Engineered Bacteria Expressing Aspartate Dehydrogenase and Method for Fermentative Production of Vitamin B5

Abstract

The present invention relates to the field of microorganisms, and specifically relates to Escherichia coli expressing the aspartate dehydrogenase gene aspDH and a method for its use in fermentative production of vitamin B5 (VB5). By comparing the fermentation yields of VB5, the effect of overexpressing the aspDH gene is the best. Compared with the highly polluting chemical method for producing vitamin B5, the biological method for producing vitamin B5 in the present invention has the advantages of renewable raw materials, easy treatment and resource utilization of waste residues, waste water and waste gas, and thus can be practically used for the industrial production of vitamin B5 and has important application value.

Description

Technical Field

[0001] The present invention relates to the field of microorganisms, and particularly to an engineered bacterium expressing aspartate dehydrogenase and a method for fermentative production of vitamin B5. Background Art

[0002] Vitamin B5 (also known as D-Pantothenic acid, VB5) is a water-soluble vitamin and is a component of coenzyme A and acyl carrier protein. As a cofactor for more than 70 enzymes, it participates in the metabolism of carbohydrates, fats, proteins, and energy, and plays an important role in physiological metabolism regulation. VB5 is mainly used in animal feed additives, food additives, and pharmaceutical raw materials. With the discovery of new functions of VB5 and the expansion of its application fields, its market demand will still show a stable growth trend.

[0003] China is the largest producer and exporter of VB5 in the world. The industrial production method of VB5 is chemical synthesis. Enterprises basically use the isobutyraldehyde-formaldehyde-hydrocyanic acid method to synthesize DL-pantolactone. DL-pantolactone is further obtained by chemical or enzymatic resolution to obtain L-pantolactone. Finally, L-pantolactone reacts with β-alanine produced from acrylonitrile to synthesize VB5. The main raw materials for chemical synthesis of VB5 are flammable, explosive, and highly toxic. Cyanide-containing wastewater will be generated during the production process, which is difficult to treat, resulting in VB5 becoming a heavily polluting industry.

[0004] In recent years, the impact of environmental protection on the VB5 industry has gradually emerged. Under large-scale and high-intensity environmental governance, highly polluting VB5 enterprises have limited production or even stopped production, resulting in a shortage of market supply and skyrocketing prices, which has restricted the healthy development of downstream feed, food, and pharmaceutical industries. Before significant improvements are made to the highly polluting VB5 production technology, such a supply-demand situation will continue for a long time. Therefore, the innovation of VB5 green manufacturing technology is extremely urgent!

[0005] The production of VB5 by microbial fermentation not only uses renewable glucose as a raw material, but also the waste residues, waste water and waste gas formed during the production process are easy to treat and resourcefully utilize, which can effectively solve the high pollution problem of the VB5 industry. The regulatory mechanism of the metabolic pathway by which microorganisms utilize glucose to synthesize VB5 is complex, and the fermentation yield is extremely low. β-alanine, as a C3 substrate, combines with D-pantothenic acid to synthesize VB5. In order to improve the fermentation yield of VB5, a large amount of β-alanine needs to be supplemented externally in the fermentation medium (Sahm, H., et al., (1999) Appl Environ Microb, 65, 1973-1979; Dusch, N., et al., (1999) Appl Environ Microb, 65, 1530-1539; Zhang, B., et al., (2019) Food Chemistry, 294, 267-275.). β-alanine can be produced by the decarboxylation of L-aspartic acid. Therefore, enhancing the biosynthesis of aspartic acid is expected to increase the yield of VB5 produced by fermentation. Summary of the Invention

[0006] In view of this, by overexpressing the above three enzymes in Escherichia coli for the production of VB5 by fermentation, the present invention found that AspDH is more conducive to improving the fermentation yield of VB5 than AspC and AspA.

[0007] In order to achieve the above invention objectives, the present invention provides the following technical solutions:

[0008] In the first aspect, the present invention provides the application of enhancing the expression of the aspartate dehydrogenase gene aspDH in the production of vitamin B5;

[0009] Preferably, the aspartate dehydrogenase gene aspDH is derived from Delftia sp. Csl-4.

[0010] In some specific embodiments of the present invention, the aspartate dehydrogenase gene aspDH has:

[0011] (I) a nucleotide sequence as shown in SEQ ID No. 55; or

[0012] (II) a nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence as shown in (I), and having the same or similar function as the nucleotide sequence as shown in (I); or

[0013] (III) a nucleotide sequence having at least 80% homology with the nucleotide sequence as shown in (I) or (II).

[0014] In some specific embodiments of the present invention, it further includes:

[0015] (1) Insert a strong promoter and / or a strong RBS into the cadA gene, wherein the strong promoter is PgapA and the strong RBS is BCD2;

[0016] Preferably, the BCD2 has:

[0017] (A) a nucleotide sequence as shown in SEQ ID No. 2; or

[0018] (B) a nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence as shown in (A), and having the same or similar function as the nucleotide sequence as shown in (A); or

[0019] (C) a nucleotide sequence having at least 80% homology with the nucleotide sequence as shown in (A) or (B);

[0020] and / or

[0021] (2) Express the ilvGM gene derived from Escherichia coli BL21; and / or

[0022] (3) Express the L-aspartate α-decarboxylase gene panD derived from Bacillus licheniformis; and / or

[0023] Preferably, the L-aspartate α-decarboxylase gene panD derived from Bacillus licheniformis has:

[0024] (a) a nucleotide sequence as shown in SEQ ID No. 1; or

[0025] (b) a nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence as shown in (a), and having the same or similar function as the nucleotide sequence as shown in (a); or

[0026] (c) a nucleotide sequence having at least 80% homology with the nucleotide sequence as shown in (a) or (b); and / or

[0027] (4) Increase the copy number of the panB, panC and / or panE genes.

[0028] In a second aspect, the present invention also provides an expression vector comprising the aspartate dehydrogenase gene aspDH; preferably, the aspartate dehydrogenase gene aspDH is derived from Delftia sp. Csl-4;

[0029] Preferably, the aspartate dehydrogenase gene aspDH has:

[0030] (I) a nucleotide sequence as shown in SEQ ID No. 56; or

[0031] (II) a nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence as shown in (I), and having the same or similar function as the nucleotide sequence as shown in (I); or (III) a nucleotide sequence having at least 80% homology with the nucleotide sequence as shown in (I) or (II).

[0032] In some specific embodiments of the present invention, the expression vector further comprises:

[0033] (i) a strong promoter and / or a strong RBS;

[0034] wherein the strong promoter is PgapA and the strong RBS is BCD2;

[0035] Preferably, the BCD2 has:

[0036] (A) a nucleotide sequence as shown in SEQ ID No. 2; or

[0037] (B) a nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence as shown in (A), and having the same or similar function as the nucleotide sequence as shown in (A); or

[0038] (C) a nucleotide sequence having at least 80% homology with the nucleotide sequence as shown in (A) or (B);

[0039] and / or

[0040] (ii) the ilvGM gene derived from Escherichia coli BL21; and / or

[0041] (iii) the L-aspartate α-decarboxylase gene panD derived from Bacillus licheniformis; and / or

[0042] Preferably, the L-aspartate α-decarboxylase gene panD derived from Bacillus licheniformis has:

[0043] (a) a nucleotide sequence as shown in SEQ ID No. 1; or

[0044] (b), a nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence as shown in (a), and a nucleotide sequence having the same or similar function as the nucleotide sequence shown in (a); or

[0045] (c), a nucleotide sequence having at least 80% homology with the nucleotide sequence shown in (a) or (b); and / or

[0046] (iv), the panB, panC, and / or panE genes with increased copy numbers.

[0047] In a third aspect, the present invention also provides a host expressing the aspartate dehydrogenase gene aspDH;

[0048] Preferably, the aspartate dehydrogenase gene aspDH is derived from Delftia sp. Csl-4;

[0049] Preferably, the aspartate dehydrogenase gene aspDH has:

[0050] (I), a nucleotide sequence as shown in SEQ ID No. 56; or

[0051] (II), a nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence as shown in (I), and a nucleotide sequence having the same or similar function as the nucleotide sequence shown in (I); or

[0052] (III), a nucleotide sequence having at least 80% homology with the nucleotide sequence shown in (I) or (II).

[0053] In some specific embodiments of the present invention, the host further includes:

[0054] (i), a strong promoter and / or a strong RBS;

[0055] wherein the strong promoter is PgapA and the strong RBS is BCD2;

[0056] Preferably, the BCD2 has:

[0057] (A), a nucleotide sequence as shown in SEQ ID No. 2; or

[0058] (B), a nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence as shown in (A), and a nucleotide sequence having the same or similar function as the nucleotide sequence shown in (A); or

[0059] (C), a nucleotide sequence having at least 80% homology with the nucleotide sequence shown in (A) or (B);

[0060] and / or

[0061] (ii), the ilvGM gene derived from Escherichia coli BL21; and / or

[0062] (iii), the L-aspartate α-decarboxylase gene panD derived from Bacillus licheniformis; and / or

[0063] Preferably, the L-aspartate α-decarboxylase gene panD derived from Bacillus licheniformis has:

[0064] (a), the nucleotide sequence shown in SEQ ID No.1; or

[0065] (b), the nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence shown in (a), and having the same or similar function as the nucleotide sequence shown in (a); or

[0066] (c), the nucleotide sequence having at least 80% homology with the nucleotide sequence shown in (a) or (b); and / or

[0067] (iv), the panB, panC and / or panE genes with increased copy number.

[0068] In some specific embodiments of the present invention, the host is transfected or transformed with the expression vector as claimed in claim 4 or 5;

[0069] Preferably, the host is derived from Escherichia coli, preferably Escherichia coli K12, more preferably Escherichia coli K12MG1655 strain.

[0070] Fourthly, the present invention also provides the use of the expression vector or the host in the production of vitamin B5.

[0071] Fifthly, the present invention also provides a method for producing vitamin B5, using the host as a fermentation strain, fermenting, collecting the fermentation broth, centrifuging to take the supernatant, and obtaining vitamin B5.

