A method for preparing RNA, a method for synthesizing protein, and a transcription reaction solution

Abstract

This application relates to the field of genetic engineering technology. Specifically, it relates to a method for preparing RNA, a method for synthesizing proteins, and a transcription reaction solution. The method for preparing RNA includes mixing raw materials and then performing a transcription reaction; the raw materials include a DNA template, RNA polymerase, NTPs, a buffer solution containing magnesium ions, and a nucleic acid denaturant; the nucleic acid denaturant includes an organic solvent. By adding a nucleic acid denaturant to the system before in vitro transcription reaction, this application effectively inhibits the generation of dsRNA from the synthesis end of RNA prepared by transcription, significantly improves the purity of ssRNA in the system after in vitro transcription, thereby improving the in vivo stability and translation efficiency of ssRNA and reducing the immunogenicity of ssRNA, and the operation is simple.

Description

[0001] This application is a divisional application. The filing date of the original application is: July 27, 2021; the application number of the original application is: 202110848977.9, and the invention title of the original application is: A method for preparing RNA, a method for synthesizing proteins, and a transcription reaction solution. Technical Field

[0002] This application relates to the field of genetic engineering technology. Specifically, it relates to a method for preparing RNA, a method for synthesizing proteins, and a transcription reaction solution. Background Art

[0003] Currently, the system after in vitro transcription (IVT) reaction contains a certain amount of dsRNA. dsRNA can stimulate the body's own defense mechanism, cause inflammatory reactions, and reduce the effectiveness of ssRNA as a drug, etc. The removal of dsRNA in the system after IVT reaction is usually purified by methods such as LiCl precipitation or alcohol precipitation, ion exchange chromatography column, silica gel column, etc. However, the above methods generally have disadvantages such as low yield of purified ssRNA, easy degradation of ssRNA, and complex purification steps. Summary of the Invention

[0004] The purpose of the embodiments of this application is to provide a method for preparing RNA, a method for synthesizing proteins, and a transcription reaction solution, aiming to improve the problem of low purity of ssRNA caused by the presence of a certain amount of dsRNA in the system after the existing in vitro transcription reaction.

[0005] The first aspect of this application provides a method for preparing RNA. The method for preparing RNA includes: mixing raw materials and then performing a transcription reaction.

[0006] The raw materials include a DNA template, RNA polymerase, NTPs, a buffer solution containing magnesium ions, and a nucleic acid denaturant; the nucleic acid denaturant includes at least one of organic solvents, sugars, sugar alcohols, alkaloids, and protein denaturants.

[0007] By adding a nucleic acid denaturant to the system before the in vitro transcription reaction, this application effectively inhibits the generation of dsRNA from the synthesis end of RNA transcription, significantly improves the purity of ssRNA in the system after in vitro transcription, thereby improving the in vivo stability and translation efficiency of ssRNA and reducing the immunogenicity of ssRNA, and the operation is simple.

[0008] The second aspect of this application provides a method for synthesizing proteins. The method for synthesizing proteins includes: preparing RNA by using the method for preparing RNA provided in the first aspect above; and then synthesizing proteins using RNA as a template.

[0009] Optionally, the protein is a protein for therapeutic use or a protein for vaccine use.

[0010] Synthesize proteins using the RNA prepared directly by the method for preparing RNA provided in the first aspect of the present application as a template. Since the method for preparing RNA provided in the first aspect of the present application effectively inhibits the generation of dsRNA, the purity of ssRNA in the prepared RNA is relatively high, which is beneficial to improving the protein translation efficiency.

[0011] The third aspect of the present application provides a transcription reaction solution, which includes a DNA template, an RNA polymerase, NTPs, a buffer containing magnesium ions, and a nucleic acid denaturant; the nucleic acid denaturant includes at least one of an organic solvent, a sugar, a sugar alcohol, an alkaloid, and a protein denaturant.

[0012] Optionally, the organic solvent includes at least one of methanol, ethanol, propanol, isopropanol, pentanol, polyethylene glycol, formamide, 1,2,3,4,5-pentapentol, 1,2,3,4,5,6-hexapentol, prop-2-en-1-ol, 3,7-dimethylhept-2,6-dien-1-ol, 2-propyn-1-ol, cyclohexane-1,2,3,4,5,6-hexol, 2-(2-propyl)-5-methyl-cyclohexan-1-ol, dimethyl sulfoxide, methyl sec-butyl sulfoxide, n-propyl sulfoxide, n-butyl sulfoxide, tetramethylene sulfoxide, triethanolamine, and ethylene glycol.

[0013] Optionally, the sugar includes at least one of trehalose and mannose.

[0014] Optionally, the sugar alcohol includes at least one of sorbitol and xylitol.

[0015] Optionally, the alkaloid includes betaine.

[0016] Optionally, the protein denaturant includes at least one of urea, guanidine hydrochloride, guanidine isothiocyanate, phenol, sulfite, and thiosulfate.

[0017] Optionally, the volume percentage of the organic solvent in the total volume of the transcription reaction solution is 0.1-70.0%.

[0018] Optionally, the nucleic acid denaturant includes at least one of trehalose with a final molar concentration of 1.0 mM-10.0 M, betaine with a final molar concentration of 1.0 mM-10.0 M, urea with a final molar concentration of 1.0 mM-10.0 M, guanidine isothiocyanate with a final molar concentration of 1.0 mM-10.0 M, guanidine hydrochloride with a final molar concentration of 1.0 mM-10.0 M, sorbitol with a final molar concentration of 1.0 mM-10.0 M, xylitol with a final molar concentration of 1.0 mM-10.0 M, and mannose with a final molar concentration of 1.0 mM-10.0 M; wherein, the final molar concentration is the ratio of the amount of substance of the solute to the total volume of the transcription reaction solution.

