Novel polypeptide and method for producing L-leucine using the same

Abstract

The present invention relates to a novel mutant polypeptide having isopropylmalate synthase activity; and a method for producing L-leucine using the same. L-leucine can be produced in high yield by using the mutant polypeptide according to one embodiment.

Description

Technical Field

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of Korean Patent Application No. 10-2020-0060578, filed on May 20, 2020, and the entire disclosure of the corresponding Korean patent application document is incorporated herein by reference in its entirety.

[0003] The present invention relates to a novel mutant polypeptide having isopropylmalate synthase activity; a polynucleotide encoding the polypeptide; a vector comprising the polynucleotide; a microorganism comprising the mutant polypeptide, the polynucleotide, the vector or a combination thereof; and a method for producing L-leucine by culturing the microorganism. Background Art

[0004] L-amino acid is produced industrially by fermentation methods using amino acid producing bacteria with the ability to produce L-amino acids belonging to coryneform bacteria or Enterobacteriaceae. As these amino acid producing bacteria, in order to improve productivity, bacterial strains isolated from nature, as well as artificial mutants of these bacterial strains and recombinant strains that strengthen the L-amino acid biosynthetic enzyme through genetic recombination are used.

[0005] In L-amino acid, L-leucine is a kind of essential amino acid, expensive, and is widely used in medicine, food, feed additives, industrial chemicals etc. In addition, L-leucine mainly uses microbial production. The fermentation production of L-leucine is mainly carried out by Escherichia (Escherichia) microorganism or Corynebacterium (Corynebacterium) microorganism, and it is known that it is as precursor from pyruvic acid biosynthesis 2-ketoisocaproic acid by several steps. However, the enzyme participating in the biosynthesis of L-leucine causes feedback inhibition to the final product, i.e. L-leucine or its derivatives, and is therefore difficult to carry out the large-scale industrial production of L-leucine.

[0006] Therefore, the present inventors have found that a mutant strain obtained by changing a specific position of isopropylmalate synthase can optimize the enzyme activity and thus can be used to produce L-leucine in high yield, thereby completing the present invention.

[0007] Prior art literature

[0008] Patent Literature

[0009] (Patent Document 1) US 2018-0251772 A1 Summary of the Invention

[0010] Technical issues

[0011] The purpose of the present application is to provide a mutant polypeptide having isopropylmalate synthase activity, wherein the proline amino acid residue at position 247 in the amino acid sequence of SEQ ID NO: 1 is substituted by an amino acid residue other than proline.

[0012] Another object of the present application is to provide a polynucleotide encoding a mutant polypeptide.

[0013] Another object of the present application is to provide a vector comprising the polynucleotide.

[0014] Another object of the present application is to provide a microorganism comprising at least one selected from the group consisting of a mutant polypeptide, a polynucleotide, and a vector comprising the polynucleotide.

[0015] Another object of the present application is to provide a method for producing L-leucine, comprising the step of culturing a microorganism in a culture medium.

[0016] Another object of the present application is to provide a composition for producing L-leucine, comprising at least one selected from the group consisting of a mutant polypeptide, a polynucleotide encoding the mutant polypeptide, a vector comprising the polynucleotide, and a microorganism (e.g., a microorganism (recombinant cell) comprising the mutant polypeptide of the present application, the polynucleotide of the present application, and / or the vector of the present application).

[0017] Another object of the present application is to provide a method for producing L-leucine by using at least one of the following methods: a mutant polypeptide, a polynucleotide encoding the mutant polypeptide, a vector comprising the polynucleotide, and a microorganism (e.g., a microorganism (recombinant cell) comprising the mutant polypeptide of the present application, the polynucleotide of the present application, and / or the vector of the present application).

[0018] Technical solutions

[0019] In one aspect of the present application, a mutant polypeptide having isopropylmalate synthase activity is provided, wherein the amino acid residue at position 247 from the N-terminus or a position corresponding thereto in the amino acid sequence of the isopropylmalate synthase protein of SEQ ID NO: 1 is substituted by another amino acid residue.

[0020] In this specification, the term "isopropylmalate synthase" (2-isopropylmalate synthase, α-isopropylmalate synthase) refers to an enzyme that catalyzes the condensation of the acetyl group of acetyl-CoA with 2-ketoisovalerate (3-methyl-2-oxobutyrate, 2-isovalerate) to convert it into isopropylmalate (3-carboxy-3-hydroxy-4-methylvaleric acid), a precursor of L-leucine. Isopropylmalate synthase can include enzymes having conversion activity regardless of the source of the microorganism. For example, the isopropylmalate synthase can be an enzyme derived from a microorganism of the genus Corynebacterium.

[0021] The isopropylmalate synthase may comprise the amino acid sequence of SEQ ID NO: 1, or may consist of the amino acid sequence of SEQ ID NO: 1. In addition, if the enzyme has the same or corresponding activity as that of isopropylmalate synthase, a polypeptide having at least 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 92% or more, 94% or more, 96% or more, 98% or more, or 99% or more, 99.5% or more, or 99.8% or more homology to the amino acid sequence of SEQ ID NO: 1, regardless of the origin of the microorganism, and a polypeptide having an amino acid sequence in which some sequences are deleted, modified, substituted, or added to the amino acid sequence of SEQ ID NO: 1 may also be included within the scope of the present application as isopropylmalate synthase.

[0022] That is, even if described herein as "a polypeptide (or protein) comprising an amino acid sequence represented by a specific sequence number" or "a polypeptide (or protein) consisting of an amino acid sequence represented by a specific sequence number," a polypeptide (or protein) having an amino acid sequence with some sequence deletions, modifications, substitutions, or additions can also be used as a protein or polypeptide to be mutated in the present application, provided that it has the same or corresponding activity as a polypeptide (or protein) consisting of an amino acid sequence represented by the corresponding sequence number. For example, a polypeptide having the same or corresponding activity as "a polypeptide consisting of the amino acid sequence of SEQ ID NO: 1" can belong to "a polypeptide consisting of the amino acid sequence of SEQ ID NO: 1."

[0023] The amino acid sequence of isopropylmalate synthase and the nucleotide sequence of the gene encoding isopropylmalate synthase can be easily obtained from databases known in the art, such as the National Center for Biotechnology Information (NCBI) and the DNA Data Bank of Japan (DDBJ).

[0024] In this specification, a polynucleotide or polypeptide "comprising a specific nucleic acid sequence (nucleotide sequence) or amino acid sequence" means that the polynucleotide or polypeptide consists of or essentially comprises a specific nucleic acid sequence (nucleotide sequence) or amino acid sequence, and within the scope of maintaining the original function and / or desired function of the polynucleotide or polypeptide, it can be interpreted as a sequence comprising a mutation (deletion, substitution, modification and / or addition) of the specific nucleic acid sequence or amino acid sequence (or not excluding the mutation). In one embodiment, a polynucleotide or polypeptide “comprising a specific nucleic acid sequence (nucleotide sequence) or amino acid sequence” may refer to a polynucleotide or polypeptide that (i) substantially comprises or consists of a specific nucleic acid sequence (nucleotide sequence) or amino acid sequence, and (ii) substantially comprises or consists of a specific nucleic acid sequence (nucleotide sequence) or amino acid sequence having 60% or higher, 70% or higher, 80% or higher, 85% or higher, 90% or higher, 91% or higher, 92% or higher, 93% or higher, 94% or higher, 95% or higher, 96% or higher, 97% or higher, 98% or higher, 98% or higher, 99.5% or higher, or 99.9% or higher homology to the specific nucleic acid sequence (nucleotide sequence) or amino acid sequence, and maintains the original function and / or the required function.