[0072] The present invention discloses an Escherichia coli expressing the aspartate dehydrogenase gene aspDH and a method for fermentatively producing vitamin B5 (VB5). In the VB5 engineering bacteria of the present invention, three pathways for synthesizing L-aspartic acid are enhanced respectively. One is the aspartate aminotransferase encoded by the aspC gene, which transfers the amino group of glutamate to oxaloacetic acid to produce L-aspartic acid and ketoglutaric acid; another is the aspartate ammonia-lyase encoded by the aspA gene, which catalyzes ammonium and fumaric acid to produce aspartic acid; and the third is the aspartate dehydrogenase encoded by the aspDH gene, which catalyzes the synthesis of aspartic acid from oxaloacetic acid and ammonium. By comparing the fermentation yields of VB5, the effect of overexpressing the aspDH gene is the best. Compared with the highly polluting chemical method for producing vitamin B5, the biological method for producing vitamin B5 in the present invention has the advantages of renewable raw materials, easy treatment and resource utilization of waste residues, waste water and waste gas, and thus can be used for the industrial production of vitamin B5 in practice and has important application value. Detailed implementation mode

[0073] The present invention discloses an engineering bacterium expressing aspartate dehydrogenase and a method for fermentatively producing vitamin B5. Those skilled in the art can draw on the content of this article and appropriately modify the process parameters to achieve it. It should be particularly noted that all such substitutions and modifications are obvious to those skilled in the art and are all considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and those skilled in the art can obviously make changes or appropriate modifications and combinations to the methods and applications described herein without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0074] Escherichia coli has two pathways for producing aspartic acid. One can be through the aspartate aminotransferase encoded by the aspC gene, which transfers the amino group of glutamate to oxaloacetic acid to produce L-aspartic acid and ketoglutaric acid; the other is through the aspartate ammonia-lyase encoded by the aspA gene, which catalyzes ammonium and fumaric acid to produce aspartic acid. In addition, aspartate dehydrogenase (AspDH), which catalyzes the synthesis of aspartic acid from oxaloacetic acid and ammonium, has also been found in some archaea. By overexpressing the above three enzymes respectively in Escherichia coli for fermentatively producing VB5 in the present invention, it is found that AspDH is more beneficial to improving the fermentation yield of VB5 than AspC and AspA.

[0075] In order to break through the metabolic bottleneck of highly efficient synthesis of vitamin B5, the inventor compared three pathways for improving aspartic acid synthesis and found that the heterologous aspartate dehydrogenation (encoded by the aspDH gene) pathway is more suitable for its own aspartate transamination pathway (encoded by the aspC gene) and aspartate ammonia-lysis pathway (encoded by the aspA gene).

[0076] An aspartate dehydrogenase (AspDH) that catalyzes the reversible reaction of oxaloacetate with ammonium and NAD(P)H to produce aspartate, water, and NAD(P)+, which is produced by one or more of the following microorganisms: Pseudomonas aeruginosa, Klebsiella pneumoniae, Serratia proteamaculans, Thermotoga maritima, Chromohalobacter salexigens, Acinetobacter baumannii, Delftia sp. Csl-4, Ochrobactrum anthropi, Caulobacter sp., Methanohalophilus mahii, Dinoroseobacter shibae, Methanosphaerula palustris, Methanobrevibacter ruminantium, etc.

[0077] In terms of the expressed aspartate dehydrogenase, the present invention uses a strong promoter to regulate the expression of the aspDH gene. The promoter can be the following promoter or its mutant: L promoter, trc promoter, T5 promoter, lac promoter, tac promoter, T7 promoter, or gapA promoter. In addition, the present invention uses a relatively strong RBS sequence to regulate the translation initiation of the aspDH gene.

[0078] The present invention integrates the aspDH gene regulated by the above high-strength translation initiation and transcription initiation into the chromosome of Escherichia coli for the fermentation production of VB5 to achieve the expression of foreign genes. The integration site is the cadA gene, which encodes lysine decarboxylase and theoretically has no effect on the biosynthesis of VB5.

[0079] At the same cadA gene locus on the chromosome of Escherichia coli for the fermentation production of VB5, the aspA and aspC genes are respectively integrated, and the same promoter is used to regulate transcription to compare the effects of overexpressing the aspA, aspC, and aspDH genes on VB5 synthesis.

[0080] The Escherichia coli for producing VB5 by fermentation method in the present invention also overexpresses the panB, panC and panE genes on the terminal synthesis pathway of VB5. The panB gene of Escherichia coli encodes ketopantoate hydroxymethyltransferase, which catalyzes the addition of a methyl group to the substrate α-ketoisovalerate to form ketopantoic acid. Ketopantoic acid is reduced to pantoic acid by the ketopantoate reductase encoded by the panE gene. The pantothenate synthetase encoded by the panC gene further catalyzes the condensation of pantoic acid and β-alanine to form VB5.

[0081] The Escherichia coli used in the present invention is the K12 MG1655 strain, in which the ilvG gene is mutated and inactivated. Therefore, the present invention introduces the active ilvG gene of Escherichia coli BL21, which improves the synthesis supply of the VB5 precursor acetolactate. The present invention inserts the ilvG+M gene derived from Escherichia coli BL21 into the chromosome of Escherichia coli K12 MG1655, and uses the trc strong promoter to regulate the transcription initiation of ilvG+M, and uses the terminator Ter to regulate the transcription termination of ilvG+M. The insertion site of the ilvG+M gene on the chromosome is the coding sequence of the avtA gene, resulting in the inactivation of AvtA, weakening the synthesis of valine, thus weakening the competitive pathway of VB5 and being beneficial to the biosynthesis of VB5.

[0082] The panD gene derived from Bacillus licheniformis is also integrated into the avtA gene of the engineered bacteria. The same strong promoters PPL and BCD2 are used to regulate the transcription and translation initiation respectively.

[0083] The method for fermenting and producing VB5, the culture medium contains a carbon source, a nitrogen source, inorganic ions, antibiotics and other nutritional factors. As the carbon source, sugars such as glucose, lactose, galactose, etc. can be used. As the inorganic nitrogen source, inorganic nitrogen sources such as ammonia water, ammonium sulfate, ammonium phosphate, ammonium chloride, etc. can be used; as the organic nitrogen source, organic nitrogen sources such as corn steep liquor, hydrolyzed soybean meal, hair powder, yeast extract, peptone, etc. can be used. The inorganic ions include one or more of iron, calcium, magnesium, manganese, molybdenum, cobalt, copper, potassium ions, etc.

[0084] The experimental methods in the following examples are all conventional methods unless otherwise specified. The test materials used in the following examples are all obtained from regular biochemical reagent stores unless otherwise specified. The quantitative tests in the following examples are all set with three repeated experiments, and the results are averaged. Unless otherwise specified in the following examples, the technical means used in the examples are the conventional means well known to those skilled in the art and the commonly used instruments and reagents on the market. Reference can be made to "Molecular Cloning Experiment Guide (3rd Edition)" (Science Press), "Microbiology Experiment (4th Edition)" (Higher Education Press) and the manufacturer's instructions of the corresponding instruments and reagents.

[0085] If the sequence recorded in the specification is inconsistent with that in the sequence listing, the sequence recorded in the specification shall prevail.

[0086] Escherichia coli K12 MG1655: The ATCC number is 700926. pACYC184 plasmid: NEB, product catalog number E4152S. Plasmid pcas9 was purchased from Addgene, cat. no. 62225; plasmid pTargetF was purchased from Addgene, cat. no. 62226.

[0087] The present invention will be further described below in conjunction with the embodiments:

[0088] Example 1 Detection method

[0089] The production of VB5 in the fermentation broth was quantitatively determined by HPLC. The specific method is as follows. Take the supernatant of the fermentation broth, dilute it with pure water to an appropriate concentration, and filter it through a 0.22 μm filter membrane. The chromatographic column used was an Agilent ZORBAX SB-Aq, 4.6x250 mm, the column temperature was 30 °C, the detection wavelength was 210 nm, and the mobile phase flow rate was 1 mL / min. The mobile phase was 3.12 g / L NaH2PO4·2H2O, and the pH was adjusted to 2.2 with phosphoric acid. Using calcium pantothenate (VB5) purchased from sigma company as the standard product, the standard curve of the concentration of 0.1 - 0.5 g / L calcium pantothenate and the light absorption value was measured.

[0090] Example 2 Construction of an engineering bacterium for fermentative production of VB5

[0091] Using P1 and P2 as primers, with the genomic DNA of the wild-type Escherichia coli K12 MG1655 strain as the template, using the high-fidelity polymerase KAPA HiFi TM HotStar, the nucleotide sequence amplified by PCR is as shown in SEQ ID No.3, where 10nt - 45nt is the promoter trc, 74nt - 868nt is the coding sequence of the panB gene, and 880nt - 1731nt is the coding sequence of the panC gene. A strong promoter trc was designed and introduced on primer P1, and BamHI and SphI restriction endonuclease sites were designed at the 5' ends of primers P1 and P2 respectively. The PCR program was: denaturation at 98 °C for 30 seconds, annealing at 65 °C for 15 seconds, extension at 72 °C for 90 seconds, for 26 cycles, to obtain the P trc -panBC gene fragment.

[0092]

[0093] (As shown in SEQ ID No.10, the underlined sequence is the BamHI restriction enzyme recognition site, and the italic is the sequence of the promoter trc)

[0094] P2: 5'-ACAT GCATGC CCTGTGTTAT GACAGATGAC-3'

[0095] (As shown in SEQ ID No.11, the underlined sequence is the recognition site for SphI digestion)

[0096] The P trc -panBC product obtained by PCR amplification was identified by gel electrophoresis, recovered, digested with BamHI and SphI simultaneously, and the pACYC184 plasmid was also digested with the same two enzymes. The PCR electrophoresis band was recovered by cutting the gel, and the amplified P trc -panBC gene DNA fragment and the pACYC184 plasmid were digested with the two enzymes. The double-digested Ptrc-panBC and pACYC184 plasmids were recovered by gel electrophoresis, ligated using T4 ligase, and the ligation product was chemically transformed into competent Escherichia coli DH5α cells. After 1 hour of recovery, the cells were spread on a chloramphenicol plate. The plated plate was placed in a 37°C incubator for 12 hours, single colonies were picked for subculture, and the recombinant plasmid was extracted and sequenced to obtain the correct recombinant plasmid pACYC184-panBC.

