Primer set, kit and method for detecting dynamic mutation of ggggcc repeat sequence of c9orf72 gene
By designing specific primer sets and capillary electrophoresis technology, the problem of detecting dynamic mutations in the GGGGCC repeat sequence of the C9orf72 gene was solved, achieving rapid and accurate repeat number detection, simplifying the process and improving efficiency.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-11-03
- Publication Date
- 2026-04-14
AI Technical Summary
Existing technologies for diagnosing dynamic mutations in the GGGGCC repetitive sequence of the C9orf72 gene are limited, complex, and have poor efficacy, making it difficult to effectively analyze their status.
Specific primer sets were designed for PCR system 1 and PCR system 2. Combined with capillary electrophoresis, the PCR products were detected by fluorescently labeled primers to determine the number of GGGGCC hexanucleotide repeats in the C9orf72 gene.
It enables rapid and accurate detection of the GGGGCC repeat number of the C9orf72 gene with an error of no more than one repeat, simplifying the detection process and improving detection efficiency.
Smart Images

Figure CN115595362B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular biological diagnostics, specifically to a primer set, kit, and method for detecting dynamic mutations in the GGGGCC repetitive sequence of the C9orf72 gene. Background Technology
[0002] C9orf72 aberrant duplication is the most common genetic cause of frontotemporal dementia (FTLD) and amyotrophic lateral sclerosis (ALS), and is also found in a wide range of conditions including Alzheimer's disease (AD), Huntington's disease, corticobasal syndrome, olivopontocerebellar degeneration, Parkinson's disease, and mental illnesses, as well as in some patients without a known family history of neurodegenerative diseases. The incidence of isolated ALS in Hong Kong is approximately 0.6 per 100,000 people, with a prevalence of approximately 3.1 per 100,000 people, while the incidence of FTLD in Europe and the Americas is approximately 2.7–4.0 per 100,000 people. C9orf72 duplication is found in approximately 5%–10% of all FTLD or ALS patients, and in up to 30% of patients in both diseases. These conditions are termed c9FTD / ALS. Prevalence varies considerably among different ethnic groups: the incidence is highest in Caucasians and lowest in Asians, with a high amplification rate, accumulating to 90.9%–99.5% by age 83.
[0003] Studies have shown that amplification of the non-coding hexanucleotide repeat sequence (GGGGCC) in the C9orf72 gene is the most common genetic factor leading to amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTLD), causing neuronal damage and death. Healthy individuals typically carry fewer than 30 repeat sequences, more than 200 repeats are likely pathogenic, and small amplifications (i.e., a maximum of 200 repeats) indicate a possible symptom.
[0004] The size of GGGGCC repeat fragments based on polymerase chain reaction (PCR) can be used for genetic confirmation in symptomatic individuals and pre-symptom prediction testing in at-risk individuals. C9orf72 alleles with 0-30 GGGGCC repeats are generally non-pathogenic; intermediate alleles (30-200 repeats) may undergo germline expansion to a pathogenic size, the significance of which is unclear; repeats of the GGGGCC allele ≥200 may be pathogenic within a normal lifespan.
[0005] However, due to the complex structure of the C9orf72 gene and the fact that the pathogenic dynamic mutation GGGGCC hexanucleotide repeat is a fully GC sequence, there are currently few publicly available diagnostic techniques for the C9orf72 gene GGGCC hexanucleotide dynamic mutation, and the methods and procedures are complex and the results are poor. Summary of the Invention
[0006] To address the shortcomings of the existing technologies, the present invention aims to provide a primer set, kit, and method for detecting dynamic mutations in the GGGGCC repeat sequence of the C9orf72 gene, thereby resolving the problems of difficulty in analyzing the GGGGCC repeat status in the C9orf72 gene and overly complex analysis methods in the existing technologies.
[0007] To solve the above problems, the present invention adopts the following technical solution:
[0008] The C9orf72 gene, associated with dementia, exhibits repeat amplifications of more than 200 GGGGCC hexanucleotides. Therefore, it is possible to design primers and methods to detect the repeat status of GGGGCC hexanucleotides, and determine the dynamic mutations in the C9orf72 gene by identifying the number of repeats.