[0025] In the present specification, the amino acid sequence of isopropylmalate synthase derived from wild-type Corynebacterium glutamicum (e.g., ATCC13032) is represented by SEQ ID NO: 1, and the nucleotide sequence of the leuA gene encoding the isopropylmalate synthase from the wild-type strain is represented by SEQ ID NO: 2. Isopropylmalate synthase is shown to consist of 616 amino acids in SEQ ID NO: 1, but in some documents, it is known to consist of 581 amino acids because the translation start codon is after 35 amino acids. The amino acid sequence of isopropylmalate synthase consisting of 581 amino acids is represented by SEQ ID NO: 16. Isopropylmalate synthase consisting of 581 amino acids can be included in the scope of the present application as isopropylmalate synthase. In this case, position 247 is interpreted as position 212 and can be thus included in the scope of the present application.

[0026] According to one embodiment, the mutant polypeptide may be the following polypeptide, wherein:

[0027] In the amino acid sequence of SEQ ID NO: 1, the arginine amino acid residue at position 558 (or a position corresponding thereto) is substituted with an amino acid residue other than arginine,

[0028] In the amino acid sequence of SEQ ID NO: 1, the glycine amino acid residue at position 561 (or a position corresponding thereto) is substituted with an amino acid residue other than glycine, or

[0029] The peptides were further modified by these two substituents.

[0030] In one embodiment, in the case of isopropylmalate synthase consisting of 581 amino acids of SEQ ID NO: 16, position 558 is interpreted as position 523, and position 561 is interpreted as position 526, and thus is included in the scope of the present application.

[0031] In this specification, the term "homology" refers to the percent identity between two polynucleotides or polypeptide portions. The homology between the sequences from one portion to another can be determined by techniques known in the art. For example, homology can be determined by arranging sequence information and directly arranging sequence information, that is, using an easily accessible computer program to arrange parameters such as the score, identity and similarity of two polynucleotide molecules or two polypeptide molecules. The computer program can be BLAST (NCBI), CLC Main Workbench (CLC bio), MegAlign™ (DNASTAR Inc) etc. In addition, the homology between the polynucleotides can be determined by hybridizing polynucleotides under conditions of forming stable double chains between homologous regions, digesting with single-stranded specific nucleases, and then determining the size of the digested fragments.

[0032] According to one aspect, a mutant polypeptide having isopropylmalate synthase activity can be provided, wherein the proline amino acid residue at position 247 (or a position corresponding thereto) in the amino acid sequence of SEQ ID NO: 1 is substituted with an amino acid residue other than proline.

[0033] According to another aspect, a mutant polypeptide having isopropylmalate synthase activity can be provided, wherein the proline amino acid residue at position 212 in the amino acid sequence of SEQ ID NO: 16 is substituted with an amino acid residue other than proline.

[0034] In the present specification, “the position ~ in the amino acid sequence of SEQ ID NO: ~” can be used interchangeably with “the position ~ from the N-terminus of the polypeptide consisting of (or comprising) the amino acid sequence of SEQ ID NO: ~”.

[0035] Amino acids other than proline may include arginine, alanine, leucine, isoleucine, valine, phenylalanine, tryptophan, methionine, glycine, serine, threonine, cysteine, tyrosine, asparagine, glutamine, lysine, histidine, aspartic acid, and glutamic acid.

[0036] According to one embodiment, the mutant polypeptide may be a polypeptide in which the proline at position 247 (or a position corresponding thereto) in the amino acid sequence of SEQ ID No: 1 is substituted by cysteine.

[0037] According to one embodiment, the mutant polypeptide may comprise the amino acid sequence of SEQ ID NO: 3 or may consist of the amino acid sequence of SEQ ID NO: 3.

[0038] According to one embodiment, the mutant polypeptide may be a polypeptide in which the amino acid residue corresponding to position 247 (in the case of SEQ ID NO: 16, position 212) in the amino acid sequence of a polypeptide having 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 92% or more, 94% or more, 96% or more, 98% or more, or 99% or more, 99.5% or more, or 99.8% or more homology to the amino acid sequence of SEQ ID NO: 1 (or SEQ ID No: 16) is substituted by another amino acid residue.

[0039] By replacing the proline at position 247 of the amino acid sequence of SEQ ID NO: 1 (or the proline at position 212 in the amino acid sequence of SEQ ID NO: 16) or an amino acid at a corresponding position thereof with another amino acid, the mutant polypeptide according to one embodiment can have increased L-leucine-producing activity compared to a polypeptide comprising the amino acid sequence of SEQ ID NO: 1 (or SEQ ID NO: 16).

[0040] According to one embodiment, a mutant polypeptide having isopropylmalate synthase activity, wherein the proline amino acid residue at position 247 or the amino acid residue at a position corresponding thereto in an amino acid sequence of a polypeptide having 70% or more, 80% or more, 85% or more, 90% or more, 92% or more, 94% or more, 96% or more, 98% or more, or 99% or more homology to the amino acid sequence of SEQ ID NO: 1, or in the amino acid sequence of SEQ ID NO: 1, is substituted with another amino acid residue. The "another amino acid residue" may refer to an amino acid residue other than the amino acid (e.g., proline) present at the position (position 247 or the position corresponding thereto in the amino acid sequence of SEQ ID NO: 1) before substitution.

[0041] By replacing the proline at position 247 (or 212) in the amino acid sequence of SEQ ID NO: 1 (or SEQ ID NO: 16) or the amino acid residue at the corresponding position thereof with another residue, the mutant polypeptide according to one embodiment can have increased L-leucine production activity compared to the isopropylmalate synthase derived from the wild-type strain (e.g., the isopropylmalate synthase comprising (or consisting of) the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 16).

[0042] By replacing the proline at position 247 (or 212) in the amino acid sequence of SEQ ID NO: 1 (or SEQ ID NO: 16) or the amino acid residue at the corresponding position thereof with another residue, the mutant polypeptide according to one embodiment can have increased isopropylmalate synthase enzymatic activity compared to the isopropylmalate synthase derived from a wild-type strain (for example, the isopropylmalate synthase consisting of the amino acid sequence of SEQ ID NO: 1 (or SEQ ID NO: 16)).

[0043] In this specification, the term "increase in isopropylmalate synthase activity" refers to an increase in the activity of converting isopropylmalate. Therefore, according to one embodiment, the mutant polypeptide can have a higher level of isopropylmalate conversion activity compared to a polypeptide comprising the amino acid sequence of SEQ ID NO: 1 (or SEQ ID NO: 16) and having isopropylmalate synthase activity.