[0097] Using the genome of Escherichia coli K12 MG1655 as a template and P3 and P4 as primers, the sequence obtained by PCR amplification is as shown in SEQ ID No.4, where 11nt - 45nt is the PJ23119 promoter, 66nt - 977nt is the coding sequence of the panE gene, and 988nt - 173Int is the terminator sequence. The promoter PJ23119 was designed on the amplification primer P3, and the terminator L3S2P56 sequence was designed on the primer P4. SphI and BsaBI restriction endonuclease sites were designed at the 5' ends of the P3 and P4 primers respectively. Using the above PCR reaction conditions, the amplified PJ23119-panE product was identified by gel electrophoresis, recovered, digested with SphI and BsaBI simultaneously, and the pACYC184-Ptrc-panBC plasmid was also digested with the same two enzymes. The double-digested PJ23119-panE and pACYC184-panBC plasmids were recovered by gel electrophoresis, ligated using T4 ligase, and the ligation product was chemically transformed into competent Escherichia coli DH5α cells. After 1 hour of recovery, the cells were spread on a chloramphenicol plate. The plated plate was placed in a 37°C incubator for 12 hours, single colonies were picked for subculture, and the recombinant plasmid was extracted and sequenced to obtain the correct recombinant plasmid pACYC184-panBCE, thus obtaining a recombinant plasmid overexpressing the genes of the vitamin B5 terminal synthesis pathway.

[0098]

[0099] (As shown in SEQ ID No.12, the underlined sequence is the recognition site for SphI digestion, and the italicized part is the sequence of promoter J23119)

[0100]

[0101] (As shown in SEQ ID No.13, the underlined sequence is the recognition site for BsaBI digestion, and the italicized part is the sequence of L3S2P56 terminator)

[0102] The reported CRISPR-Cas9 gene editing system containing pCas9 and pTargetF vectors was applied (Jiang, Y., Chen, B., Duan, C.L., Sun, B.B., Yang, J.J., and Yang, S. (2015) Multigene Editing in the Escherichia coli Genome via the CRISPR-Cas9 System, Appl Environ Microb 81, 2506-2514.).

[0103] The gene mutation kit from NEB company ( Site-Directed Mutagenesis Kit, product number E0552S) was used to design primers P5 and P6 to mutate the pTargetF vector according to the kit instructions. The mutated N20 sequence is CTTTCCAAGC TGGGTCTACC, targeting the avtA gene. The mutated pTargetF was named pTargetFavtA.

[0104] P5: TGGGTCTACCG TTTTAGAGCT AGAAATAGC (as shown in SEQ ID NO.14);

[0105] P6: GCTTGGAAAG GACTAGTATT ATACCTAGG (as shown in SEQ ID NO.15);

[0106] P7: CG GACTGGAAGA AGATCTG (as shown in SEQ ID NO.16);

[0107] P8: TTTCTTAGAC GTCGGAATTG AGACTCATGC ACAGCACGA (as shown in SEQ ID NO.17);

[0108] P9: TCGTGCTGT GCATGAGT CTCAATTCCGACGTCTAAGAAAC (as shown in SEQ ID NO.18);

[0109] P10: GATCTCCTTT TTAAGTGAAC TTGGGGTCAG TGCGTCCTGC TGAT (as shown in SEQ ID NO.19);

[0110] P11: ATCAGCAGGACGCACTGACCCCAAGTTCACTTAAAAAGGAGA TC (as shown in SEQ ID NO.20);

[0111] P12: TGCCGTTCAT ATTGGTGATG CAAAAAACCC CTCAAGACC (as shown in SEQ ID NO.21);

[0112] P13: GGTCTTGAGGGGTTTTTTGCATC ACCAATATGAACGGCA (as shown in SEQ ID NO.22);

[0113] P14: GCTGATAGAG CTGCTTGGT (as shown in SEQ ID NO.23);

[0114] P15: GGAGCTACTC ACACTGCTTG (as shown in SEQ ID NO.24);

[0115] P16: CGCATACATT GATGCGTATG (as shown in SEQ ID NO.25).

[0116] The aspartate α-decarboxylase gene panD (as shown in SEQ ID No.1) from Bacillus licheniformis was synthesized by a gene synthesis company. When custom-synthesizing the above panD gene sequence, the XbaI and HindIII restriction endonuclease sequences were removed by synonymous codon substitution. When custom-synthesizing the above panD gene sequence, the same BCD2 sequence (as shown in SEQ ID No.2) was synthesized in front of each panD sequence, and XbaI and HindIII restriction enzyme cleavage sites were added to both ends of the BCD2-panD sequence. The synthesized sequence was ligated to a vector. The synthesized BCD2-panD vector and the pET28a(+) plasmid were double-digested with the restriction endonucleases XbaI and HindIII, and the digested BCD2-panD gene fragment and the linearized vector fragment were recovered by gel electrophoresis. Then, the two fragments were further ligated using T4 ligase, and the ligation product was transformed into competent Escherichia coli DH5α cells and screened on an LB plate containing 50 mg / L kanamycin to obtain transformants containing the recombinant plasmid. After the transformants were expanded and cultured, the plasmid was extracted and sent for sequencing to verify the correct plasmid.

[0117] pET28a-BCD2-panDBl.

[0118] The upstream sequence of the avtA gene was amplified using primers P7 and P8, the PL promoter was amplified using primers P9 and P10, the BCD2-panDBl-Ter gene fragment was amplified using primers P11 and P12 with pET28a-BCD2-panDBl as the template, and the downstream sequence of the avtA gene was amplified using primers P13 and P14. The above 4 fragments were ligated by overlap PCR to obtain a combination of 4 DNA fragments, DonorBl (as shown in SEQ ID No.5), as the template for gene editing. Among them, Int-312nt of SEQ ID No.5 is the upstream sequence of the target gene avtA, 313nt-474nt is the PL promoter, 475nt-560nt is the BCD2 sequence, 560nt-943nt is the panDBl sequence, 944nt-995nt is the terminator sequence, and 996-1261nt is the downstream sequence of the avtA gene.

[0119] The pCas9 plasmid was transformed into MG1655 and spread on a kanamycin-resistant plate containing 50 mg / L kanamycin, and cultured at 30 °C to obtain the strain MG655 / pCas9. A single colony of MG1655 / pCas9 was picked and inoculated into a 500 mL shake flask containing 50 mL of LB with kanamycin, and cultured at 30 °C and 220 rpm. When the OD600 of the medium reached 0.2, arabinose with a final concentration of 10 mM was added for induction, and competent cells were prepared when the OD600 reached 0.45. 2 μL of the pTargetFavtA plasmid and 10 μL of the DonorBs template DNA were taken and electrotransformed into the MG655 / pCas9 competent cells, and spread on a double-resistant plate containing 50 mg / L kanamycin and 50 mg / L spectinomycin, and cultured at 30 °C. Primers P15 and P16 were used to identify the single colonies integrating PPL-BCD2-panD-Ter on the avtA gene, and the PCR products with the correct size were verified by sequencing. The single colonies with correct sequencing were selected, cultured with 0.2 mM IPTG to eliminate the pTargetFavtA plasmid, and the engineered strains E. coli MG1655 avtA:panDBl / pCas were obtained respectively. Competent cells were still prepared according to the above method for standby.

[0120] The engineered strain E. coli MG1655 avtA:panDBl / pCas was inoculated into a non-resistant LB liquid medium and cultured at 37 °C for 12 hours, then diluted and spread on an LB plate to obtain the engineered strain E. coli MG1655 avtA:panDBl that had eliminated the pCas plasmid. The gene panD was inserted into the coding sequence of the chromosomal avtA gene, resulting in the inactivation of AvtA and weakening the valine competitive metabolic pathway.

[0121] The ilvG gene of the wild-type Escherichia coli K12 MG1655 was mutated, and the encoded acetolactate synthase had no activity. In the present invention, an active ilvG gene of Escherichia coli BL21 was introduced into the chromosome of Escherichia coli MG1655, improving the synthesis of acetolactate, the precursor of VB5. In the present invention, the ilvG+M gene derived from Escherichia coli BL21 was inserted into the chromosome of Escherichia coli K12 MG1655, and the trc strong promoter was used to regulate the transcriptional initiation of ilvG+M, and the terminator Ter was used to regulate the transcriptional termination of ilvG+M. The ilvG+M gene was integrated into another N20 target sequence of the avtA gene. Using the above Mutation kit and primers P17 and P18 were used to mutate the pTargetF vector, and the mutated pTargetF was named pTargetFavtA1.

[0122] P17: ACGGTCCACAG TTTTAGAGCT AGAAATAGC (as shown in SEQ ID NO.26);

[0123] P18: CGTAGTTACA GACTAGTATT ATACCTAGG (as shown in SEQ ID NO.27);

[0124] P19: GGCAGAAAAT CAGCCAGTTC (as shown in SEQ ID NO.28);

[0125] P20: TCCACACATT ATACGAGCCG GATGATTAAT TGTCAAGAAC TCTGTAGCAA GGAAGG (as shown in SEQ ID NO.29);

[0126] P21: TTGA CAATTAATCATCCGGCTCGTATAATGTGTGGA CAAGATT CAGGACGGGG AAC (as shown in SEQ ID NO.30);

[0127] P22: CGAAAAAAGA CGCTCTAAAA GCGTCTCTTT TCTGGTATAT TCCTTTTGCG CTCAG (as shown in SEQ ID NO.31);

[0128] P23: CAGAAAAGAGACGCT TTTAG AGCGTCTTTTTTCGTTTTGGAGC TACTC ACACTGCTTG (as shown in SEQ ID NO.32);

[0129] P24: GCCAATATGC AGATGCTCATGAGCATCTGCATATTGG C (as shown in SEQ ID NO.33);

[0130] P25: CACGTTCGGA TATGAACTG (as shown in SEQ ID NO.34);

[0131] P26: CGTCAAGCTT CAGCAACTC (as shown in SEQ ID NO.35).