[0019] Optionally, the nucleic acid denaturant includes ethanol and urea; the percentage of ethanol in the total volume of the transcription reaction solution is 1.5-15.0%; the final concentration of urea in the transcription reaction solution is 40.0 mM-1.2 M.

[0020] Optionally, the nucleic acid denaturant includes ethanol, formamide and trehalose; the percentages of ethanol and formamide in the total volume of the transcription reaction solution are both 0.5-5.0%; the final concentration of trehalose in the transcription reaction solution is 5.0 mM-0.5 M.

[0021] By adding a nucleic acid denaturant to the transcription reaction solution, the present application effectively inhibits the generation of dsRNA from the RNA synthesis end of transcription preparation, significantly improves the purity of ssRNA in the in vitro transcription system, thereby improving the in vivo stability and translation efficiency of ssRNA and reducing the immunogenicity of ssRNA, and the operation is simple. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the following will briefly introduce the drawings required to be used in the embodiments. It should be understood that the following drawings only show some embodiments of the present application, and therefore should not be regarded as limiting the scope. For those of ordinary skill in the art, other related drawings can be obtained based on these drawings without creative efforts.

[0023] Figure 1 Shows the dsRNA content diagrams after the IVT reactions provided in Examples 51-56 and Comparative Example 1 of the present application.

[0024] Figure 2 Shows the dsRNA content diagrams after the IVT reactions provided in Examples 57-59 and Comparative Example 1 of the present application.

[0025] Figure 3 Shows the IFNα content diagrams in mice after the IVT reactions provided in Examples 51-56 and Comparative Example 1 of the present application.

[0026] Figure 4 Shows the EPO content diagrams in mice after the IVT reactions provided in Examples 56, 59 and Comparative Example 1 of the present application. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0027] To make the objectives, technical solutions and advantages of the embodiments of the present application clearer, the technical solutions in the embodiments of the present application will be clearly and completely described below. Those not specified in the embodiments are carried out according to conventional conditions or conditions recommended by the manufacturer. Those reagents or instruments not specified by the manufacturer can be obtained as conventional products through commercial purchase.

[0028] The preparation method of RNA, the method for synthesizing proteins, and the transcription reaction solution provided by the embodiments of the present invention will be specifically described below.

[0029] In the present application, the unit "M" refers to mol / L; "mM" refers to mmol / L; ssRNA (single-stranded RNA) refers to single-stranded ribonucleic acid, and dsRNA (double-stranded RNA) refers to double-stranded ribonucleic acid; IVT (In Vitro Transcription) refers to in vitro transcription; NTPs (Nucleoside triphosphates) refers to nucleoside triphosphates. A protein denaturant refers to a substance that can cause protein denaturation.

[0030] The present application provides a method for preparing RNA, which includes mixing raw materials and then performing a transcription reaction.

[0031] The raw materials include a DNA template, an RNA polymerase, NTPs, a buffer solution containing magnesium ions, and a nucleic acid denaturant; the nucleic acid denaturant includes at least one of an organic solvent, a sugar, a sugar alcohol, an alkaloid, and a protein denaturant.

[0032] In the present application, the magnesium ions in the buffer solution containing magnesium ions bind to NTPs and the DNA template to form a complex so that the promoter in the DNA template can be recognized by the RNA polymerase. Using the template strand in the DNA template as a template and NTPs as raw materials, IVT is performed under the catalysis of the RNA polymerase to synthesize RNA.

[0033] By adding a nucleic acid denaturant to the system before the IVT reaction, the generation of dsRNA can be effectively inhibited from the synthesis end of the transcribed RNA, and the purity of ssRNA in the system after in vitro transcription can be significantly improved, thereby improving the in vivo stability, translation efficiency of ssRNA, and reducing the immunogenicity of ssRNA. The operation is simple.

[0034] In some embodiments of the present application, the organic solvent includes at least one of methanol, ethanol, propanol, isopropanol, pentanol, polyethylene glycol, formamide, 1,2,3,4,5-pentapentol, 1,2,3,4,5,6-hexapentol, prop-2-en-1-ol, 3,7-dimethylhepta-2,6-dien-1-ol, 2-propyn-1-ol, cyclohexane-1,2,3,4,5,6-hexol, 2-(2-propyl)-5-methyl-cyclohexan-1-ol, dimethyl sulfoxide, methyl sec-butyl sulfoxide, n-propyl sulfoxide, n-butyl sulfoxide, tetramethylene sulfoxide, triethanolamine, and ethylene glycol. The above organic solvents can effectively inhibit the generation of dsRNA from the RNA synthesis end during transcription preparation, thereby significantly improving the purity of ssRNA in the in vitro transcription system. It can be understood that in other embodiments of the present application, the organic solvent may not be limited to the above solvents.