[0044] In this specification, the term "increased activity" can be used interchangeably with "enhanced activity." Furthermore, isopropylmalate is one of the precursors of L-leucine. Therefore, according to one embodiment, the use of a mutant polypeptide results in higher levels of L-leucine production compared to a polypeptide comprising the amino acid sequence of SEQ ID NO: 1 (or SEQ ID NO: 16) and having isopropylmalate synthase activity.

[0045] Isopropylmalate conversion activity can be directly confirmed by measuring the level of isopropylmalate produced, or can be indirectly confirmed by measuring the level of CoA produced. The enzymatic activity of isopropylmalate synthase can be measured by a known method, for example, according to the method described by Kohlhaw et al. (Methods in Enzymology 166: 423-9 (1988)), and the activity of isopropylmalate synthase can be determined by measuring the change in absorbance at 412 nm of thionitrobenzoate (TNB) formed by the reduction of DTNB (5,5′-dithiobis-(2-nitrobenzoic acid), Ellman's reagent) with the produced CoA.

[0046] According to one embodiment, compared to the isopropylmalate synthase derived from a wild-type strain (e.g., the isopropylmalate synthase consisting of the amino acid sequence of SEQ ID NO: 1), the mutant polypeptide can reduce feedback inhibition by replacing the proline at position 247 (or position 212) in the amino acid sequence of SEQ ID NO: 1 (or SEQ ID NO: 16) or the amino acid sequence at the corresponding position with another amino acid.

[0047] As used herein, the term "feedback inhibition" refers to the inhibition of an enzyme system's initial reaction by an end product. For example, feedback inhibition may mean that L-leucine or a derivative thereof inhibits the activity of isopropylmalate synthase, which mediates the first step in its biosynthetic pathway. Therefore, when feedback inhibition of isopropylmalate synthase is reduced (or released), L-leucine productivity may increase compared to when feedback inhibition is not reduced (or released).

[0048] In this specification, the term "derivative" may refer to a compound known to inhibit the ability of a microorganism to produce L-leucine by inducing feedback inhibition associated with the biosynthesis of L-leucine as the final product of the present invention. Examples may include isoleucine, tertiary leucine, norleucine and / or cycloleucine, etc.

[0049] According to one embodiment, the mutant polypeptide may be a polypeptide in which a position other than position 247 (or position 212) in the amino acid sequence of SEQ ID NO: 1 (or SEQ ID NO: 16) is additionally mutated, thereby synergistically increasing one or more effects selected from the following: (1) increased L-leucine production activity; (2) increased isopropylmalate synthase enzymatic activity; and (3) reduced feedback inhibition by L-leucine and / or its derivatives.

[0050] According to one embodiment, the mutated polypeptide may further comprise a mutation that can exhibit one or more effects selected from the group consisting of: (1) increased L-leucine production activity; (2) increased enzymatic activity of isopropylmalate synthase; and (3) reduced feedback inhibition of L-leucine and / or its derivatives.

[0051] The mutant polypeptide may be a polypeptide wherein:

[0052] The arginine amino acid residue at position 558 (or a position corresponding thereto) in the amino acid sequence of SEQ ID NO: 1 is substituted with an amino acid residue other than arginine,

[0053] The glycine amino acid residue at position 561 (or a position corresponding thereto) in the amino acid sequence of SEQ ID NO: 1 is substituted with an amino acid residue other than glycine, or the polypeptide is further modified by these two substituents.

[0054] The mutant polypeptide may be a polypeptide wherein:

[0055] The arginine amino acid residue at position 523 (or a position corresponding thereto) in the amino acid sequence of SEQ ID NO: 16 is substituted with an amino acid residue other than arginine,

[0056] The glycine amino acid residue at position 526 (or a position corresponding thereto) in the amino acid sequence of SEQ ID NO: 16 is substituted with an amino acid residue other than glycine, or the polypeptide is further modified by these two substituents.

[0057] Amino acids other than arginine may include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, methionine, glycine, serine, threonine, cysteine, tyrosine, asparagine, glutamine, lysine, histidine, aspartic acid and glutamic acid; and amino acids other than glycine may include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, methionine, arginine, serine, threonine, cysteine, tyrosine, asparagine, glutamine, lysine, histidine, aspartic acid and glutamic acid; but are not limited thereto.

[0058] According to one embodiment, the amino acid other than arginine may be histidine.

[0059] According to one embodiment, the amino acid other than glycine may be aspartic acid.

[0060] According to one embodiment, the mutant polypeptide may be the following polypeptide, wherein:

[0061] The arginine amino acid residue at position 558 in the amino acid sequence of SEQ ID NO: 1 is replaced by a histidine amino acid residue,

[0062] The glycine amino acid residue at position 561 in the amino acid sequence of SEQ ID NO: 1 is substituted with an aspartic acid amino acid residue, or

[0063] The polypeptide is further modified by these two substituents.

[0064] According to one embodiment, the variant polypeptide may include the amino acid sequence of SEQ ID NO: 5, or may consist of the amino acid sequence of SEQ ID NO: 5.

[0065] In the mutant polypeptide, the amino acid residue at position 247 (or position 212) in the amino acid sequence of SEQ ID NO: 1 (or SEQ ID NO: 16) is substituted with an amino acid residue other than proline,

[0066] In the mutant polypeptide, the arginine amino acid residue at position 558 (or position 523) in the amino acid sequence of SEQ ID NO: 1 (or SEQ ID NO: 16) is substituted with an amino acid residue other than arginine, and the glycine amino acid residue at position 561 (or position 526) is substituted with an amino acid residue other than glycine, or the polypeptide is further modified by these two substituents. The mutant polypeptide may be the following polypeptide, wherein:

[0067] Compared to the following mutant polypeptide, wherein (i) the isopropylmalate synthase derived from a wild-type strain (e.g., an isopropylmalate synthase comprising the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 16) or (ii) the proline amino acid residue at position 247 (or position 212) in the amino acid sequence of SEQ ID NO: 1 (or SEQ ID NO: 16) is substituted with an amino acid residue other than proline,

[0068] One or more effects selected from the group consisting of the following (1) to (3) may be increased:

[0069] (1) Increased L-leucine production activity;

[0070] (2) increased enzyme activity of isopropylmalate synthase; and

[0071] (3) Feedback inhibition by L-leucine and / or its derivatives is reduced.

[0072] According to one embodiment, depending on the combination of mutations, wherein the amino acid at position 247, 558 and / or 561 (or position 212, 523 and / or 526) in the amino acid sequence of SEQ ID NO: 1 (or SEQ ID NO: 16) is substituted with another amino acid, the mutant polypeptide according to one embodiment may have a synergistically increased effect of one or more selected from the group consisting of the following (1) to (3):

[0073] (1) Increased L-leucine production activity;

[0074] (2) increased enzyme activity of isopropylmalate synthase; and

[0075] (3) Feedback inhibition by L-leucine and / or its derivatives is reduced.

[0076] The effects of (1) to (3) above are the same as those described above.

[0077] According to another aspect, polynucleotide encoding mutant polypeptides can be provided. In this specification, term "polynucleotide" refers to a nucleotide polymer to which nucleotide monomers are covalently linked in a long chain form, and is a DNA or RNA chain with a certain length or longer. More specifically, it can refer to a polynucleotide fragment encoding a mutant polypeptide.

[0078] The mutant polypeptide is the same as above.