[0132] The upstream sequence of the avtA gene was amplified using primers P19 and P20, the ilvG + M sequence of E. coli BL21 was amplified using primers P21 and P22, and the downstream sequence of the avtA gene was amplified using primers P23 and P24.

[0133] The trc promoter TTGA CAATTAATCATCCGGCTCGTATAATGTGTGGA was introduced by primers P20 and P21, and the terminator sequence CCAGAAAAGAGACGCT TTTAG AGCGTCTTTTTTCGTTTT was introduced by primers P22 and P23. The above three fragments were ligated by overlapping PCR to obtain the construct DonorilvGM (shown in SEQ ID No.6), which was used as the template for gene editing. The 1-305 nt of SEQ ID No.6 is the upstream sequence of the target gene avtA, 306 nt-341 nt is the trc promoter, 367 nt-2013 nt is the ilvG + coding sequence of the gene derived from E.coli BL21, 2010 nt-2273 nt is the coding sequence of the ilvM gene, 2274-2328 is the terminator sequence, and 2329-2629 is the downstream sequence of the avtA gene.

[0134] Take 2 μL of pTargetFavtA1 plasmid and 10 μL of DonorilvGM template DNA, and electrotransform them into E.Coli MG1655 avtA:panDBl / pCas competent cells. Spread them on a double-resistant plate containing 50 mg / L kanamycin and 50 mg / L spectinomycin, and culture at 30 °C. Use primers P25 and P26 to identify the single colonies with Ptrc-ilvG+M-Ter integrated on the avtA gene, and sequence the PCR products with the correct size for verification. Select the single colonies with correct sequencing, add 0.2 mM IPTG for culture to eliminate the pTargetFavtA1 plasmid. Further inoculate into LB liquid medium without resistance and culture at 37 °C for 12 hours, then dilute and spread on LB plates to obtain the engineered strain E.coli MG1655 avtA:panDBl-ilvG + M. By integrating active ilvG + M on the chromosome, the synthesis of the VB5 precursor, acetolactate, was improved.

[0135] Using the above mutation kit and primers P27 and P28 to mutate the N20 sequence of the pTargetF vector. After mutation, pTargetF was named pTargetFcadA.

[0136] P27: TCATATCTCCG TTTTAGAGCT AGAAATAGC (shown in SEQ ID NO.36);

[0137] P28: CTATGAACGT GACTAGTATT ATACCTAGG (as shown in SEQ ID NO.37);

[0138] P29: GTTGCGT GTTCTGCTTC ATC (as shown in SEQ ID NO.38);

[0139] P30: CCAGTTGGTG TTAATGTTTT GCTCCCAACA CATGGGACA (as shown in SEQ ID NO.39);

[0140] P31: TGTCC CATGTGTTGG GAGCA AAACATTAACACCAACTGG (as shown in SEQ ID NO.40);

[0141] P32: CTCCTTAGCA TGATTAAGAT GGTGAATAAA AGGTTGCCTG T (as shown in SEQ ID NO.41);

[0142] P33: A CAGGCAACCTTTTATTCAC CATCTTAATCATGCTAAGGAG (as shown in SEQ ID NO.42);

[0143] P34: GCTAATTTCT TCGCACAGCT GGACCAAAAC GAAAAAAGAC G (as shown in SEQ ID NO.43);

[0144] P35: CGTCTTTTTTCGTTTTGGTCCAGCTGTG CGAAGAAATT AGC (as shown in SEQ ID NO.44);

[0145] P36: TCGTCAGTGG TCTGCTTGA (as shown in SEQ ID NO.45);

[0146] P37: CTAC TCTTGCGTTG ACCTGA (as shown in SEQ ID NO.46);

[0147] P38: GTGACCAGGA GTACAGAAAG (as shown in SEQ ID NO.47).

[0148] Using the Escherichia coli MG1655 genome as a template, the upstream sequence of the cadA gene was amplified using primers P29 and P30, the gapA promoter was amplified using primers P31 and P32, and the downstream sequence of the cadA gene was amplified using primers P35 and P36. The aspDH gene containing the RBS and terminator was synthesized from a gene synthesis company, and the RBS-aspDH-Ter sequence was amplified using primers P33 and P34. The above four fragments were ligated by overlapping PCR to obtain the construct DonoraspDH (shown in SEQ ID No.7), which was used as a template for gene editing. The 1-210 nt of SEQ ID No.7 is the upstream sequence of the target gene cadA, 211 nt-480 nt is the gapA promoter, 481 nt-509 nt is the RBS sequence, 510 nt-1307 nt is the coding sequence of the aspDH gene from Delftia sp. Csl-4 (shown in SEQ ID No.56), 1308 nt-1360 nt is the terminator sequence, and 1361-1535 is the downstream sequence of the cadA gene.

[0149] Take 2 μL of pTargetFcadA plasmid and 10 μL of DonoraspDH template DNA, and electrotransform them into E. coli MG1655 avtA:panDBl-ilvG + M / pCas competent cells, spread them on a double-resistant plate containing 50 mg / L kanamycin and 50 mg / L spectinomycin, and culture at 30 °C. Use primers P37 and P38 to identify the single colonies with PgapA-aspDH-Ter integrated on the cadA gene, and sequence the PCR products with the correct size for verification. Select the single colonies with correct sequencing, add 0.2 mM IPTG for culture to eliminate the pTargetFcadA plasmid. Further inoculate them into a non-resistant LB liquid medium and culture at 37 °C for 12 hours, then dilute and spread them on an LB plate to obtain the engineered strain E. coli MG1655 avtA:panDBl-ilvG + M-aspDH.

[0150] Using the Escherichia coli MG1655 genome as a template, the upstream sequence of the cadA gene was amplified using primers P29 and P30, the gapA promoter was amplified using primers P31 and P39, the aspC gene was amplified using primers P40 and P41, and the downstream sequence of the cadA gene was amplified using primers P42 and P36. The above four fragments were ligated by overlap PCR to obtain the construct DonoraspC (shown in SEQ ID No. 8), which was used as the template for gene editing. The 1-210 nt of SEQ ID No. 8 is the upstream sequence of the target gene cadA, 211 nt - 480 nt is the gapA promoter, 611 nt - 1801 nt is the coding sequence of the aspC gene, and 1992 - 2166 is the downstream sequence of the cadA gene.

[0151] Take 2 μL of pTargetFcadA plasmid and 10 μL of DonoraspC template DNA, and electrotransform them into E. coli MG1655 avtA:panDBl-ilvG + M / pCas competent cells, coat them on a double-resistant plate containing 50 mg / L kanamycin and 50 mg / L spectinomycin, and culture at 30 °C. Use primers P37 and P38 to identify the single colonies with PgapA-aspC integrated into the cadA gene, and sequence the PCR products with the correct size for verification. Select the single colonies with correct sequencing, add 0.2 mM IPTG for culture to eliminate the pTargetFcadA plasmid. Further transfer them into a LB liquid medium without antibiotics and culture at 37 °C for 12 hours, then dilute and coat on LB plates to obtain the engineered strain E. coli MG1655 avtA:panDBl-ilvG + M-aspC.

[0152] P39: GAGATTGCTC TGGAAGGTAT AGTGAATAAA AGGTTGCCTG T (shown in SEQ ID NO. 48);

[0153] P40: A CAGGCAACCTT TTATTCAC TATACCTTCC AGAGCAATCT C (shown in SEQ ID NO. 49);

[0154] P41: GCTAATTTCT TCGCACAGCT CCTGGATTTC TGGCAAAGTG (shown in SEQ ID NO. 50);

[0155] P42: CACTTTGCC AGAAATCCAG GAGCTGTG CGAAGAAATT AGC (shown in SEQ ID NO. 51).

[0156] Using the Escherichia coli MG1655 genome as a template, the upstream sequence of the cadA gene was amplified using primers P29 and P30, the gapA promoter was amplified using primers P31 and P43, the aspA gene was amplified using primers P44 and P45, and the downstream sequence of the cadA gene was amplified using primers P46 and P36. The above 4 fragments were ligated by overlapping PCR to obtain the construct DonoraspA (shown in SEQ ID No. 9), which was used as the template for gene editing. The 1-210 nt of SEQ ID No. 9 is the upstream sequence of the target gene cadA, 211 nt - 480 nt is the gapA promoter, 504 nt - 1940 nt is the coding sequence of the aspA gene, and 2004 - 2178 is the downstream sequence of the cadA gene.

[0157] Take 2 μL of pTargetFcadA plasmid and 10 μL of DonoraspA template DNA, and electrotransform them into E. coli MG1655 avtA:panDBl-ilvG + M / pCas competent cells, coat them on a double-resistant plate containing 50 mg / L kanamycin and 50 mg / L spectinomycin, and culture at 30 °C. Use primers P37 and P38 to identify the single colonies with PgapA-aspA integrated on the cadA gene, and sequence the PCR products with the correct size for verification. Select the single colonies with correct sequencing, add 0.2 mM IPTG for culture to eliminate the pTargetFcadA plasmid. Further inoculate them into a non-resistant LB liquid medium, culture at 37 °C for 12 hours, dilute and coat on an LB plate to obtain the engineered strain E. coli MG1655 avtA:panDBl-ilvG + M-aspA.

[0158] P43: GAACCTTCTT TTTCAAGCTG CGTGAATAAA AGGTTGCCTG T (shown in SEQ ID NO. 52);

[0159] P44: A CAGGCAACCTT TTATTCAC GCAGCTTGAAAAA GAAGGTTC (shown in SEQ ID NO. 53);

[0160] P45: GCTAATTTCT TCGCACAGCT CTGCTCACAA GAAAAAAGGC (shown in SEQ ID NO. 54);

[0161] P46: GCCTTTTTTC TTGTGAGCAGAGCTGTG CGAAGAAATT AGC (shown in SEQ ID NO. 55).

[0162] Transform the above-constructed vector pACYC184-panBCE into the above engineered bacterium E. coli MG1655 avtA:panDBl-ilvG + M-aspDH, E. coli MG1655 avtA:panDBl-ilvG + M-aspC and E. coli MG1655 avtA:panDBl-ilvG + In M-aspA, respectively obtain the engineered bacterium E. coli MG1655 avtA:panDBl-ilvG + M-aspDH / pACYC184-panBCE, E. coli MG1655 avtA:panDBl-ilvG + M-aspC / pACYC184-panBCE and E. coli MG1655 avtA:panDBl-ilvG + M-aspA / pACYC184-panBCE, for the fermentation production of VB5.