[0035] Furthermore, the organic solvent includes at least one of ethanol, formamide, and dimethyl sulfoxide. Ethanol, formamide, or dimethyl sulfoxide, as a nucleic acid denaturant, is added to the reaction system before the IVT reaction, which can effectively inhibit the generation of dsRNA (the content of dsRNA in the post-transcription system is reduced to less than 1.0%), thereby significantly improving the purity of ssRNA in the in vitro transcription system. In some embodiments, the organic solvent includes ethanol and formamide. Ethanol and formamide cooperate with each other, which can effectively inhibit the generation of dsRNA (the content of dsRNA in the post-transcription system is reduced to less than 0.5%), and significantly improve the purity of ssRNA in the in vitro transcription system.

[0036] In this embodiment, the sugar includes at least one of trehalose and mannose; the sugar alcohol includes at least one of sorbitol and xylitol; the alkaloid includes betaine; the protein denaturant includes at least one of urea, guanidine hydrochloride, guanidine isothiocyanate, phenol, sulfite, and thiosulfate. The above substances can effectively inhibit the generation of dsRNA from the RNA synthesis end during transcription preparation, thereby significantly improving the purity of ssRNA in the in vitro transcription system.

[0037] In some embodiments of the present application, the nucleic acid denaturant includes at least one of trehalose, betaine, urea, guanidine isothiocyanate, guanidine hydrochloride, sorbitol, xylitol, and mannose.

[0038] Furthermore, the nucleic acid denaturant includes at least one of trehalose, betaine, urea, and guanidine isothiocyanate. The above substances can effectively inhibit the generation of dsRNA from the RNA synthesis end during transcription preparation (the content of dsRNA in the post-transcription system is reduced to less than 1.0%), thereby significantly improving the purity of ssRNA in the in vitro transcription system. It can be understood that in other embodiments of the present application, the nucleic acid denaturant may not be limited to the above substances.

[0039] Furthermore, the nucleic acid denaturant includes trehalose and urea. Trehalose and urea cooperate with each other to effectively inhibit the generation of dsRNA (the content of dsRNA in the post-transcriptional system is reduced to less than 0.2%), thereby significantly improving the purity of ssRNA in the post-transcriptional system in vitro.

[0040] In some embodiments of the present application, the nucleic acid denaturant includes at least one of trehalose with a final molar concentration of 1.0 mM - 10.0 M, betaine with a final molar concentration of 1.0 mM - 10.0 M, urea with a final molar concentration of 1.0 mM - 10.0 M, guanidine isothiocyanate with a final molar concentration of 1.0 mM - 10.0 M, guanidine hydrochloride with a final molar concentration of 1.0 mM - 10.0 M, sorbitol with a final molar concentration of 1.0 mM - 10.0 M, xylitol with a final molar concentration of 1.0 mM - 10.0 M, and mannose with a final molar concentration of 1.0 mM - 10.0 M; wherein, the final molar concentration is the ratio of the amount of substance of the solute to the total volume of the raw materials. Exemplarily, the nucleic acid denaturant includes trehalose, and the final molar concentration of trehalose in the system after mixing the raw materials can be 1.0 mM, 2.5 mM, 5.0 mM, 25.0 mM, 40.0 mM, 0.25 M, 0.5 M, 1.2 M, 2.5 M, 4.0 M, and 10.0 M, etc. The above final molar concentration can further inhibit the generation of dsRNA and improve the purity of ssRNA in the post-transcriptional system in vitro.

[0041] Furthermore, the nucleic acid denaturant includes at least one of trehalose with a final molar concentration of 2.5 mM - 4.0 M, betaine with a final molar concentration of 2.5 mM - 4.0 M, urea with a final molar concentration of 2.5 mM - 4.0 M, guanidine isothiocyanate with a final molar concentration of 2.5 mM - 4.0 M, guanidine hydrochloride with a final molar concentration of 2.5 mM - 4.0 M, sorbitol with a final molar concentration of 2.5 mM - 4.0 M, xylitol with a final molar concentration of 2.5 mM - 4.0 M, and mannose with a final molar concentration of 2.5 mM - 4.0 M. Furthermore, the nucleic acid denaturant includes at least one of trehalose with a final molar concentration of 0.5 M - 1.2 M, betaine with a final molar concentration of 0.5 M - 1.2 M, urea with a final molar concentration of 0.5 M - 1.2 M, guanidine isothiocyanate with a final molar concentration of 0.5 M - 1.2 M, guanidine hydrochloride with a final molar concentration of 0.5 M - 1.2 M, sorbitol with a final molar concentration of 0.5 M - 1.2 M, xylitol with a final molar concentration of 0.5 M - 1.2 M, and mannose with a final molar concentration of 0.5 M - 1.2 M.

[0042] Exemplarily, the nucleic acid denaturant includes at least one of trehalose with a final molar concentration of 5.0 mM - 0.5 M, guanidine isothiocyanate with a final molar concentration of 5.0 mM - 0.5 M, sorbitol with a final molar concentration of 5.0 mM - 0.5 M, and xylitol with a final molar concentration of 5.0 mM - 0.5 M. Alternatively, the nucleic acid denaturant includes mannose with a final molar concentration of 2.5 mM - 0.25 M. Alternatively, the nucleic acid denaturant includes betaine with a final molar concentration of 25.0 mM - 2.5 M. Alternatively, the nucleic acid denaturant includes urea with a final molar concentration of 40.0 mM - 4.0 M.