[0079] The polynucleotide may include, but is not limited to, a polynucleotide sequence encoding the mutant polypeptide of the present application.

[0080] According to one embodiment, it can be a polynucleotide encoding the following polypeptide, wherein the proline amino acid residue at position 247 (or position 212) in the amino acid sequence of SEQ ID NO: 1 (or SEQ ID NO: 16) is substituted by an amino acid residue other than proline; or a polynucleotide encoding a polypeptide having 60% or higher, 70% or higher, 80% or higher, 85% or higher, 90% or higher, 92% or higher, 94% or higher, 96% or higher, 98% or higher, or 99% or higher, 99.5% or higher, or 99.8% or higher homology to the amino acid sequence of SEQ ID NO: 1 (or SEQ ID NO: 16), wherein the amino acid residue at the position corresponding to position 247 (or position 212) in the amino acid sequence of SEQ ID NO: 1 (or SEQ ID NO: 16) is substituted by other amino acid residues, or encoding a polypeptide in which some of the sequences are deleted, modified, substituted or added.

[0081] According to one embodiment, the polynucleotide may include, but is not limited to, a probe that can be prepared from a known gene sequence, for example, a probe that can hybridize under stringent conditions with a complementary sequence to all or part of a polynucleotide sequence and comprises a sequence corresponding to a sequence encoding a protein variant in which the amino acid at position 247 (or position 212) or a position corresponding thereto in the amino acid sequence of SEQ ID NO: 1 (or SEQ ID NO: 16) is substituted with another amino acid. The term "stringent conditions" refers to conditions under which so-called specific hybrids are formed, while non-specific hybrids are not formed. Examples of such conditions include conditions under which genes having a high degree of homology, for example, genes having 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 92% or more, 94% or more, 96% or more, 98% or more, or 99% or more, 99.5% or more, or 99.8% or more homology, hybridize with each other, whereas genes having a low degree of homology do not hybridize with each other, or conditions under which the genes are washed once, particularly twice and three times, at a temperature and salt concentration equivalent to 60°C, 1×SSC and 0.1% SDS, particularly 60°C, 0.1×SSC and 0.1% SDS, more particularly 68°C, 0.1×SSC and 0.1% SDS, which are washing conditions for conventional Southern hybridization (Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001)).

[0082] The probe used in hybridization can be a portion of the complementary sequence of a nucleotide sequence. This probe can be constructed by PCR using oligonucleotides prepared based on a known sequence as primers and a gene fragment containing the nucleotide sequence as a template. For example, a gene fragment of approximately 300 bp in length can be used as a probe. More specifically, when using a probe of approximately 300 bp in length, washing conditions of 50°C, 2×SSC, and 0.1% SDS can be recommended for hybridization.

[0083] According to one embodiment, the polynucleotide may comprise the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 6, or may consist of the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 6, and the polynucleotide that can be translated into a mutant polypeptide by codon degeneracy according to one embodiment may also be included in the scope of the present application.

[0084] According to another aspect, a vector comprising a polynucleotide may be provided.

[0085] In this specification, the term "vector" refers to any carrier used to clone and / or transfer nucleic acids to a host cell. A vector may be a replicon to allow replication of a segment that is bound to other DNA segments. A "replicon" refers to any genetic unit (e.g., plasmid, phage, cosmid, chromosome, and virus) that functions as a self-replicating unit for DNA replication in vivo, i.e., that can replicate by self-regulation.

[0086] In one embodiment, the vector can be a DNA construct comprising a polynucleotide sequence encoding a target protein, operably linked to a suitable regulatory sequence so that the target protein can be expressed in a suitable host. The regulatory sequence can include a promoter capable of initiating transcription, any operator sequence for controlling transcription, a sequence encoding a suitable mRNA ribosome binding domain, and sequences that control transcription and translation termination. After transformation into a suitable host cell, the vector can replicate or function independently of the host genome, and it can be integrated into the host genome itself.

[0087] In the present specification, the term "operably linked" means that a gene sequence is functionally linked to a promoter sequence, which initiates and mediates the transcription of a polynucleotide encoding a polypeptide.

[0088] The vector is not particularly limited as long as it can replicate in the host cell, and any vector known in the art can be used. For example, the vector can be a natural or recombinant plasmid, a cosmid, a virus, and a phage. As a phage vector or a cosmid vector, MBL3, MBI4, IXII, ASHII, APII, t10, t11, pWE15, M13, λEMBL3, λEMBL4, λFIXII, λDASHII, λZAPII, λgt10, λgt11, Charon4A, and / or Charon21A, etc. can be used; as a plasmid vector, a pDZ vector, a pBR-based vector, a pUC-based vector, a pBluescript II-based vector, a pGEM-based vector, a pTZ-based vector, a pCL-based vector, and / or a pET-based vector, etc. can be used. For example, pCR2.1, pDC, pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118 and / or pCC1BAC vectors can be used.

[0089] According to another aspect, there may be provided a microorganism (or recombinant cell) comprising at least one selected from the group consisting of a mutant polypeptide, a polynucleotide encoding the mutant polypeptide, and a vector comprising the polynucleotide.

[0090] Details regarding the mutant polypeptide, polynucleotide and vector are the same as described above.

[0091] The microorganism (or recombinant cell) may further comprise a mutation that increases L-leucine production, and as long as L-leucine production is increased, the position of the mutation and / or the type of gene to be mutated may be included without limitation.

[0092] The microorganism (or recombinant cell) may further comprise a mutation that enhances the activity of an enzyme involved in L-leucine biosynthesis. The enhancement of the enzyme activity is the same as described above.

[0093] The microorganism (recombinant cell) can be used without limitation as long as it is a cell capable of transformation.

[0094] Microorganism (or recombinant cell) can have the ability to produce L-leucine.Microorganism (or recombinant cell) can have higher improved L-leucine production capacity or can have L-leucine production capacity that cell before recombinant, parent strain and / or wild-type strain do not have.

[0095] The microorganism (or recombinant cell) may be a polypeptide in which the amino acid sequence corresponding to isopropylmalate synthase is mutated, such that its activity is increased compared to a wild-type strain, a parent strain and / or a cell before recombination, or the feedback inhibition of L-leucine and its derivatives is released, or both the increase in enzyme activity and the release of feedback inhibition are achieved.

[0096] The microorganism (or recombinant cell) may be one in which the polynucleotide according to one embodiment is integrated into a chromosome, for example, the polynucleotide according to one embodiment may be exchanged with the native leuA gene (gene encoding isopropylmalate synthase) at a gene site in the chromosome or integrated into another gene site.

[0097] As used herein, "having the ability to produce L-leucine" refers to a microorganism that imparts the ability to produce leucine to a cell and / or microorganism that does not have this ability, or a cell and / or microorganism that naturally has this ability. For example, a Corynebacterium microorganism that has the ability to produce L-leucine refers to a Corynebacterium microorganism whose L-leucine production ability has been enhanced by inserting an external gene related to the leucine production mechanism, or by enhancing or inactivating the activity of a native gene or the native microorganism itself. The microorganism may be a Corynebacterium microorganism.