[0163] SEQ ID No.1

[0164]

[0165] SEQ ID No.2

[0166]

[0167] SEQ ID No.3

[0168]

[0169]

[0170]

[0171] SEQ ID No.4

[0172]

[0173]

[0174] SEQ ID No.5

[0175]

[0176]

[0177]

[0178] SEQ ID No.6

[0179]

[0180]

[0181]

[0182] SEQ ID No.7 RBS-aspDH-ter L3S2P56

[0183]

[0184]

[0185]

[0186] SEQ ID No.8

[0187]

[0188]

[0189]

[0190] SEQ ID No.9

[0191]

[0192]

[0193]

[0194]

[0195] SEQ ID No.56

[0196]

[0197]

[0198] Example 3 Fermentation Test of VB5 Engineering Bacteria

[0199] Take the test strain engineering bacteria E.coli MG1655 avtA:panDBl-ilvG + M-aspDH / pACYC184-panBCE, E.coli MG1655 avtA:panDBl-ilvG +M-aspC / pACYC184-panBCE and E. coli MG1655 avtA:panDBl-ilvG + M-aspA / pACYC184-panBCE was streaked on a solid LB medium plate containing 34 mg / L chloramphenicol and cultured statically at 37 °C for 12 h. The bacterial colonies on the plate were picked and inoculated into an LB medium slant, and cultured statically at 37 °C for 10 - 12 h. The bacterial colonies on the plate were picked and inoculated into a liquid LB medium, and cultured with shaking at 37 °C and 220 rpm for 12 h to obtain a seed culture. The seed culture was inoculated into the fermentation medium at an inoculation amount of 3%, and cultured with shaking at 37 °C and 220 rpm.

[0200] Fermentation medium: MOPS 80 g / L, glucose 20.0 g / L, ammonium sulfate 10.0 g / L, potassium dihydrogen phosphate 2.0 g / L, magnesium sulfate heptahydrate 2.0 g / L, yeast extract 5.0 g / L, trace element mixture 5 mL / L, and the balance was water. Trace element mixture: FeSO4·7H2O 10 g / L, CaCl2 1.35 g / L, ZnSO4·7H2O 2.25 g / L, MnSO4·4H2O 0.5 g / L, CuSO4·5H2O 1 g / L, (NH4)6Mo7O 24 ·4H2O 0.106 g / L, Na2B4O7·10H2O 0.23 g / L, CoCl2·6H2O 0.48 g / L, 35% HCl 10 mL / L, and the balance was water.

[0201] During the culture process, samples were taken every 4 h, and the pH value of the reaction system was adjusted with ammonia water to maintain it at 6.8 - 7.0. The glucose content was detected using a biosensing analyzer SBA-40D. When the glucose content in the system was lower than 5 g / L, glucose was supplemented to make the glucose concentration in the system reach 20 g / L. After culturing for 24 h, samples were taken, centrifuged at 12000 g for 2 min, and the supernatant was taken to detect the VB5 content (as shown in the following table).

[0202] Table 1

[0203]

[0204] In the present invention, by enhancing three different aspartate-producing pathways in Escherichia coli for the production of VB5 by fermentation, it was found that the engineered strain overexpressing the aspDH gene was more beneficial for improving the fermentation yield of VB5 than the strains overexpressing aspC and aspA.