[0043] In some embodiments of the present application, the percentage of the organic solvent in the total volume of the raw materials is 0.1 - 70.0%. Exemplarily, the percentage of the organic solvent in the total volume of the raw materials can be 0.1%, 0.5%, 1.5%, 5.0%, 10.0%, 15.0%, 30.0%, 50.0%, 70.0%, etc. The above volume percentage of the organic solvent can further inhibit the generation of dsRNA and improve the purity of ssRNA in the system after in vitro transcription. It should be noted that in other embodiments of the present application, the percentage of the organic solvent in the total volume of the raw materials may not be limited to the above volume percentage.

[0044] Furthermore, the percentage of the organic solvent in the total volume of the raw materials is 0.5 - 50.0%. Furthermore, the percentage of the organic solvent in the total volume of the raw materials is 10.0 - 15.0%.

[0045] In the present application, the nucleic acid denaturant may include only one of an organic solvent, a sugar, a sugar alcohol, an alkaloid, and a protein denaturant, may include several of an organic solvent, a sugar, a sugar alcohol, an alkaloid, and a protein denaturant; or may also include an organic solvent, a sugar, a sugar alcohol, an alkaloid, and a protein denaturant simultaneously.

[0046] In the present application, the nucleic acid denaturant may include only an organic solvent, may include at least one of trehalose, betaine, urea, guanidine isothiocyanate, guanidine hydrochloride, sorbitol, xylitol, and mannose, or may also include at least one of trehalose, betaine, urea, guanidine isothiocyanate, guanidine hydrochloride, sorbitol, xylitol, and mannose and an organic solvent simultaneously.

[0047] In some embodiments of the present application, the nucleic acid denaturant includes ethanol and urea; the percentage of ethanol in the total volume of the raw materials is 1.5 - 15.0%; the final molar concentration of urea in the system after mixing the raw materials is 40.0 mM - 1.2 M; wherein, the final molar concentration is the ratio of the amount of substance of the solute to the total volume of the raw materials. By way of example, the percentage of ethanol in the total volume of the raw materials can be 0.5%, 1.5%, 5.0%, 10.0%, 15.0%, etc.; the final molar concentration of urea in the system after mixing the raw materials can be 40.0 mM, 0.12 M, 0.4 M, 1.2 M, etc. Compared with ethanol or urea alone as the nucleic acid denaturant, ethanol and urea cooperate with each other to synergistically inhibit the generation of dsRNA, so that the content of dsRNA in the post-transcription system is as low as 0.02%, and thus significantly improve the purity of ssRNA in the in vitro transcription system to as high as 99.98%.

[0048] In some embodiments of the present application, the nucleic acid denaturant includes ethanol, formamide and trehalose; the percentages of ethanol and formamide in the total volume of the raw materials are both 0.5 - 5.0%; the final molar concentration of trehalose in the system after mixing the raw materials is 5.0 mM - 0.5 M; wherein, the final molar concentration is the ratio of the amount of substance of the solute to the total volume of the raw materials. By way of example, the percentage of ethanol in the total volume of the raw materials can be 0.5%, 1.5%, 3.5%, 4.0%, 5.0%, etc., and the percentage of formamide in the total volume of the raw materials can be 0.5%, 1.5%, 3.5%, 4.0%, 5.0%, etc.; the percentage of ethanol in the total volume of the raw materials and the percentage of formamide in the total volume of the raw materials can be the same or different. The final molar concentration of trehalose in the system after mixing the raw materials can be 5.0 mM, 15 mM, 30 mM, 50 mM, 0.1 M, 0.2 M, 0.5 M, etc. Compared with ethanol, formamide or trehalose alone as the nucleic acid denaturant, ethanol, formamide and trehalose cooperate with each other to synergistically inhibit the generation of dsRNA, so that the content of dsRNA in the post-transcription system is as low as 0.02%, and thus significantly improve the purity of ssRNA in the in vitro transcription system to as high as 99.98%.

[0049] The DNA template refers to a DNA sequence containing an RNA promoter, and its sources include but are not limited to PCR and plasmid DNA. By way of example, the DNA template can contain a T7 promoter (TAATACGACTCACTATAGGG) or an SP6 promoter (ATTTAGGTGACACTATAG). It should be noted that in other embodiments of the present application, the RNA promoter contained in the DNA template is not limited to the above promoters either.

[0050] In some embodiments of the present application, the final mass concentration of the DNA template in the system after raw materials are mixed is 1 - 500 ng / μL. Exemplarily, the final mass concentration of the DNA template in the system after raw materials are mixed can be 1 ng / μL, 5 ng / μL, 25 ng / μL, 50 ng / μL, 100 ng / μL, 200 ng / μL, 500 ng / μL, and so on.

[0051] The RNA polymerase can be a natural or non-natural RNA polymerase. Exemplarily, the RNA polymerase can be T7 RNA polymerase, T3 RNA polymerase, or SP6 RNA polymerase. It should be noted that in other embodiments of the present application, the RNA polymerase is not limited to the above-mentioned RNA polymerases.

[0052] In some embodiments of the present application, the RNA polymerase is T7 RNA polymerase, and the final concentration of T7 RNA polymerase in the system after raw materials are mixed is 0.5 - 50 U / μL. Exemplarily, the final concentration of T7 RNA polymerase in the system after raw materials are mixed can be 0.5 U / μL, 2.5 U / μL, 10 U / μL, 20 U / μL, 40 U / μL, 50 U / μL, and so on.