[0098] The Corynebacterium microorganism may be Corynebacterium glutamicum, Corynebacterium ammoniagenes, Corynebacterium acetoacidophilum, Corynebacterium acetoglutamicum, Corynebacterium alkanolyticum, Corynebacterium callunae, Corynebacterium lilium, Corynebacterium melassecola, Corynebacterium thermoaminogenes, Corynebacterium efficiens and / or Corynebacterium herculis, etc.

[0099] Microorganism (or recombinant cell) can comprise and be artificially produced and / or spontaneously generated by transformation.For example, microorganism (or recombinant cell) can transform with the polynucleotide of encoding mutant polypeptide according to one embodiment, or the carrier transformation that comprises this polynucleotide.

[0100] In this specification, the term "transformation" refers to the introduction of a gene or polynucleotide into a host cell so that it can be expressed in the host cell, and the transformed gene or polynucleotide may include a form inserted into the host cell chromosome and a form located outside the chromosome, without limitation, as long as it can be expressed in the host cell.

[0101] In this specification, the transformation method includes, but is not limited to, any method for introducing a gene into a cell, and can be performed by selecting a suitable standard technique known in the art according to the host cell. For example, electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, retroviral infection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method and / or lithium acetate-DMSO method, and similar methods can be used, but are not limited thereto.

[0102] The microorganism (or recombinant cell) can be a microorganism (or recombinant cell) in which a polynucleotide sequence is integrated into a chromosome according to one embodiment. Homologous recombination allows the DNA fragment on the chromosome to be exchanged for a polynucleotide according to one embodiment, which is transferred into the cell by a vector while using a vector according to one embodiment. In order to effectively recombine between the circular DNA molecule of the vector and the target DNA on the chromosome, a DNA region comprising an exchange of the polynucleotide according to one embodiment is provided, and a nucleotide sequence homologous to the target site is provided at the end; these determine the vector integration site and the DNA exchange site. For example, a polynucleotide according to one embodiment can be exchanged for a natural leuA gene at a natural gene site within the chromosome, or can be incorporated into another gene site.

[0103] According to another aspect, there may be provided a method for producing L-leucine, comprising the step of culturing a microorganism (or recombinant cell) in a culture medium.

[0104] In one embodiment, the method may further include the step of collecting L-leucine from the culture medium or the microorganism (or recombinant cell).

[0105] The culture can be carried out according to appropriate culture media and culture conditions known in the art, which must be suitably adapted to meet the requirements of a particular strain and can be appropriately modified by those skilled in the art.

[0106] The culture method may include, for example, batch culture, continuous culture, fed-batch culture, or a combination thereof, but is not limited thereto.

[0107] The culture medium used for culturing microorganisms (or recombinant cells) can refer to known literature (Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington DC, USA, 1981), but is not limited thereto.

[0108] According to one embodiment, the culture medium may include various carbon sources, nitrogen sources, and trace element components, and the recombinant cells may be cultured in a conventional culture medium containing an appropriate carbon source, nitrogen source, amino acid, vitamin, etc., with the temperature and / or pH adjusted. Carbon sources include sugars and carbohydrates, such as glucose, sucrose, lactose, fructose, maltose, starch, and / or cellulose; oils and fats, such as soybean oil, sunflower oil, castor oil, and / or coconut oil; fatty acids, such as palmitic acid, stearic acid, and / or linoleic acid; alcohols, such as glycerol and / or ethanol; and organic acids, such as acetic acid. These substances may be used alone or in combination of two or more, but are not limited thereto. Nitrogen sources that may be used may include peptone, yeast extract, meat juice, malt extract, corn steep liquor, soy flour, and urea or inorganic compounds, such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. Nitrogen sources may also be used alone or in combination of two or more, but are not limited thereto. Phosphorus sources that may be used may include potassium dihydrogen phosphate or dipotassium hydrogen phosphate or corresponding sodium salts, but are not limited thereto. In addition, the culture medium may contain metal salts required for growth, such as magnesium sulfate or iron sulfate, but is not limited thereto. Furthermore, necessary growth substances such as amino acids and vitamins may also be included. Furthermore, precursors suitable for the culture medium may be used. During the culture process, the culture medium or individual components may be added to the culture medium in a batch or continuous manner, but is not limited thereto.

[0109] According to one embodiment, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid and sulfuric acid can be added to the culture medium of the microorganism in an appropriate manner to adjust the pH value of the culture medium. In addition, defoamers such as fatty acid polyethylene glycol esters can be used to suppress the generation of bubbles during the culture process. In addition, in order to maintain the aerobic state of the culture medium, oxygen or oxygen-containing gas (such as air) can be injected into the culture medium. The temperature of the culture medium can be 20°C to 45°C, 25°C to 40°C, or 30°C to 37°C. The culture time can last until the useful substance (for example, L-leucine) required production volume is obtained, and can be, for example, 10 to 160 hours.

[0110] The step of separating or collecting L-leucine from the cultured microorganism (or recombinant cell) and / or culture medium can be carried out using a suitable method known in the art according to the culture method. For example, centrifugation, filtration, extraction, spraying, drying, distillation, precipitation, crystallization, electrophoresis, fractional dissolution (e.g., ammonium sulfate precipitation) and / or chromatography (e.g., ion exchange, affinity, hydrophobicity and size exclusion) can be used, but are not limited thereto. The culture medium refers to the culture medium for culturing the microorganism (or recombinant cell).

[0111] According to one embodiment, the step of separating or collecting L-leucine can be performed by centrifuging the culture at low speed to remove biomass, and separating the resulting supernatant by ion exchange chromatography.

[0112] The method for producing L-leucine may further include a step of purifying L-leucine.

[0113] According to another aspect, a composition for producing L-leucine can be provided, comprising at least one selected from the group consisting of a mutant polypeptide of the present application, a polynucleotide encoding the mutant polypeptide, a vector comprising the polynucleotide, and a microorganism (e.g., a microorganism (recombinant cell) comprising the mutant polypeptide of the present application, the polynucleotide of the present application, and / or the vector of the present application).

[0114] The composition of the present invention may further comprise any suitable excipient commonly used in the production of amino acid compositions, such as a preservative, a wetting agent, a dispersant, a suspending agent, a buffer, a stabilizer or an isotonic agent, but is not limited thereto.

[0115] In the composition of the present application, the mutant polypeptide, polynucleotide, vector, microorganism and culture medium are the same as those described in the other aspects above.

[0116] According to another aspect, at least one use of the method for producing L-leucine selected from the group consisting of a mutant polypeptide, a polynucleotide encoding a mutant polypeptide, a vector comprising the polynucleotide, and a microorganism (e.g., a microorganism (recombinant cell) comprising a mutant polypeptide of the present application, a polynucleotide of the present application, and / or a vector comprising the present application) can be provided.

[0117] In the use of the present application, the mutant polypeptide, polynucleotide, vector, microorganism and culture medium are the same as those described in the other aspects above.

[0118] Beneficial effects

[0119] By using the mutant polypeptide according to one embodiment, L-leucine can be produced in high yield. DETAILED DESCRIPTION

[0120] Hereinafter, the present invention will be described in more detail with reference to the following examples, but the scope of the present invention is not intended to be limited by these examples.

