctgaatt tccctggcta tttgccagtt 2220 tatgatattt taagtgatat tttgaaatta attcttaatg tatcagggaa agttaaaatg 2280 tcacaattat gtaaattatt aagtgaattt gaaaccagta tttatgaaaa atatggtact 2340 ttatcagatt gtttgaatcc aaagaattgt tcatttaatc atatttatgc tagaaatatg 2400 ccagttaaat tatatatttc tttaaaatca tttttggttt ctgtttattt ccatattttc 2460 ttgtattatg aaaagaaaga tttgaaattg tcatattttt atttgaagaa aatcattcaa 2520 attgctgcta ctgatatcat gcctcattat tttgaattat taggtaatag tgaagttgta 2580 tgtgatatgg ttaaatcc aaaattgatt caaattattc ataaattaat ccaggttaat 2640 ttagcattaa tattgagagt taatttttca attattatt ttaaaaatca agaagatcat 2700 ggatttaaat gttctaatga tgaaaaatat tattcatatt ataaagaatt atgtaaattt 2760 tcatcaggtt taacaagatg tgcggaagtt ggggtagcag cggtttcaaa attaagtaca 2820 agatattatt atgcatggaa agtaaccaaa gcaaatatt atttattgaa aaagataaca 2880 actatggaat tttatgataa agaatctaaa atgagtaata aattaatgtt accaaattat 2940 tcaattgaag aaattcaaga attaggatta atgtcagaaa ttgcattatc aaaattaggt 3000 aaaactaaag ttatgggtga tgaatttgt actacttgta cttataaaaa tttcaaatct 3060 gatatgcta cgacatcatc tgaaacaaat caaactccaa atactgccac caccatgaat 3120 agcaccacca ccaacaataa tataataac atcagtagta ctaattcaaa ttctatgaca 3180 agtatttctg atacgagaaa atacactaat gaatttgggc tagattttgt tataatgaa 3240 gatattgata agatttggtt acaaatgatt accgatcaac aaaaaaca aaaacaaaat 3300 gaacctaata cacctaattt ttcaatgatg aattctccat atggtaatat tgctacccca 3360 ggtaacaatg gtggatttaa taatgacata tttgatccta attcatttga tattttagtc 3420 gatattgatc gtttattaaa caatgatgga taa 3453 <210> 77 <211> 1179 <212> DNA <213> Homo sapiens <400> 77 atggatatcg ttcttgaaat ttgtgactac tttcttttg ataaagtcta tagtaaagtt 60 ttccctaaaa acggagcagc tcatgaattt gttaaaaatt caccaattat tcaatcatta 120 tccaatattc aactcccaaa agctgaaatt ttagattcat tttctacaaa ttcaactatc 180 ttatcatctt catcaacttc aaatttctcc cttgcaaatg taaatccagc taatatccca 240 aattattat taaaaaaat tgcaaattat caagaataaat cagaaatcta cggtttagct 300 cctacttttt tgcctgctgg tgattatttc gatagttcat tcttagcaag atctaatatt 360 ttcagggaat tcttatccct tttcatagtt actactattt ttggttgggt tttatatttc 420 cttgttgcta ctttatctta tatgtttgtt tttgatagaa atattttcaa tcatccaaga 480 tatttgaaaa atcaaatgtc tttggaaatc ggtttggcaa ctagagccat tccagttatg 540 gttttattaa cttgtccttt ctttatgatg gaattgcatg gtttttcatt cctttactac 600 aatattgatg aatctactgg tggttataag gcacttttat ggcaatttcc taaatttatt 660 ttattactg attgtggtat ttattcctt cacagatggt tacattggcc aagtgtttat 720 aaagctttac ataaaccaca tcataaatgg attgtttgta ctccttttgc atcccatgct 780 ttccatccag ttgatggtttt tttccaatct ttaccatatc atacttatcc attatttttc 840 ccattacata aagttttata cttgtttttg ttcactttg tcaatttctg gactgttatg 900 attcatgatg gtaattattg gtcaaatgat ccagttgtca atggtactgc ttgtcatact 960 gttcatcatt tatatttcaa ctataactat ggtcaattca ccactttgtg ggacagatta 1020 ggtagatctt acagaagacc agatgattct ttgtttgtta gacaacaacc aaaagaaatt 1080 gaaaagaaag tttggaagca acaaactaaa gaaatggaag aaattagagg tgaacttgaa 1140 ggtaaagttg atgacagaga atatgtctct gaagaatag 1179

Claims

1. A method for detecting drug-resistant genes of Candida tropicalis based on nucleic acid mass spectrometry for non-diagnostic and non-therapeutic purposes, characterized in that The steps include: 1) Identification of seven drug resistance genes of Candida tropicalis ERG11 , FKS1 , MDR1 , TAC1 , UPC2 , MRR1 , ERG3 and its SNP site; ERG11 The gene sequence is shown in SEQ ID NO.71; FKS1 The gene sequence is shown in SEQ ID NO.72; MDR1 The gene sequence is as SEQ ID NO.73; TAC1 The gene sequence is shown in SEQ ID NO.74; UPC2 The gene sequence is shown in SEQ ID NO.75; MRR1 The gene sequence is shown in SEQ ID NO.76; ERG3 The gene sequence is shown in SEQ ID NO.77; 2) Based on the reference strain sequences of the above seven drug-resistant genes, multiple PCR primers and MPE primers were designed for the SNP sites; the above seven drug-resistant genes ERG11 , FKS1 , MDR1 , TAC1 , UPC2 , MRR1 , ERG3 The 38 SNP sites are as follows: ； The multiplex PCR primers are 15 pairs, and their primer sequences are shown in SEQ ID NO.1 to SEQ ID NO.30; the MPE primers are 40 pairs, and their sequences are shown in SEQ ID NO.31 to 70; 3) Extraction of C. tropicalis DNA and multiplex PCR amplification, SAP digestion followed by mass probe extension reaction and resin desalting; 4) The mass spectrometer uses the difference in the mass-to-charge ratio of nucleic acid fragments as the result detection signal to quickly determine whether the resistance gene sequence of Candida tropicalis has mutated.

2. The method for detecting drug-resistant genes of Candida tropicalis based on nucleic acid mass spectrometry for non-diagnostic and non-therapeutic purposes according to claim 1, characterized in that: The drug-resistance gene SNP sites included in the screening include confirmed sites with a clear causal relationship with drug resistance and related sites whose causal relationship has not yet been confirmed.

3. The method for detecting drug-resistant genes of Candida tropicalis based on nucleic acid mass spectrometry for non-diagnostic and non-therapeutic purposes according to claim 1, characterized in that: The multiplex PCR primers and MPE primers are artificially designed, and their sequences do not belong to any known nucleic acid primer sequences, and there is no mutual interference between the two primers.

4. The method for detecting drug-resistant genes of Candida tropicalis based on nucleic acid mass spectrometry for non-diagnostic and non-therapeutic purposes according to claim 1, characterized in that: The multiple PCR primers effectively complete the amplification of all gene sequences under the same reaction temperature and time program.

5. The method for detecting drug-resistant genes of Candida tropicalis based on nucleic acid mass spectrometry for non-diagnostic and non-therapeutic purposes according to claim 1, characterized in that: The concentration and purity requirements of the extracted DNA are relatively low, with a concentration greater than 0.1 ng / ul, a purity 260 / 280 of 1.6-2.0, and 260 / 230 greater than 1, which meets the subsequent detection requirements.

Images