[0205] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention. Sequence Listing <110> Institute of Microbiology, Chinese Academy of Sciences <120> Engineering Bacteria Expressing Aspartate Dehydrogenase and Method for Fermentative Production of Vitamin B5 <130> IM2022022I <141> 2022-03-07 <160> 56 <170> SIPOSequenceListing 1.0 <210> 1 <211> 384 <212> DNA <213> Artificial Sequence <400> 1 atgtaccgta cgttaatgag cgcaaaactt cacagagcga gagtgacgga agccaatttg 60 aactacgtcg gcagcgtgac aattgatgaa gatttgctgg atgctgtcgg aatgatggca 120 aatgaaaaag tgcaaattgt gaataataat aacggggccc ggctggaaac gtacattatt 180 cccggtgaaa ggggcagcgg cgtcgtttgt ttaaacggag ctgccgcccg ccttgtccag 240 gttggagatg tcgtcatcat cgtgtcttat gcgatgatgt ctgaagagga agcaaagacc 300 cataagccga aggttgccgt tttgaacgag agaaacgaaa tcgaggaaat gctgggtcag 360 gagccagccc gtaccattct gtaa 384 <210> 2 <211> 84 <212> DNA <213> Artificial Sequence <400> 2 ccaagttcac ttaaaaagga gatcaacaat gaaagcaatt ttcgtactga aacatcttaa 60 tcatgctaag gaggttttct aatg 84 <210> 3 <211> 1800 <212> DNA <213> Artificial Sequence <400> 3 cgcggatcct tgacaattaa tcatccggct cgtataatgt gtggagcaca acatcaattt 60 atcaggatac gttatgaaac cgaccaccat ctccttactg cagaagtaca aacaggaaaa 120 aaaacgtttc gcgaccatca ccgcttatga ctatagcttc gccaaactct ttgctgatga 180 agggcttaac gtcatgctgg tgggcgattc gctgggcatg acggttcagg ggcacgactc 240 caccctgcca gttaccgttg ccgatatcgc ctaccacact gccgccgtac gtcgcggcgc 300 accaaactgc ctgctgctgg ctgacctgcc gtttatggcg tatgccacgc cggaacaagc 360 cttcgaaaac gccgcaacgg ttatgcgtgc cggtgctaac atggtcaaaa ttgaaggcgg 420 tgagtggctg gtagaaaccg tacaaatgct gaccgaacgt gccgttcctg tatgtggtca 480 cttaggttta acaccacagt cagtgaatat tttcggtggc tacaaagttc aggggcgcgg 540 cgatgaagcg ggcgatcaac tgctcagcga tgcattagcc ttagaagctg ctggggcaca 600 gctgctggtg ctggaatgcg tgccggttga actggcaaaa cgtattaccg aagcactggc 660 gatcccggtt attggcattg gcgcaggcaa cgtcactgac gggcagatcc tcgtgatgca 720 cgacgccttt ggtattaccg gcggtcacat tcctaaattc gctaaaaatt tcctcgccga 780 aacgggcgac atccgcgcgg ctgtgcggca gtatatggct gaagtggagt ccggcgttta 840 tccgggcgaa gaacacagtt tccattaagg agtcacgttg tgttaattat cgaaaccctg 900 ccgctgctgc gtcagcaaat tcgccgcctg cgtatggaag gcaagcgcgt ggcgctggtg 960 cctaccatgg gtaacctgca cgatggccat atgaagctgg tcgacgaagc caaagcccgc 1020 gccgatgtgg tcgtcgtcag tattttcgtt aacccgatgc agttcgaccg cccggaagat 1080 ctggctcgtt atccacggac cttgcaggag gactgcgaga agctaaacaa acgtaaagtg 1140 gatttagttt tcgccccttc ggtaaaagag atctacccga acggtactga aacccacact 1200 tacgttgacg ttcctggcct ttcgaccatg ctggaaggtg ccagccgtcc gggacatttt 1260 cgcggcgttt cgactattgt cagcaagctg ttcaacctgg tccagccgga catcgcctgc 1320 ttcggtgaaa aagattttca gcaactggcg ctgatccgca aaatggttgc cgatatgggc 1380 ttcgatattg agattgtcgg tgtgccaatt atgcgcgcca aagacggtct ggcgctaagt 1440 tcccgtaacg gttatctgac ggcggaacaa cgcaaaattg cgcctggtct gtacaaagtt 1500 ttaagttcga ttgctgacaa attgcaggct ggggaacggg atctcgatga aattattacc 1560 attgcggggc aagaactgaa tgaaaaaggc ttccgcgccg atgatattca gattcgcgat 1620 gccgacacat tgctggaagt ttctgaaacc agcaaacggg cagtaattct ggtagccgcc 1680 tggcttggcg atgctcgcct gatcgacaac aaaatggtcg agctggcgta atacttaact 1740 ggcgctacgg ctgatggcgc cagttattaa tttaccccac gtcatctgtc ataacacagg 1800 <210> 4 <211> 1044 <212> DNA <213> Artificial Sequence <400> 4 acatgcatgc ttgacagcta gctcagtcct aggtataatg ctagcgttgc gggtgaggag 60 acatgcatgc ttgacagcta gctcagtcct aggtataatg ctagcgttgc gggtgaggag 60 gaacaatgaa aattaccgta ttgggatgcg gtgccttagg gcaattatgg cttacagcac 120 gaacaatgaa aattaccgta ttgggatgcg gtgccttagg gcaattatgg cttacagcac 120 tttgcaaaca gggtcatgaa gttcagggct ggctgcgcgt accgcaacct tattgtagcg 180 tttgcaaaca gggtcatgaa gttcagggct ggctgcgcgt accgcaacct tattgtagcg 180 tgaatctggt tgagacagat ggttcgatat ttaacgaatc gctgaccgcc aacgatcccg 240 tgaatctggt tgagacagat ggttcgatat ttaacgaatc gctgaccgcc aacgatcccg 240 attttctcgc caccagcgat ctgctcctgg tgacgctgaa agcatggcag gtttccgatg 300 attttctcgc caccagcgat ctgctcctgg tgacgctgaa agcatggcag gtttccgatg 300 ccgtcaaaag cctcgcgtcc acactgcctg taactacgcc aatactgtta attcacaacg 360 ccgtcaaaag cctcgcgtcc acactgcctg taactacgcc aatactgtta attcacaacg 360 gcatgggcac catcgaagag ttgcaaaaca ttcagcagcc attactgatg ggcaccacca 420 gcatgggcac catcgaagag ttgcaaaaca ttcagcagcc attactgatg ggcaccacca 420 cccatgcagc ccgccgcgac ggcaatgtca ttattcatgt ggcaaacggt atcacgcata 480 cccatgcagc ccgccgcgac ggcaatgtca ttattcatgt ggcaaacggt atcacgcata 480 ttggcccggc acggcaacag gacggggatt acagttatct ggcggatatt ttgcaaaccg 540 ttggcccggc acggcaacag gacggggatt acagttatct ggcggatatt ttgcaaaccg 540 tgttgcctga cgttgcctgg cataacaata ttcgcgccga gctgtggcgc aagctggcag 600 tgttgcctga cgttgcctgg cataacaata ttcgcgccga gctgtggcgc aagctggcag 600 tcaactgcgt gattaatcca ctgactgcca tctggaattg cccgaacggt gaattacgtc 660 tcaactgcgt gattaatcca ctgactgcca tctggaattg cccgaacggt gaattacgtc 660 atcatccgca agaaattatg cagatatgcg aagaagtcgc ggcggtgatc gaacgcgaag 720 atcatccgca agaaattatg cagatatgcg aagaagtcgc ggcggtgatc gaacgcgaag 720 ggcatcatac ttcagcagaa gatttgcgtg attacgtgat gcaggtgatt gatgccacag 780 cggaaaatat ctcgtcgatg ttgcaggata tccgcgcgct gcgccacact gaaatcgact 840 atatcaatgg ttttctctta cgccgcgccc gcgcgcatgg gattgccgta ccggaaaaca 900 cccgcctgtt tgaaatggta aaaagaaagg agagtgaata tgagcgcatc ggcactggtt 960 tgcctcgccc ctggtagtga agagactaat tttcgaaaaa agacgctgaa aagcgtcttt 1020 tttcgttttg ggatctaaat cgag 1044 <210> 5 <211> 1261 <212> DNA <213> Artificial Sequence <400> 5 cggactggaa gaagatctgt ttgtctctgc gcgtccgaat attgaactgc tgccggaagg 60 ccagtttaaa taccacgtcg attttgagca tctgcatatt ggcgaagaaa ccgggatgat 120 ttgcgtctcc cggccgacga atccaacagg caatgtgatt actgacgaag agttgctgaa 180 gcttgacgcg ctggcgaatc aacacggcat tccgctggtg attgataacg cttatggcgt 240 cccgttcccg ggtatcatct tcagtgaagc gcgcccgcta tggaatccga atatcgtgct 300 gtgcatgagt ctcaattccg acgtctaaga aaccattatt atcatgacat taacctataa 360 aaataggcgt atcacgaggc cctttcgtct tcacctcgag tccctatcag tgatagagat 420 tgacatccct atcagtgata gagatactga gcacatcagc aggacgcact gaccgggccc 480 aagttcactt aaaaaggaga tcaacaatga aagcaatttt cgtactgaaa catcttaatc 540 atgctaagga ggttttctaa tgtaccgtac gttaatgagc gcaaaacttc acagagcgag 600 agtgacggaa gccaatttga actacgtcgg cagcgtgaca attgatgaag atttgctgga 660 tgctgtcgga atgatggcaa atgaaaaagt gcaaattgtg aataataata acggggcccg 720 gctggaaacg tacattattc ccggtgaaag gggcagcggc gtcgtttgtt taaacggagc 780 tgccgcccgc cttgtccagg ttggagatgt cgtcatcatc gtgtcttatg cgatgatgtc 840 tgaagaggaa gcaaagaccc ataagccgaa ggttgccgtt ttgaacgaga gaaacgaaat 900 cgaggaaatg ctgggtcagg agccagcccg taccattctg taaaagccta gcataacccc 960 ttggggcctc taaacgggtc ttgaggggtt ttttgcatca ccaatatgaa cggcattatc 1020 agcctggcac ctggcggtat tggtccggcg atgatgtgtg aaatgattaa gcgtaacgat 1080 ctgctgcgcc tgtctgaaac agtcatcaaa ccgttttact accagcgtgt tcaggaaact 1140 atcgccatca ttcgccgcta tttaccggaa aatcgctgcc tgattcataa accggaagga 1200 gccattttcc tctggctatg gtttaaggat ttgcccatta cgaccaagca gctctatcag 1260 c 1261 <210> 6 <211> 2629 <212> DNA <213> Artificial Sequence <400> 6 ggcagaaaat cagccagttc cgcgcccgcc atcccgcaat tggcgcgggc aaacaaacga 60 cacttttgct gaagcagggc tacggctttg ttcgtgagca tggcgacgat aaagtgctgg 120 tcgtctgggc agggcaacag taacttttcc ggcttcccgt tcgtcagtac ctcgggaagc 180 cgccaaccag gataaaatgt cagccctaat cagcgttgca ggataaagca ccgctcactc 240 ttcaacagac cgatttgcac cccagcaaat gtagcgttat tgttaccttc cttgctacag 300 agttcttgac aattaatcat ccggctcgta taatgtgtgg acaagattca ggacggggaa 360 ctaactatga atggcgcaca gtgggtggta catgcgttgc gggcacaggg tgtgaacacc 420 gttttcggtt atccgggtgg cgcaattatg ccggtttacg atgcattgta tgacggcggc 480 gtggagcact tgctatgccg acatgagcag ggtgcggcaa tggcggctat cggttatgct 540 cgtgctaccg gcaaaactgg cgtatgtatc gccacgtctg gtccgggcgc aaccaacctg 600 ataaccgggc ttgcggacgc actgttagat tccatccctg ttgttgccat caccggtcaa 660 gtgtccgcac cgtttatcgg cactgacgca tttcaggaag tggatgtcct gggattgtcg 720 ttagcctgta ccaagcacag ctttctggtg cagtcgctgg aagagttgcc gcgcatcatg 780 gctgaagcat tcgacgttgc ctgctcaggt cgtcctggtc cggttctggt cgatatccca 840 aaagatatcc agttagccag cggtgacctg gaaccgtggt tcaccaccgt tgaaaacgaa 900 gtgactttcc cacatgccga agttgagcaa gcgcgccaga tgctggcaaa agcgcaaaaa 960 ccgatgctgt acgttggcgg tggcgtgggt atggcgcagg cagttccggc tttgcgtgaa 1020 tttctcgctg ccacaaaaat gcctgccacc tgtacgctga aagggctggg cgcagtagaa 1080 gcagattatc cgtactatct gggcatgctg ggaatgcatg gcaccaaagc ggcgaacttc 1140 gcggtgcagg agtgcgactt gctgatcgcc gtgggtgcac gttttgatga ccgggtgacc 1200 ggcaaactga acaccttcgc accacacgcc agtgttatcc atatggatat cgacccggca 1260 gaaatgaaca agctgcgtca ggcacatgtg gcattacaag gtgatttaaa tgctctgtta 1320 ccagcattac agcagccgtt aaatatcaat gactggcagc tacactgcgc gcagctgcgt 1380 gatgaacatg cctggcgtta cgaccatccc ggtgacgcta tctacgcgcc gttgttgtta 1440 aaacaactgt cagatcgtaa acctgcggat tgcgtcgtga ccacagatgt ggggcagcac 1500 cagatgtggg ctgcgcagca catcgcccac actcgcccgg aaaatttcat cacctccagc 1560 ggcttaggca ccatgggttt tggtttaccg gcggcggttg gcgcgcaagt cgcgcgacca 1620 aacgataccg tcgtctgtat ctccggtgac ggctctttca tgatgaatgt gcaagagctg 1680 ggcaccgtaa aacgcaagca gttaccgttg aaaatcgtct tactcgataa ccaacggtta 1740 gggatggttc gacaatggca gcaactgttt ttccaggaac gatatagcga aaccaccctt 1800 accgataacc ccgatttcct catgttagcc agcgccttcg gcatccctgg ccaacacatc 1860 acccgtaaag accaggttga agcggcactc gacaccatgc tgaacagtga tgggccatac 1920 ctgcttcatg tctcaatcga cgaacttgag aacgtctggc cgctggtgcc gcctggtgcc 1980 agtaattcag aaatgttgga gaaattatca tgatgcaaca tcaggtcaat gtatcggctc 2040 gcttcaatcc agaaacctta gaacgtgttt tacgcgtggt gcgtcatcgt ggtttccacg 2100 tctgctcaat gaatatggcc gccgccagcg atgcacaaaa tataaatatc gaattgaccg 2160 ttgccagccc acggtcggtc gacttactgt ttagtcagtt aaataaactg gtggacgtcg 2220 cacacgttgc catctgccag agcacaacca catcacaaca aatccgcgcc tgagcgcaaa 2280 aggaatatac cagaaaagag acgcttttag agcgtctttt ttcgttttgg agctactcac 2340 actgcttgcc ggaatgctgc gcgagaagtt gggttgggat atcgaaccac agaatattgc 2400 actaacaaac ggcagccaga gcgcgttttt ctacttattt aacctgtttg ccggacgccg 2460 tgccgatggt cgggtcaaaa aagtgctgtt cccgcttgca ccggaataca ttggctatgc 2520 tgacgccgga ctggaagaag atctgtttgt ctctgcgcgt ccgaatattg aactgctgcc 2580 ggaaggccag tttaaatacc acgtcgattt tgagcatctg catattggc 2629 <210> 7 <211> 1535 <212> DNA <213> Artificial Sequence <400> 7 gttgcgtgtt ctgcttcatc gcgctgatgg gcgcaagctc cttcgagctg gcaggtacct 60 tcatcgtcag cctgattatc ctgatgttct acgctcgcaa aatgcacgag cgccagagcc 120 actcaatgga taaccacacc gcgtctaacg cacattaatt aaaagtattt tccgaggctc 180 ctcctttcat tttgtcccat gtgttgggag caaaacatta acaccaactg gcaaaatttt 240 gtcctaaact tgatctcgac gaaatggctg cacctaaatc gtgatgaaaa tcacattttt 300 atcgtaattg ccctttaaaa ttcggggcgc cgaccccatg tggtctcaag cccaaaggaa 360 gagtgaggcg agtcagtcgc gtaatgctta ggcacaggat tgatttgtcg caatgattga 420 cacgattccg cttgacgctg cgtaaggttt ttgtaatttt acaggcaacc ttttattcac 480 catcttaatc atgctaagga ggttttctaa tgaatattgc tgtgattggc tgcggtgcga 540 ttggcgccag cgtgctcgaa ctgctcaagg gccatgccgc ggtgcaggtg ggctgggtgc 600 ttgtgcccga agtgacggac gccgtgcgcg ccaccctggc ccggcatgcg ccccaggcgc 660 gcgcactgcc tgcgctgacg actgaagacc ggcccgacct tatcgtcgaa tgcgcaggcc 720 ataccgccat cgaagagcat gtgctgcccg ccctgcggcg cggcattcct gccgtcgtgg 780 cctccatcgg cgcactcagc gcccccggca tggccgaggc cgttcaggcc gcggccgagg 840 ccggaggcac ccaggtgcaa ttgctgtcgg gcgccatcgg cggcgtggat gcgctggccg 900 cagcccgcat cggcggcctg gacgaagtgg tctacaccgg ccgcaagccg cccctggcct 960 ggaccggcac gcccgcagaa cagcgctgcg acctcgccag cctcaaggaa gccttctgca 1020 tcttcgaagg cagcgcacgc gaggccgccc agctctaccc caagaacgcc aacgtggccg 1080 ccaccctgtc gctggccggc atgggcctgg accgcaccac ggtgcgcctg tacgccgacc 1140 cggccgtgga cgaaaacgtg caccatgtgg ccgcgcgcgg cgccttcggt tccatggaat 1200 tgaccatgcg cggcaagccg ctggaggcca accccaagac ctcggccctc