[0121] Example 1. Construction of a DNA library encoding mutant isopropylmalate synthase

[0122] Example 1-1. Construction of a vector containing leuA

[0123] In order to construct a leuA mutant library encoding variants having isopropylmalate synthase activity, a recombinant vector containing leuA was first constructed.

[0124] In order to amplify the leuA gene (SEQ ID NO: 2) encoding LeuA (2-isopropylmalate synthase) protein (SEQ ID NO: 1, Uniprot accession code: P42455) derived from wild-type Corynebacterium glutamicum, the chromosome of Corynebacterium glutamicum ATCC13032 wild-type strain was used as a template, and the primers of SEQ ID NO: 7 and 8 were used to carry out the PCR method under the following conditions, repeating 25 cycles: denaturation at 94°C for 1 minute, annealing at 58°C for 30 seconds, and polymerization at 72°C for 1 minute using Pfu DNA polymerase. The specific sequences of the primers used are shown in Table 1 below.

[0125] The amplified PCR product was cloned into the E. coli vector pCR2.1 using a TOPO cloning kit (Invitrogen) according to the manufacturer's manual to obtain "pCR-leuA".

[0126]

Table 1

[0127] SEQ ID NO Sequence (5′->3′) SEQ ID NO: 7 CTAATCTCGAGGTCACCCATGTCTCCTAAC SEQ ID NO: 8 GGCTGGCGGCGTTTAAAACCGGTTGAT

[0128] Example 1-2. Construction of leuA mutation library

[0129] Based on the vector constructed in Example 1-1, an error-prone PCR kit (clontech A leuA mutation library was constructed using the PCR Random Mutagenesis Kit. PCR reactions were performed using the pCR-leuA vector as a template and primers of SEQ ID NO: 7 and SEQ ID NO: 8, with 0 to 3 mutations per 1000 bp. Specifically, the PCR reaction was performed under the following conditions: preheating at 94°C for 30 seconds, followed by 25 cycles of 94°C for 30 seconds and 68°C for 1 minute and 30 seconds, to achieve 0 to 3 mutations per 1000 bp. The resulting PCR product was used as a megaprimer (50-125 ng), and the PCR reaction was repeated for 25 cycles of 95°C for 50 seconds, 60°C for 50 seconds, and 68°C for 12 minutes, followed by DpnI treatment. The DpnI-treated PCR product was transformed into Escherichia coli DH5α by heat shock and plated on LB solid medium containing kanamycin (25 mg / L). Twenty transformed colonies were selected, plasmids obtained, and the nucleotide sequence analyzed. As a result, it was confirmed that mutations were introduced at mutually different positions at a frequency of 2 mutations / kb. Approximately 20,000 transformed E. coli colonies were collected, and plasmids were extracted and named "pTOPO-leuA-library".

[0130] Example 2. Evaluation of constructed libraries and selection of variants

[0131] Example 2-1. Selection of mutant strains with increased L-leucine production

[0132] The pTOPO-leuA-library that embodiment 1-2 is made up is transformed into wild-type Corynebacterium glutamicum ATCC13032 by electroporation, the bacterial strain of conversion is spread on the nutrient medium (table 2) that contains 25mg / L kanamycin, select the bacterium colony of 10,000 bacterial strains that insert mutagenesis.Each bacterium colony selected is named as ATCC13032 / pTOPO_leuA (mt) 1 to ATCC13032 / pTOPO_leuA (mt) 10,000.In order to identify the bacterium colony that the L-leucine production amount increases in 10,000 bacterium colonies that obtain, the fermentation titer of each bacterium colony is evaluated in the following manner.

[0133]

Table 2

[0134]

[0135] Each colony was inoculated into a 250 ml baffled flask containing 25 ml of autoclaved production medium containing 25 μg / ml kanamycin (Table 2) using a platinum loop, and then cultured at 30° C. with a shaking rate of 200 rpm for 60 hours. After the culture was completed, the amount of L-leucine produced was measured by high performance liquid chromatography (HPLC, SHIMAZDU LC20A).

[0136] In the 10,000 bacterium colonies that obtain, selected a kind of bacterial strain (ATCC13032 / pTOPO_leuA (mt) 5306) with the L-leucine productivity of maximum improvement compared with wild-type Corynebacterium glutamicum bacterial strain (ATCC13032).The concentration of the L-leucine that produces among the selected bacterial strain (ATCC13032 / pTOPO_leuA (mt) 5306) is presented in table 3 below.

[0137]

Table 3

[0138] Strain name L-Leucine (g / L) ATCC13032 0.87 ATCC13032 / pTOPO_leuA(mt)5306 1.32

[0139] As shown in Table 3, the L-leucine production capacity of the Corynebacterium glutamicum ATCC13032 / pTOPO_leuA(mt)5306 strain having the leuA gene mutation was improved by about 1.5 times compared with the parent strain Corynebacterium glutamicum ATCC13032.

[0140] Example 2-2. Confirmation of mutation of mutant strain with increased L-leucine production

[0141] In order to confirm the leuA gene mutation of Corynebacterium glutamicum ATCC13032 / pTOPO_leuA(mt)5306 strain, PCR was performed using DNA of ATCC13032 / pTOPO_leuA(mt)5306 strain as a template and primers of SEQ ID NO: 9 and SEQ ID NO: 10 listed in Table 4 under the following conditions: denaturation at 94°C for 5 minutes, followed by 30 cycles of 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1 minute and 30 seconds, followed by 72°C for 5 minutes, and DNA sequencing was performed.

[0142]

Table 4

[0143] SEQ ID NO Sequence (5′->3′) SEQ ID NO: 9 AACACGACCGGCATCCCGTCGC SEQ ID NO: 10 AAATCATTTGAGAAAACTCGAGG

[0144] As a result of sequencing, it was confirmed that in the ATCC13032 / pTOPO_leuA(mt)5306 strain, CC at positions 739 and 740 of the leuA gene were replaced by TG. This means that a variant (hereinafter referred to as P247C) can be encoded in which the proline at position 247 of the LeuA protein (position 212, if the LeuA protein consists of 581 amino acids (SEQ ID NO: 16), the translation start codon is indicated after 35 amino acids, based on known literature; hereinafter referred to as position 247) is replaced by cysteine. The amino acid sequence of the LeuA variant (P247C) and the nucleotide sequence encoding the leuA variant are identical to those of SEQ ID NO: 3 and SEQ ID NO: 4, respectively.

[0145] In the following examples, it was attempted to confirm whether the mutation (P247C) affects the amount of L-leucine produced by a microorganism belonging to the genus Corynebacterium.

[0146] Example 3. Confirmation of L-leucine production ability of selected mutant strains

[0147] Example 3-1. Construction of insertion vector containing leuA mutation

[0148] In this embodiment, in order to use the site-directed mutagenesis method the sudden change (P247C) of selection is introduced into bacterial strain, attempt to construct the vector that is used to insert.Use the chromosome of Corynebacterium glutamicum wild type (ATCC13032) as template, and use the primer of SEQID NO:11 and 12, and the primer of SEQ ID NO:13 and 14 to carry out PCR.Specifically, PCR is carried out under the following conditions: 94 ℃ of denaturation 5 minutes, then 94 ℃ 30 seconds, 55 ℃ 30 seconds and 72 ℃ 1 minute 30 seconds carry out 30 cycles, then down at 72 ℃, keep 5 minutes.The specific sequence of primer used is shown in Table 5.