[0053] NTPs are nucleoside triphosphates, and NTPs can be natural or non-natural nucleoside triphosphates. In this embodiment, NTPs can include ATP (adenosine triphosphate), CTP (cytidine triphosphate), GTP (guanosine triphosphate), UTP (uridine triphosphate), and so on. It should be noted that in other embodiments of the present application, NTPs are not limited to the above-mentioned nucleoside triphosphates.

[0054] In some embodiments of the present application, the final concentrations of ATP, CTP, GTP, and UTP in the system after raw materials are mixed are each independently 0.5 - 20 mM. Exemplarily, the final concentration of ATP, CTP, GTP, or UTP in the system after raw materials are mixed can be 0.5 mM, 1 mM, 5 mM, 8 mM, 10 mM, 16 mM, 20 mM, and so on.

[0055] The buffer containing magnesium ions is a key factor in maintaining the pH value stability in the RNA synthesis system. In this embodiment, the buffer containing magnesium ions can include MgCl2, Tris-HCl (tris(hydroxymethyl)aminomethane hydrochloride), spermidine, and DTT (dithiothreitol). It should be noted that in the embodiments of the present application, the substances in the buffer containing magnesium ions are not limited to the above-mentioned substances.

[0056] In some embodiments of the present application, the final concentration of MgCl2 in the system after raw material mixing is 2-70 mM. Exemplarily, the final concentration of MgCl2 in the system after raw material mixing can be 2 mM, 5 mM, 20 mM, 46 mM, 60 mM, 70 mM, and so on. In some embodiments of the present application, the pH of Tris-HCl is 6.0-9.0; Exemplarily, the pH of Tris-HCl can be 6.0, 7.2, 7.9, 8.3, 9.0, and so on. In some embodiments of the present application, the final concentration of Tris-HCl in the system after raw material mixing is 10-100 mM; Exemplarily, the final concentration of Tris-HCl in the system after raw material mixing can be 10 mM, 20 mM, 40 mM, 80 mM, 100 mM, and so on. In some embodiments of the present application, the final concentration of spermidine in the system after raw material mixing is 0.1-5 mM; Exemplarily, the final concentration of spermidine can be 0.1 mM, 0.5 mM, 2 mM, 5 mM, and so on. In some embodiments of the present application, the final concentration of DTT in the system after raw material mixing is 1-50 mM; Exemplarily, the final concentration of DTT in the system after raw material mixing can be 1 mM, 5 mM, 10 mM, 20 mM, 50 mM, and so on.

[0057] In this embodiment, the raw materials further include inorganic pyrophosphatase, nuclease inhibitor, and nuclease-free water. In some embodiments of the present application, the final concentration of inorganic pyrophosphatase in the system after raw material mixing is 0.0001-0.1 U / μL; Exemplarily, the final concentration of inorganic pyrophosphatase in the system after raw material mixing can be 0.0001 U / μL, 0.001 U / μL, 0.005 U / μ, 0.01 U / μL, 0.05 U / μL, 0.1 U / μL, and so on. In some embodiments of the present application, the final concentration of the nuclease inhibitor in the system after raw material mixing is 0.1-5 U / μL; Exemplarily, the final concentration of the nuclease inhibitor in the system after raw material mixing is 0.1 U / μL, 0.5 U / μ, 1 U / μL, 2 U / μL, 5 U / μL, and so on.

[0058] In this embodiment, the temperature of the transcription reaction is 20-60 °C, and the time of the transcription reaction is 15 min-10 h. Exemplarily, the temperature of the transcription reaction can be 20 °C, 25 °C, 37 °C, 50 °C, 60 °C, and so on; The time of the transcription reaction can be 15 min, 30 min, 2 h, 6 h, 10 h, and so on. The above transcription reaction temperature and transcription reaction time can keep the transcription reaction proceeding stably.

[0059] In this embodiment, after the transcription reaction, it further includes adding DNase I enzyme without RNase contamination (Deoxyribonuclease I, an endonuclease that can digest single-stranded or double-stranded DNA to produce monodeoxynucleotides or single-stranded or double-stranded oligodeoxynucleotides) to digest the original DNA template at 25-45°C for 5-60 minutes. Exemplarily, the temperature for digesting the original DNA template can be 25°C, 30°C, 37°C, 42°C, 45°C, etc.; the time for digesting the original DNA template can be 5 minutes, 10 minutes, 20 minutes, 25 minutes, 30 minutes, 40 minutes, 60 minutes, etc. The above temperature and time for digesting the original DNA template can well digest the original DNA template, which is beneficial to improving the purity of ssRNA in the system after in vitro transcription.

[0060] This application also provides a method for synthesizing proteins, including preparing RNA by using the above RNA preparation method; and then synthesizing proteins using the RNA as a template.

[0061] Directly using the RNA prepared by the RNA preparation method provided in the first aspect of this application as a template to synthesize proteins. Since the RNA preparation method provided in the first aspect of this application effectively inhibits the generation of dsRNA, the purity of ssRNA in the prepared RNA is relatively high, which is beneficial to improving the protein translation efficiency.

[0062] In some embodiments of this application, the synthesized proteins can be proteins for therapeutic use or proteins for vaccine use. Proteins for therapeutic use can treat gene-defective diseases or tissue repair through the expression of functional proteins, and proteins for vaccine use can be used for immunotherapy through the expression of antigens, antibodies or receptors.

[0063] This application also provides a transcription reaction solution, including a DNA template, an RNA polymerase, NTPs, a buffer containing magnesium ions, and a nucleic acid denaturant; the nucleic acid denaturant includes at least one of organic solvents, sugars, sugar alcohols, alkaloids, and protein denaturants.