accgtctaca 1260 gcgtggtgcg cgccgtgctc aaccaggcca cggccatcgc catctaagcc gcaccttttc 1320 gaaaaaagac gctgaaaagc gtcttttttc gttttggtcc agctgtgcga agaaattagc 1380 aaaatgaacg agaacctgcc gttgtacgcg ttcgctaata cgtattccac tctcgatgta 1440 agcctgaatg acctgcgttt acagattagc ttctttgaat atgcgctggg tgctgctgaa 1500 gatattgcta ataagatcaa gcagaccact gacga 1535 <210> 8 <211> 2166 <212> DNA <213> 人工序列(Artificial Sequence) <400> 8 gttgcgtgtt ctgcttcatc gcgctgatgg gcgcaagctc cttcgagctg gcaggtacct 60 tcatcgtcag cctgattatc ctgatgttct acgctcgcaa aatgcacgag cgccagagcc 120 actcaatgga taaccacacc gcgtctaacg cacattaatt aaaagtattt tccgaggctc 180 ctcctttcat tttgtcccat gtgttgggag caaaacatta acaccaactg gcaaaatttt 240 gtcctaaact tgatctcgac gaaatggctg cacctaaatc gtgatgaaaa tcacattttt 300 atcgtaattg ccctttaaaa ttcggggcgc cgaccccatg tggtctcaag cccaaaggaa 360 gagtgaggcg agtcagtcgc gtaatgctta ggcacaggat tgatttgtcg caatgattga 420 cacgattccg cttgacgctg cgtaaggttt ttgtaatttt acaggcaacc ttttattcac 480 tataccttcc agagcaatct cacgtcttgc aaaaacagcc tgcgttttca tcagtaatag 540 ttggaatttt gtaaatctcc cgttaccctg atagcggact tcccttctgt aaccataatg 600 gaacctcgtc atgtttgaga acattaccgc cgctcctgcc gacccgattc tgggcctggc 660 cgatctgttt cgtgccgatg aacgtcccgg caaaattaac ctcgggattg gtgtctataa 720 agatgagacg ggcaaaaccc cggtactgac cagcgtgaaa aaggctgaac agtatctgct 780 cgaaaatgaa accaccaaaa attacctcgg cattgacggc atccctgaat ttggtcgctg 840 cactcaggaa ctgctgtttg gtaaaggtag cgccctgatc aatgacaaac gtgctcgcac 900 ggcacagact ccggggggca ctggcgcact acgcgtggct gccgatttcc tggcaaaaaa 960 taccagcgtt aagcgtgtgt gggtgagcaa cccaagctgg ccgaaccata agagcgtctt 1020 taactctgca ggtctggaag ttcgtgaata cgcttattat gatgcggaaa atcacactct 1080 tgacttcgat gcactgatta acagcctgaa tgaagctcag gctggcgacg tagtgctgtt 1140 ccatggctgc tgccataacc caaccggtat cgaccctacg ctggaacaat ggcaaacact 1200 ggcacaactc tccgttgaga aaggctggtt accgctgttt gacttcgctt accagggttt 1260 tgcccgtggt ctggaagaag atgctgaagg actgcgcgct ttcgcggcta tgcataaaga 1320 gctgattgtt gccagttcct actctaaaaa ctttggcctg tacaacgagc gtgttggcgc 1380 ttgtactctg gttgctgccg acagtgaaac cgttgatcgc gcattcagcc aaatgaaagc 1440 ggcgattcgc gctaactact ctaacccacc agcacacggc gcttctgttg ttgccaccat 1500 cctgagcaac gatgcgttac gtgcgatttg ggaacaagag ctgactgata tgcgccagcg 1560 tattcagcgt atgcgtcagt tgttcgtcaa tacgctgcag gaaaaaggcg caaaccgcga 1620 cttcagcttt atcatcaaac agaacggcat gttctccttc agtggcctga caaaagaaca 1680 agtgctgcgt ctgcgcgaag agtttggcgt atatgcggtt gcttctggtc gcgtaaatgt 1740 ggccgggatg acaccagata acatggctcc gctgtgcgaa gcgattgtgg cagtgctgta 1800 agcattaaaa acaatgaagc ccgctgaaaa gcgggctgag actgatgaca aacgcaacat 1860 tgcctgatgc gctacgctta tcaggcctac gcgtcccctg caatattttg aatttgcacg 1920 attttgtagg ccggataagg cgctcgtgcc gcatccggca taaacaaagc gcactttgcc 1980 agaaatccag gagctgtgcg aagaaattag caaaatgaac gagaacctgc cgttgtacgc 2040 gttcgctaat acgtattcca ctctcgatgt aagcctgaat gacctgcgtt tacagattag 2100 cttctttgaa tatgcgctgg gtgctgctga agatattgct aataagatca agcagaccac 2160 tgacga 2166 <210> 9 <211> 2178 <212> DNA <213> Artificial Sequence <400> 9 gttgcgtgtt ctgcttcatc gcgctgatgg gcgcaagctc cttcgagctg gcaggtacct 60 tcatcgtcag cctgattatc ctgatgttct acgctcgcaa aatgcacgag cgccagagcc 120 actcaatgga taaccacacc gcgtctaacg cacattaatt aaaagtattt tccgaggctc 180 ctcctttcat tttgtcccat gtgttgggag caaaacatta acaccaactg gcaaaatttt 240 gtcctaaact tgatctcgac gaaatggctg cacctaaatc gtgatgaaaa tcacattttt 300 atcgtaattg ccctttaaaa ttcggggcgc cgaccccatg tggtctcaag cccaaaggaa 360 gagtgaggcg agtcagtcgc gtaatgctta ggcacaggat tgatttgtcg caatgattga 420 cacgattccg cttgacgctg cgtaaggttt ttgtaatttt acaggcaacc ttttattcac 480 gcagcttgaa aaagaaggtt cacatgtcaa acaacattcg tatcgaagaa gatctgttgg 540 gtaccaggga agttccagct gatgcctact atggtgttca cactctgaga gcgattgaaa 600 acttctatat cagcaacaac aaaatcagtg atattcctga atttgttcgc ggtatggtaa 660 tggttaaaaa agccgcagct atggcaaaca aagagctgca aaccattcct aaaagtgtag 720 cgaatgccat cattgccgca tgtgatgaag tcctgaacaa cggaaaatgc atggatcagt 780 tcccggtaga cgtctaccag ggcggcgcag gtacttccgt aaacatgaac accaacgaag 840 tgctggccaa tatcggtctg gaactgatgg gtcaccaaaa aggtgaatat cagtacctga 900 acccgaacga ccatgttaac aaatgtcagt ccactaacga cgcctacccg accggtttcc 960 gtatcgcagt ttactcttcc ctgattaagc tggtagatgc gattaaccaa ctgcgtgaag 1020 gctttgaacg taaagctgtc gaattccagg acatcctgaa aatgggtcgt acccagctgc 1080 aggacgcagt accgatgacc ctcggtcagg aattccgcgc tttcagcatc ctgctgaaag 1140 aagaagtgaa aaacatccaa cgtaccgctg aactgctgct ggaagttaac cttggtgcaa 1200 cagcaatcgg tactggtctg aacacgccga aagagtactc tccgctggca gtgaaaaaac 1260 tggctgaagt tactggcttc ccatgcgtac cggctgaaga cctgatcgaa gcgacctctg 1320 actgcggcgc ttatgttatg gttcacggcg cgctgaaacg cctggctgtg aagatgtcca 1380 aaatctgtaa cgacctgcgc ttgctctctt caggcccacg tgccggcctg aacgagatca 1440 acctgccgga actgcaggcg ggctcttcca tcatgccagc taaagtaaac ccggttgttc 1500 cggaagtggt taaccaggta tgcttcaaag tcatcggtaa cgacaccact gttaccatgg 1560 cagcagaagc aggtcagctg cagttgaacg ttatggagcc ggtcattggc caggccatgt 1620 tcgaatccgt tcacattctg accaacgctt gctacaacct gctggaaaaa tgcattaacg 1680 gcatcactgc taacaaagaa gtgtgcgaag gttacgttta caactctatc ggtatcgtta 1740 cttacctgaa cccgttcatc ggtcaccaca acggtgacat cgtgggtaaa atctgtgccg 1800 aaaccggtaa gagtgtacgt gaagtcgttc tggaacgcgg tctgttgact gaagcggaac 1860 ttgacgatat tttctccgta cagaatctga tgcacccggc ttacaaagca aaacgctata 1920 ctgatgaaag cgaacagtaa tcgtacaggg tagtacaaat aaaaaaggca cgtcagatga 1980 cgtgcctttt ttcttgtgag cagagctgtg cgaagaaatt agcaaaatga acgagaacct 2040 gccgttgtac gcgttcgcta atacgtattc cactctcgat gtaagcctga atgacctgcg 2100 tttacagatt agcttctttg aatatgcgct gggtgctgct gaagatattg ctaataagat 2160 caagcagacc actgacga 2178 <210> 10 <211> 63 <212> DNA <213> Artificial Sequence <400> 10 cgcggatccc aattaatcat ccggctcgta taatgtgtgg agcacaacat caatttatca 60 gga 63 <210> 11 <211> 30 <212> DNA <213> Artificial Sequence <400> 11 acatgcatgc cctgtgttat gacagatgac 30 <210> 12 <211> 65 <212> DNA <213> Artificial Sequence <400> 12 acatgcatgc ttgacagcta gctcagtcct aggtataatg ctagcgttgc gggtgaggag 60 gaaca 65 <210> 13 <211> 90 <212> DNA <213> Artificial Sequence <400> 13 ctcgatttag atcccaaaac gaaaaaagac gcgcttttca gcgtcttttt tcgaaaatta 60 gtctcttcac taccagggat gactatcgag 90 <210> 14 <211> 30 <212> DNA <213> Artificial Sequence <400> 14 tgggtctacc gttttagagc tagaaatagc 30 <210> 15 <211> 29 <212> DNA <213> Artificial Sequence <400> 15 gcttggaaag gactagtatt atacctagg 29 <210> 16 <211> 19 <212> DNA <213> Artificial Sequence <400> 16 cggactggaa gaagatctg 19 <210> 17 <211> 39 <212> DNA <213> Artificial Sequence <400> 17 tttcttagac gtcggaattg agactcatgc acagcacga 39 <210> 18 <211> 40 <212> DNA <213> Artificial Sequence <400> 18 tcgtgctgtg catgagtctc aattccgacg tctaagaaac 40 <210> 19 <211> 44 <212> DNA <213> Artificial Sequence <400> 19 gatctccttt ttaagtgaac ttggggtcag tgcgtcctgc tgat 44 <210> 20 <211> 44 <212> DNA <213> Artificial Sequence <400> 20 atcagcagga cgcactgacc ccaagttcac ttaaaaagga gatc 44 <210> 21 <211> 39 <212> DNA <213> Artificial Sequence <400> 21 tgccgttcat attggtgatg caaaaaaccc ctcaagacc 39 <210> 22 <211> 39 <212> DNA <213> Artificial Sequence <400> 22 ggtcttgagg ggttttttgc atcaccaata tgaacggca 39 <210> 23 <211> 19 <212> DNA <213> Artificial Sequence <400> 23 gctgatagag ctgcttggt 19 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <400> 24 ggagctactc acactgcttg 20 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <400> 25 cgcatacatt gatgcgtatg 20 <210> 26 <211> 30 <212> DNA <213> Artificial Sequence <400> 26 acggtccaca gttttagagc tagaaatagc 30 <210> 27 <211> 29 <212> DNA <213> Artificial Sequence <400> 27 cgtagttaca gactagtatt atacctagg 29 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <400> 28 ggcagaaaat cagccagttc 20 <210> 29 <211> 56 <212> DNA <213> Artificial Sequence <400> 29 tccacacatt atacgagccg gatgattaat tgtcaagaac tctgtagcaa ggaagg 56 <210> 30 <211> 56 <212> DNA <213> Artificial Sequence <400> 30 ttgacaatta atcatccggc tcgtataatg tgtggacaag attcaggacg gggaac 56 <210> 31 <211> 55 <212> DNA <213> Artificial Sequence <400> 31 cgaaaaaaga cgctctaaaa gcgtctcttt tctggtatat tccttttgcg ctcag 55 <210> 32 <211> 58 <212> DNA <213> Artificial Sequence <400> 32 cagaaaagag acgcttttag agcgtctttt ttcgttttgg agctactcac actgcttg 58 <210> 33 <211> 38 <212> DNA <213> Artificial Sequence <400> 33 gccaatatgc agatgctcat gagcatctgc atattggc 38 <210> 34 <211> 19 <212> DNA <213> Artificial Sequence <400> 34 cacgttcgga tatgaactg 19 <210> 35 <211> 19 <212> DNA <213> Artificial Sequence <400> 35 cgtcaagctt cagcaactc 19 <210> 36 <211> 30 <212> DNA <213> Artificial Sequence <400> 36 tcatatctcc gttttagagc tagaaatagc 30 <210> 37 <211> 29 <212> DNA <213> Artificial Sequence <400> 37 ctatgaacgt gactagtatt atacctagg 29 <210> 38 <211> 20 <212> DNA <213> Artificial Sequence <400> 38 gttgcgtgtt ctgcttcatc 20 <210> 39 <211> 39 <212> DNA <213> Artificial Sequence <400> 39 ccagttggtg ttaatgtttt gctcccaaca catgggaca 39 <210> 40 <211> 39 <212> DNA <213> Artificial Sequence <400> 40 tgtcccatgt gttgggagca aaacattaac accaactgg 39 <210> 41 <211> 41 <212> DNA <213> Artificial Sequence <400> 41 ctccttagca tgattaagat ggtgaataaa aggttgcctg t 41 <210> 42 <211> 41 <212> DNA <213> Artificial Sequence <400> 42 acaggcaacc ttttattcac catcttaatc atgctaagga g 41 <210> 43 <211> 41 <212> DNA <213> Artificial Sequence <400> 43 gctaatttct tcgcacagct ggaccaaaac gaaaaaagac g 41 <210> 44 <211> 41 <212> DNA <213> Artificial Sequence <400> 44 cgtctttttt cgttttggtc cagctgtgcg aagaaattag c 41 <210> 45 <211> 19 <212> DNA <213> Artificial Sequence <400> 45 tcgtcagtgg tctgcttga 19 <210> 46 <211> 20 <212> DNA <213> Artificial Sequence <400> 46 ctactcttgc gttgacctga 20 <210> 47 <211> 20 <212> DNA <213> Artificial Sequence <400> 47 gtgaccagga gtacagaaag 20 <210> 48 <211> 41 <212> DNA <213> Artificial Sequence <400> 48 gagattgctc tggaaggtat agtgaataaa aggttgcctg t 41 <210> 49 <211> 41 <212> DNA <213> Artificial Sequence <400> 49 acaggcaacc ttttattcac tataccttcc agagcaatct c 41 <210> 50 <211> 40 <212> DNA <213> Artificial Sequence <400> 50 gctaatttct tcgcacagct cctggatttc tggcaaagtg 40 <210> 51 <211> 40 <212> DNA <213> Artificial Sequence <400> 51 cactttgcca gaaatccagg agctgtgcga agaaattagc 40 <210> 52 <211> 41 <212> DNA <213> Artificial Sequence <400> 52 gaaccttctt tttcaagctg cgtgaataaa aggttgcctg t 41 <210> 53 <211> 41 <212> DNA <213> Artificial Sequence <400> 53 acaggcaacc ttttattcac gcagcttgaa aaagaaggtt c 41 <210> 54 <211> 40 <212> DNA <213> Artificial Sequence <400> 54 gctaatttct tcgcacagct ctgctcacaa gaaaaaaggc 40 <210> 55 <211> 40 <212> DNA <213> Artificial Sequence <400> 55 gccttttttc ttgtgagcag agctgtgcga agaaattagc 40 <210> 56 <211> 798 <212> DNA <213> Artificial Sequence <400> 56 atgaatattg ctgtgattgg ctgcggtgcg attggcgcca gcgtgctcga actgctcaag 60 ggccatgccg cggtgcaggt gggctgggtg cttgtgcccg aagtgacgga cgccgtgcgc 120 gccaccctgg cccggcatgc gccccaggcg cgcgcactgc ctgcgctgac gactgaagac 180 cggcccgacc ttatcgtcga atgcgcaggc cataccgcca tcgaagagca tgtgctgccc 240 gccctgcggc gcggcattcc tgccgtcgtg gcctccatcg gcgcactcag cgcccccggc 300 atggccgagg ccgttcaggc cgcggccgag gccggaggca cccaggtgca attgctgtcg 360 ggcgccatcg gcggcgtgga tgcgctggcc gcagcccgca tcggcggcct ggacgaagtg 420 gtctacaccg gccgcaagcc gcccctggcc tggaccggca cgcccgcaga acagcgctgc 480 gacctcgcca gcctcaagga agccttctgc atcttcgaag gcagcgcacg cgaggccgcc 540 cagctctacc ccaagaacgc caacgtggcc gccaccctgt cgctggccgg catgggcctg 600 gaccgcacca cggtgcgcct gtacgccgac ccggccgtgg acgaaaacgt gcaccatgtg 660 gccgcgcgcg gcgccttcgg ttccatggaa ttgaccatgc gcggcaagcc gctggaggcc 720 aaccccaaga cctcggccct caccgtctac agcgtggtgc gcgccgtgct caaccaggcc 780 acggccatcg ccatctaa 798