[0149]

Table 5

[0150]

[0151] The obtained PCR product was cut with SmaI restriction endonuclease to obtain a linear pDZ vector, and the homologous sequences of the terminal 15 bases between the DNA fragments were fused and cloned with In-Fusion enzyme to construct the vector "pDZ-leuA(P247C)", in which the proline (Pro) at the 247th amino acid position of LeuA was replaced by cysteine ​​(Cys).

[0152] Example 3-2. Introduction of leuA gene mutation into ATCC13032 strain

[0153] The pDZ-leuA(P247C) vector constructed in Example 3-1 was transformed into ATCC13032 by electroporation, and strains in which the vector had been inserted into the chromosome by homologous sequence recombination were selected in a medium containing 25 mg / L kanamycin. The selected primary strains were again subjected to secondary exchange to select strains with mutations introduced into the leuA gene. After PCR using primers of SEQ ID NO: 9 and SEQ ID NO: 15 under the following conditions, nucleotide sequence analysis was performed to confirm whether the leuA gene mutation had been introduced into the final transformed strain: 94°C for 5 minutes, followed by 30 cycles of 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 90 seconds, followed by 72°C for 5 minutes. The results of nucleotide sequence analysis confirmed that the leuA mutation encoding LeuA, in which nucleotides CC at positions 739 and 740 of the leuA gene were replaced by TG, and amino acid proline (Pro) at position 247 was replaced by cysteine ​​(Cys), had been introduced into the strain. The resulting strain was named "ATCC13032 leuAP247C". The specific sequences of the primers used are shown in Tables 4 and 6.

[0154]

Table 6

[0155] SEQ ID NO Sequence (5′->3′) SEQ ID NO: 15 ATCCATTCAATGGAGTCTGCG

[0156] Example 3-3. Evaluation of the ability of mutants to produce L-leucine

[0157] To evaluate the L-leucine production capacity of the ATCC13032_leuA_P247C strain produced in Example 3-2, flask fermentation titers were assessed similarly to the method in Example 2. The parent strains, Corynebacterium glutamicum ATCC13032 and ATCC13032leuA P247C, were each inoculated into 250 ml of production medium using a platinum loop. The cultures were then shaken at 30°C and 200 rpm for 60 hours to produce L-leucine. Following the incubation period, L-leucine production was measured by HPLC. The L-leucine concentrations in the culture medium for each strain are shown in Table 7 below.

[0158]

Table 7

[0159] Strain name L-Leucine (g / L) ATCC13032 0.87 ATCC13032_leuA_P247C 1.35

[0160] As shown in Table 7, ATCC13032_leuA_P247C increased the production of L-leucine by about 1.55 times compared to the parent Corynebacterium glutamicum ATCC13032.

[0161] Example 4. Evaluation of leucine production capacity in leucine-producing mutants

[0162] Since wild-type strains of the genus Corynebacterium produce a trace amount of L-leucine, a leucine-producing strain derived from ATCC13032 was generated and introduced with the mutation (P247C) selected in Example 2 to confirm the L-leucine-producing ability. Specific experiments were performed as follows.

[0163] Example 4-1. Production of L-leucine-producing strain (CJL-8100 strain)

[0164] As a strain for producing high-concentration L-leucine, a strain derived from ATCC13032 containing the following mutations was produced: (1) a mutation in which arginine at amino acid position 558 of the LeuA protein is substituted with histidine by replacing G at nucleotide position 1673 of the leuA gene with A (R558H), and (2) a mutation in which glycine at amino acid position 561 is substituted with aspartic acid by replacing GC at nucleotide positions 1682 and 1683 of the leuA gene with AT (G561D).

[0165] Specifically, the pDZ-leuA (R558H, G561D) vector containing the leuA gene mutation (KR10-2018-0077008A) was transformed into Corynebacterium glutamicum ATCC13032 by electroporation, and a strain with a vector inserted on the chromosome by homologous sequence recombination was selected in a medium containing 25 mg / L kanamycin. The selected primary strain was again subjected to a secondary exchange, and a strain into which the leuA gene mutation had been introduced was selected. Finally, it was then confirmed whether the transformed strain had introduced a mutation, wherein primers of SEQ ID NO: 7 and SEQ ID NO: 13 were used to perform PCR under the following conditions: 94°C for 5 minutes, then 94°C for 30 seconds / 55°C for 30 seconds / 72°C for 90 seconds for 30 cycles, then 72°C for 5 minutes, and the nucleotide sequence was analyzed to confirm the introduction of R558H and G561D mutations. The specific sequences of the primers used are listed in Tables 1 and 5. The ATCC13032_leuA_(R558H, G561D) strain transformed with the pDZ-leuA(R558H, G561D) vector was named “CJL-8100”.

[0166] Example 4-2. Construction of an insertion vector containing a leuA mutation

[0167] In this example, in order to introduce the mutation (P247C) selected in Example 2 into the L-leucine-producing strain CJL-8100, in which two mutations (R558H and G561D) were introduced into LeuA, an attempt was made to construct a vector for insertion.

[0168] PCR was performed using the chromosome of the CJL-8100 strain as a template using primers of SEQ ID NOs: 9 and 10 and primer pairs of SEQ ID NOs: 11 and 12. PCR was performed under the following conditions: denaturation at 94°C for 5 minutes, followed by 30 cycles of 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1 minute and 30 seconds, and then polymerization at 72°C for 5 minutes. The resulting PCR product was cut with SmaI restriction enzyme to obtain a linear pDZ vector, and the terminal 15 base homologous sequences between the DNA fragments were fused and cloned with In-Fusion enzyme to construct the vector pDZ-leuA (P247C, R558H, G561D), which contains a leuA mutation encoding a LeuA variant, wherein the arginine at amino acid position 558 in the LeuA amino acid sequence of the wild-type strain is substituted by histidine, and the glycine at amino acid position 561 is substituted by aspartic acid, and the proline (Pro) at amino acid position 247 of LeuA is substituted by cysteine ​​(Cys).

[0169] Example 4-3. Introduction and evaluation of the LeuA mutant (P247C) in the CLJ-8100 strain

[0170] The L-leucine-producing strain CJL-8100 was transformed with the pDZ-leuA (P247C, R558H, G561D) vector produced in Example 4-2. Strains that had the vector inserted into their chromosomes via homologous recombination were selected in a medium containing 25 mg / L kanamycin. The selected primary strains were then subjected to a secondary crossover to select strains that had introduced the target gene mutation. Whether the final transformed strain had introduced the leuA gene mutation was confirmed by PCR using primers of SEQ ID NO: 9 and SEQ ID NO: 15 under the following conditions, followed by nucleotide sequence analysis: 94°C for 5 minutes, followed by 30 cycles of 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 90 seconds, followed by 72°C for 5 minutes. As a result of nucleotide sequence analysis, a leuA mutation encoding a LeuA variant (P247C, R558H, G561D) was introduced into the strain. In the LeuA variant, the G at nucleotide 1673 of the leuA gene was replaced with A, the GC at nucleotides 1682 and 1683 were replaced with AT; and the CC at nucleotides 739 and 740 were replaced with TG. The arginine at amino acid position 558 of the LeuA protein was replaced by histidine, the glycine at amino acid position 561 was replaced by aspartic acid, and the proline (Pro) at amino acid position 247 was replaced by cysteine ​​(Cys). The produced CJL8100_leuA_P247C was named "CA13-8105" and was deposited in the Korean Collection of Microorganisms (KCCM), an international depository under the Budapest Treaty, on April 29, 2020, under the given deposit number. The amino acid sequence of the LeuA variant comprising three mutations (P247C, R558H, G561D) and the nucleotide sequence of the leuA variant encoding the same are identical to SEQ ID NO: 5 and SEQ ID NO: 6, respectively.