[0064] In some embodiments of this application, the organic solvents include at least one of methanol, ethanol, propanol, isopropanol, pentanol, polyethylene glycol, formamide, 1,2,3,4,5-pentapentol, 1,2,3,4,5,6-hexahitol, prop-2-en-1-ol, 3,7-dimethylhept-2,6-dien-1-ol, 2-propyn-1-ol, cyclohexane-1,2,3,4,5,6-hexol, 2-(2-propyl)-5-methyl-cyclohexan-1-ol, dimethyl sulfoxide, methyl sec-butyl sulfoxide, n-propyl sulfoxide, n-butyl sulfoxide, tetramethylene sulfoxide, triethanolamine, and ethylene glycol.

[0065] In some embodiments of the present application, the sugar includes at least one of trehalose and mannose.

[0066] In some embodiments of the present application, the sugar alcohol includes at least one of sorbitol and xylitol.

[0067] In some embodiments of the present application, the alkaloid includes betaine.

[0068] In some embodiments of the present application, the protein denaturant includes at least one of urea, guanidine hydrochloride, guanidine isothiocyanate, phenol, sulfite, and thiosulfate.

[0069] In some embodiments of the present application, the percentage of the volume of the organic solvent in the total volume of the transcription reaction solution is 0.1-70.0%.

[0070] In some embodiments of the present application, the nucleic acid denaturant includes at least one of trehalose with a final molar concentration of 1.0 mM-10.0 M, betaine with a final molar concentration of 1.0 mM-10.0 M, urea with a final molar concentration of 1.0 mM-10.0 M, guanidine isothiocyanate with a final molar concentration of 1.0 mM-10.0 M, guanidine hydrochloride with a final molar concentration of 1.0 mM-10.0 M, sorbitol with a final molar concentration of 1.0 mM-10.0 M, xylitol with a final molar concentration of 1.0 mM-10.0 M, and mannose with a final molar concentration of 1.0 mM-10.0 M; wherein, the final molar concentration is the ratio of the amount of substance of the solute to the total volume of the transcription reaction solution.

[0071] In some embodiments of the present application, the nucleic acid denaturant includes ethanol and urea; the percentage of ethanol in the total volume of the transcription reaction solution is 1.5-15.0%; the final molar concentration of urea in the transcription reaction solution is 40.0 mM-1.2 M.

[0072] In some embodiments of the present application, the nucleic acid denaturant includes ethanol, formamide, and trehalose; the percentages of ethanol and formamide in the total volume of the transcription reaction solution are both 0.5-5.0%; the final molar concentration of trehalose in the transcription reaction solution is 5.0 mM-0.5 M.

[0073] The transcription reaction solution provided by the present application has at least the following advantages:

[0074] By adding a nucleic acid denaturant to the transcription reaction solution, the present application effectively inhibits the generation of dsRNA from the RNA synthesis end of the transcription preparation, significantly improves the purity of ssRNA in the system after in vitro transcription, thereby improving the in vivo stability, translation efficiency of ssRNA, and reducing the immunogenicity of ssRNA, and the operation is simple.

[0075] Example 1

[0076] This embodiment provides a transcription reaction solution and a method for preparing RNA.

[0077] Preparation of buffer solution (10X) containing magnesium ions: Mix Tris-HCl (pH = 7.9), MgCl2, spermidine, and DTT to obtain a buffer solution (10X) containing magnesium ions; wherein, the concentration of Tris-HCl is 400 mM, the concentration of MgCl2 is 460 mM, the concentration of spermidine is 20 mM, and the concentration of DTT is 100 mM.

[0078] Preparation of mixed enzymes: Mix T7 RNA polymerase, inorganic pyrophosphatase, and nuclease inhibitor to obtain a mixed enzyme system; wherein, the concentration of T7 RNA polymerase is 400 U / μL, the concentration of inorganic pyrophosphatase is 0.1 U / μL, and the concentration of nuclease inhibitor is 20 U / μL.

[0079] Preparation of transcription reaction solution: After mixing 2 μL of buffer solution (10X) containing magnesium ions, 1 μL of 200 mM ATP, 1 μL of 200 mM GTP, 1 μL of 200 mM CTP, 1 μL of 200 mM UTP, 1 μL of mixed enzymes, 1 μL of 1 μg / μL DNA template, and 0.1 μL of ethanol, add nuclease-free water to 20 μL to obtain the transcription reaction solution; wherein the DNA template is a DNA template for synthesizing erythropoietin (EPO, Erythropoietin (human)) mRNA, the above DNA template contains a T7 promoter, and the sequence of the above DNA template refers to Chromosome 7-NC_000007.14.

[0080] After the transcription reaction of the transcription reaction solution at 37°C for 2 h, add 1 μL of 1 U / μL DNase I enzyme and digest the original DNA template at 37°C for 30 min.

[0081] Examples 2-59 and Comparative Example 1

[0082] Examples 2-59 and Comparative Example 1 respectively provide a transcription reaction solution and a method for preparing RNA. Please refer to Example 1. Examples 2-56 and Comparative Example 1 are different from Example 1 in terms of nucleic acid denaturants, as shown in Table 1 in detail; Examples 57-59 are different from Example 1 in terms of nucleic acid denaturants, as shown in Table 2 in detail.