Claims

1. A host, characterized in that, expresses the aspartate dehydrogenase gene aspDH; the said aspartate dehydrogenase gene aspDH is derived from Delftia sp.( Delftia sp. )Csl-4; The aspartate dehydrogenase gene aspDH has a nucleotide sequence as shown in SEQ ID No. 56; It also includes: (i), a strong promoter and / or a strong RBS; wherein the strong promoter is PgapA and the strong RBS is BCD2; the nucleotide sequence of the BCD2 is as shown in SEQ ID No.2; (ii), a gene derived from Escherichia coli BL21 ilvGM ; (iii), an L-aspartate α-decarboxylase gene derived from Bacillus licheniformis ( Bacillus licheniformis ); (iv), the copy numbers of the panD; gene and the panD gene derived from Bacillus licheniformis are increased; (v), the panB, panC gene and the panE gene are added The host is derived from Escherichia coli, and the Escherichia coli ( Escherichia coil ) is Escherichia coli K12, and the Escherichia coli K12 is Escherichia coli K12 MG1655 strain.

2. Use of the host according to claim 1 in the production of vitamin B5.

3. A method for producing vitamin B5, characterized in that, Using the host according to claim 1 as the fermentation strain, fermenting, collecting the fermentation broth, centrifuging to obtain the supernatant, and obtaining vitamin B5.

Images