[0171] The L-leucine production capacity of ATCC13032, the produced CJL-8100, and CA13-8105 strains was evaluated. Specifically, flask cultures were performed in the same manner as in Example 2-2. After completion of the cultures, L-leucine production of the parent strain and the mutant strains was measured by HPLC. The results are shown in Table 8 below.

[0172]

Table 8

[0173] Strain name L-Leucine (g / L) ATCC13032 0.87 ATCC13032_leuA_(R558H, G561D): CJL-8100 2.71 CJL8100_leuA_P247C:CA13-8105 3.52

[0174] As shown in Table 8, the L-leucine-producing strain Corynebacterium glutamicum CJL8100 increased L-leucine production by approximately 130% compared to its parent strain ATCC13032. The CA13-8105 strain, which additionally introduced the leuA_P247C mutation into CJL8100, increased L-leucine production by approximately 150% compared to the parent strain CJL8100. These results confirm that amino acid position 247 in the amino acid sequence of the LeuA protein is a key position for L-leucine production activity.

[0175] Example 4-4. Measurement of isopropylmalate synthase activity in strains into which LeuA variants were introduced

[0176] In order to measure the activity of isopropylmalate synthase in the L-leucine-producing strains CJL-8100 and CA13-8105 produced in Example 4-3, an experiment was conducted by the following method.

[0177] Bacterial strains (CJL-8100, CA13-8105) and wild type ATCC13032 were inoculated into 250 ml angle baffled flasks containing 25 ml of each seed culture medium (production culture medium in Table 2) using a platinum loop, and then cultured at 30°C with an oscillation rate of 200 rpm for 16 hours. After the culture was complete, the culture solution was centrifuged, the supernatant was discarded, the precipitate was suspended and washed with lysis buffer, and the cells were broken with a bead homogenizer. Protein quantification in the lysate was based on the Bradford assay and a lysate containing 100 μg / ml protein was used. Due to the use of the CoA produced at this time to reduce the thionitrobenzoate (TNB) formed by DTNB (5,5′-dithiobis-(2-nitrobenzoic acid), Ellman's reagent), the activity of isopropylmalate synthase was measured by measuring the absorbance change at 412 nm.

[0178] The results of the determination of isopropylmalate synthase activity in each strain are shown in Table 9 below.

[0179]

Table 9

[0180]

[0181] Next, to confirm the extent of release of feedback inhibition by leucine, the activity of isopropylmalate synthase was measured by measuring the amount of CoA produced using a solution containing 100 μg / mL protein in the presence of 2 g / L leucine. The results of isopropylmalate synthase activity measurements for each strain are shown in Table 10 below.

[0182]

Table 10

[0183]

[0184] As shown in Tables 9 and 10, the L-leucine-producing strains CJL-8100 and CA13-8105 transformed with the LeuA mutant expression vector demonstrated 1.13-fold and 1.21-fold increases in isopropylmalate synthase activity, respectively, compared to the control strain, Corynebacterium glutamicum ATCC13032. Furthermore, even when supplemented with 2 g / l of leucine, the L-leucine-producing strains maintained isopropylmalate synthase activity at 78% and 88%, respectively, indicating that feedback inhibition by leucine was released.

[0185] In summary, those skilled in the art to which the present invention pertains will appreciate that the present invention may be implemented in other specific forms without changing the technical concept or essential features of the present invention. In this regard, the exemplary embodiments disclosed herein are for illustrative purposes only and should not be construed as limiting the scope of the present invention. On the contrary, the present invention is intended to encompass not only the exemplary embodiments, but also various alternatives, modifications, equivalents, and other embodiments that may be included within the spirit and scope of the present invention as defined by the appended claims.

[0186]

Accession number

[0187] Name of depository institution: Korea Collection of Microorganisms

[0188] Accession number: KCCM12709P

[0189] Date of deposit: April 29, 2020

[0190] (Chinese translation)

[0191] International Form of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure

[0192] To: CJ CheilJedang Co., Ltd.

[0193] 330 Dongho-ro, Jung-gu, Seoul, South Korea

[0194] CJ CheilJedang Center

[0195] (Zip Code) 100-400

[0196]

[0197] The above translation does not contradict the original text.

Claims

1. A mutant polypeptide having isopropylmalate synthase activity, wherein: The amino acid sequence of the mutant polypeptide is as follows: (i) the proline amino acid residue at position 247 in the amino acid sequence of SEQ ID NO: 1, or (ii) the proline amino acid residue at position 212 in the amino acid sequence of SEQ ID NO: 16 is replaced by cysteine. 2 . The mutant polypeptide according to claim 1 , comprising the amino acid sequence of SEQ ID NO:

3.

3. The mutant polypeptide according to claim 1, wherein: The arginine amino acid residue at position 558 in the amino acid sequence of SEQ ID NO: 1 is substituted with a histidine amino acid residue, and The glycine amino acid residue at position 561 in the amino acid sequence of SEQ ID NO: 1 is substituted with an aspartic acid amino acid residue.

4. The mutant polypeptide according to claim 3, wherein The mutant polypeptide comprises the amino acid sequence of SEQ ID NO:

5.

5. A polynucleotide encoding the mutant polypeptide according to any one of claims 1 to 4. A vector comprising the polynucleotide according to claim 5 .

7. A microorganism comprising at least one selected from the group consisting of a mutant polypeptide according to any one of claims 1 to 4, a polynucleotide encoding the mutant polypeptide, and a vector comprising the polynucleotide, wherein: The microorganism is Corynebacterium glutamicum.

8. The microorganism according to claim 7, wherein The microorganism has the ability to produce L-leucine.

9. A method for producing L-leucine, comprising the step of culturing the microorganism according to claim 7 in a culture medium.

10. The method for producing L-leucine according to claim 9, wherein The method further comprises the step of collecting L-leucine from the cultured medium or the microorganism.

11. A composition for producing L-leucine, comprising at least one selected from the group consisting of a mutant polypeptide according to any one of claims 1 to 4; a polynucleotide encoding the mutant polypeptide; a vector comprising the polynucleotide; and a microorganism comprising the polypeptide, the polynucleotide or the vector.

12. A method for producing L-leucine comprising: selecting from at least one of a mutant polypeptide according to any one of claims 1 to 4; a polynucleotide encoding the mutant polypeptide; a vector comprising the polynucleotide; and a microorganism comprising the polypeptide, the polynucleotide or the vector.

Images