[0083] Table 1

[0084]

[0085]

[0086]

[0087] Table 2

[0088]

[0089] Note: The "nucleic acid denaturant without organic solvent" in Table 1 and Table 2 refers to the nucleic acid denaturant from which organic solvents are removed.

[0090] Comparative Example 2

[0091] Comparative Example 2 provided a transcription reaction solution and a method for preparing RNA, respectively. The difference between Comparative Example 2 and Example 1 is that the nucleic acid denaturant was not added to the transcription reaction solution. In Comparative Example 2, the nucleic acid denaturant was added to the system after adding DNase I enzyme to digest the original DNA template. Specifically as follows:

[0092] Preparation of buffer solution (10X) containing magnesium ions: Mix Tris-HCl (pH = 7.9), MgCl2, spermidine, and DTT to obtain a buffer solution (10X) containing magnesium ions; among them, the concentration of Tris-HCl is 400 mM, the concentration of MgCl2 is 460 mM, the concentration of spermidine is 20 mM, and the concentration of DTT is 100 mM.

[0093] Preparation of mixed enzyme: Mix T7 RNA polymerase, inorganic pyrophosphatase, and nuclease inhibitor to obtain a mixed enzyme system; among them, the concentration of T7 RNA polymerase is 400 U / μL, the concentration of inorganic pyrophosphatase is 0.1 U / μL, and the concentration of nuclease inhibitor is 20 U / μL.

[0094] Preparation of transcription reaction solution: After mixing 2 μL of buffer solution (10X) containing magnesium ions, 1 μL of 200 mM ATP, 1 μL of 200 mM GTP, 1 μL of 200 mM CTP, 1 μL of 200 mM UTP, 1 μL of mixed enzyme, and 1 μL of X DNA template, add nuclease-free water to 20 μL to obtain the transcription reaction solution; where the DNA template is the DNA template for synthesizing erythropoietin (EPO, erythropoietin (human)) mRNA, the above DNA template contains a T7 promoter, and the sequence of the above DNA template refers to Chromosome 7-NC_000007.14.

[0095] After the transcription reaction solution was transcribed at 37°C for 2 h, 1 μL of 1 U / μL DNase I enzyme was added to digest the original DNA template at 37°C for 30 min, and then 10.0 μL of ethanol was added to obtain the RNA product.

[0096] Comparative Examples 3 - 11

[0097] Comparative Examples 3-11 respectively provided a transcription reaction solution and a method for preparing RNA. The nucleic acid denaturant in Comparative Examples 3-11 was also added to the system after adding DNase I enzyme to digest the original DNA template. The difference between Comparative Examples 3-11 and Comparative Example 2 lies in the different nucleic acid denaturants, as shown in Table 3 for details.

[0098] Table 3

[0099]

[0100] Note: The "nucleic acid denaturant without organic solvent" in Table 3 refers to the nucleic acid denaturant after removing the organic solvent.

[0101] Test Example 1

[0102] The dsRNA content of the RNA obtained from the transcription reaction solutions and the RNA preparation methods provided in Examples 1-59 and Comparative Examples 1-11 was detected. The detection results are shown in Table 4. Among them, the detection method of dsRNA content used the sandwich ELISA (double antibody sandwich enzyme-linked immunosorbent assay) method; the detection method is as follows:

[0103] First, coat the microplate with antibody K1 (SCICONS, Budapest, Hungary), add dsRNA to form an antigen-antibody complex, then add detection antibody K2 (SCICONS, Budapest, Hungary), and then add TMB (3,3',5,5'-tetramethylbenzidine) chromogenic solution for color development. Incubate at room temperature for 20-30 min. When a blue gradient appears in the standard product, add the termination solution (0.16 M sulfuric acid) to terminate the reaction. Read the absorbance value with an enzyme-labeled instrument at a wavelength of 450 nm. According to the standard curve, the dsRNA concentration in the sample to be tested can be calculated. The dsRNA content (%) in the sample to be tested is the ratio of the dsRNA concentration in the sample to be tested to the total concentration of the RNA product in the sample to be tested.

[0104] Among them, the establishment of the standard curve: Use an enzyme-labeled instrument to measure the absorbance values of dsRNA standard samples Standard1-8 with different concentrations (ng / mL) at 450 nm, and establish a standard curve of the relationship between the concentration and the absorbance value (OD 450 )

[0105] Table 4

[0106]

[0107]

[0108] As can be seen from Table 4, the dsRNA content in Examples 1 - 59 was significantly lower than that in Comparative Example 1. By adding a nucleic acid denaturant to the system before the IVT reaction, the generation of dsRNA can be effectively inhibited.

[0109] In Comparative Examples 2 - 11, a nucleic acid denaturant was added to the system after the IVT reaction, and the dsRNA content could not be effectively reduced. That is, adding a nucleic acid denaturant to the system after the IVT reaction could not open the double - helix structure of dsRNA to denature it into ssRNA, and thus could not effectively reduce the dsRNA content in the system.

[0110] Furthermore, in Example 4 and Example 5, 3 μL or 10 μL of ethanol was separately added to the system before the IVT reaction, and the dsRNA contents were 0.9% and 0.8% respectively; in Example 44 and Example 45, 3 μL or 10 μL of 8 M urea was separately added to the system before the IVT reaction, and the dsRNA contents were 0.9% and 0.2% respectively; in Example 56, 3.0 μL of ethanol and 3.0 μL of 8 M urea were simultaneously added to the system before the IVT reaction, and the dsRNA content was only 0.02%. It can be seen that the dsRNA content after the transcription reaction with ethanol and urea simultaneously added to the system before the IVT reaction was significantly lower than that with ethanol or urea separately added to the system before the IVT reaction and then the transcription reaction was carried out. Therefore, ethanol and urea cooperate with each other to synergistically inhibit the generation of dsRNA.

[0111] Furthermore, in Example 3, 1.0 μL of ethanol was separately added to the system before the IVT reaction, and the dsRNA content was 1.1%; in Example 30, 10 μL of 1.0 M trehalose was separately added to the system before the IVT reaction, and the dsRNA content was 1.0%; in Example 48, 1.0 μL of formamide was separately added to the system before the IVT reaction, and the dsRNA content was 0.6%; in Example 59, 1.0 μL of formamide, 1.0 μL of ethanol and 10 μL of 1 M trehalose were simultaneously added to the system before the IVT reaction, and the dsRNA content was only 0.02%. It can be seen that the dsRNA content after the transcription reaction with formamide, ethanol and trehalose simultaneously added to the system before the IVT reaction was significantly lower than that with formamide, ethanol or trehalose separately added to the system before the IVT reaction and then the transcription reaction was carried out. Therefore, ethanol, formamide and trehalose cooperate with each other to synergistically inhibit the generation of dsRNA.

[0112] Test Example 2

[0113] The transcription reaction solutions provided in Examples 51 - 59 and Comparative Examples 1 - 11, and the RNAs obtained by the RNA preparation method were purified by HPLC (high performance liquid chromatography) to remove dsRNA. The dsRNA content of the RNAs obtained in Examples 51 - 59 and Comparative Examples 1 - 11 after HPLC purification was detected. The detection results are shown in Table 5, Figure 1 and Figure 2 as shown

[0114] Table 5

[0115]

[0116] It can be seen from Table 5 that in Example 56, 3.0 μL of ethanol and 3.0 μL of 8 M urea were added to the system before the IVT reaction. The dsRNA content before HPLC purification was 0.02%, and the dsRNA content after HPLC purification was also 0.02%. That is, without the purification step, the effect after HPLC purification can be achieved, and the operation is simple.

[0117] In Example 59, 1.0 μL of formamide, 1.0 μL of ethanol, and 10 μL of 1 M trehalose were added to the system before the IVT reaction. The dsRNA content before HPLC purification was 0.02%, and the dsRNA content after HPLC purification was also 0.02%. That is, without the purification step, the effect after HPLC purification can be achieved, and the operation is simple.

[0118] Test Example 3

[0119] The translation efficiency and immunogenicity of the RNAs after IVT in Examples 56, 59 and Comparative Example 1 were detected. The RNAs after IVT in Examples 56, 59 and Comparative Example 1 were respectively encapsulated by lipid nanoparticles (LNP), and then intraperitoneally injected into mice at a dose of 3 μg / animal (6 mice per group). Serum samples of mice were collected at 2 hours, 6 hours and 24 hours respectively, and the levels of interferon α (IFNα) and erythropoietin (EPO) in the mice were measured by ELISA (enzyme linked immunosorbent assay). The detection results are shown in Table 6, Table 7, Figure 3 and Figure 4 as shown

[0120] Table 6 Levels of IFNα in mice

[0121]

[0122] As can be seen from Table 6, the levels of IFNα in the mice of Example 56 and Example 59 are significantly lower than those in the mice of Comparative Example 1. Therefore, Example 56 and Example 59 can significantly reduce the immunogenicity caused by dsRNA as compared with Comparative Example 1.

[0123] Table 7 Levels of EPO in Mice

[0124]

[0125] As can be seen from Table 7, the levels of EPO in the mice of Example 56 and Example 59 are significantly higher than those in the mice of Comparative Example 1. Therefore, Example 56 and Example 59 can significantly improve the translation efficiency of mRNA and promote protein expression as compared with Comparative Example 1.

[0126] The above are only the preferred embodiments of the present application and are not intended to limit the present application. For those skilled in the art, various changes and modifications can be made to the present application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. A method for preparing RNA, characterized in that, Comprising: Mix the raw materials and then perform a transcription reaction; The composition of the raw materials is a DNA template, RNA polymerase, NTPs, a buffer containing magnesium ions, and a nucleic acid denaturant; the nucleic acid denaturant is one of ethanol, dimethyl sulfoxide, formamide, or a combination of urea and ethanol, or a combination of trehalose, formamide, and ethanol; When the nucleic acid denaturant is ethanol or dimethyl sulfoxide, or a combination of urea and ethanol, or a combination of trehalose, formamide, and ethanol, the percentage of any one of the ethanol, the dimethyl sulfoxide, or the formamide in the total volume of the raw materials is 0.5% - 50.0%; When the nucleic acid denaturant is formamide, the percentage of formamide in the total volume of the raw materials is 1.5% - 50.0%.

2. The preparation method of RNA according to claim 1, wherein, The percentage of any one of the ethanol, the dimethyl sulfoxide, or the formamide in the total volume of the raw materials is 10.0% - 15.0%.

3. A method for synthesizing proteins, characterized in that, Comprising: Prepare RNA by using the method for preparing RNA according to claim 1 or 2; then synthesize a protein by using the RNA as a template.

4. According to the method for synthesizing a protein as claimed in claim 3, the protein is a protein for therapeutic use or a protein for vaccine use.

Images