[0009] The main contents of this invention are: primer pairs C9T2, C9T3 and C9R4 for PCR system 1 used to detect the number of hexanucleotide repeats in GGGGCC; and primer pairs C9F1 and C9R4 for PCR system 2 used to detect whether hexanucleotide repeats in GGGGCC PCR are amplified.
[0010] Primer C9R4 has a fluorescent label at its 5' end;
[0011] The upstream primer C9R4 of the PCR system 1 has the nucleotide sequence SEQ ID NO:4; the downstream primer C9T2 is a sequence unrelated to the human genome, and its nucleotide sequence is SEQ ID NO:2; the downstream primer C9T3 has the nucleotide sequence containing the same 5' end as SEQ ID NO:2 and four CCGGGG hexanucleotide repeats, and its nucleotide sequence is SEQ ID NO:3.
[0012] The nucleotide sequence of the upstream primer C9R4 in the PCR system 2 reaction system is SEQ ID NO:4, and the nucleotide sequence of the downstream primer C9F1 is SEQ ID NO:1.
[0013] Genomic DNA is extracted from the sample to be tested and used as a DNA template; a PCR amplification system containing the primer pair and the amplification template is configured; the PCR amplification system is subjected to an amplification reaction to obtain a PCR product containing the GGGGCC hexanucleotide repeat sequence; the PCR product is detected by capillary electrophoresis, and the number of GGGGCC hexanucleotide repeats in the C9orf72 gene of the sample to be tested is calculated based on the electrophoresis detection results.
[0014] The primer information is detailed in Table 1 below:
[0015] Table 1 Primer sequence information
[0016]
[0017] More preferably, the primer C9R4 has a 5'-FAM fluorescent group at its 5' end.
[0018] Secondly, the present invention provides a kit containing the above-mentioned primer set.
[0019] Furthermore, the kit includes 12.5 × n μl of 2 × GoldStar Best Master Mix reagent; 1 × n μl of 10 μM C9F1 primer; 1 × n μl of 10 μM C9T2 primer; 0.1 × n μl of 10 μM C9T3 primer; 2 × n μl of 10 μM C9R4 primer; 1 × n μl of DMSO; and 6.4 × n μl of ddH2O. The number of samples to be tested is n = number of samples + 1. 1 μl of DNA is added to 24 μl of amplification reaction mixture for PCR amplification.
[0020] Thirdly, this invention provides a method for non-diagnostic purposes of detecting dynamic mutations in the GGGGCC repetitive sequence in the C9orf72 gene, comprising:
[0021] 1) Extract DNA and perform PCR amplification using the primer set described in claim 1;
[0022] 2) Perform capillary electrophoresis on the PCR amplification products from step 1);
[0023] 3) Analyze the GGGGCC duplication in the C9orf72 gene.
[0024] Furthermore, step 1) PCR amplification includes:
[0025] Prepare the amplification reaction mixture according to the number of DNA samples to be tested. The amplification reaction mixture includes 12.5 × n μl of 2×GoldStar Best Master Mix reagent; 1 × n μl of 10 μM C9F1 primer; 1 × n μl of 10 μM C9T2 primer; 0.1 × n μl of 10 μM C9T3 primer; 2 × n μl of 10 μM C9R4 primer; 1 × n μl of DMSO; and 6.4 × n μl of ddH2O. Where n = number of samples to be tested + 1. Add 1 μl of DNA to 24 μl of the amplification reaction mixture; then perform PCR amplification.
[0026] Specifically, the PCR amplification includes:
[0027] Denature at 98°C for 5 minutes in a PCR instrument; then run the following cycle 35 times: denature at 98°C for 35 seconds, anneal at 62°C for 35 seconds, extend at 72°C for 3 minutes; then extend at 72°C for 10 minutes, and store at 4°C.
[0028] Furthermore, step 2) performing capillary electrophoresis on the PCR amplification product from step 1) includes:
[0029] Dilute the PCR amplification product and add it to ddH2O;
[0030] Mix ABI GS500-LIZ internal standard and HIDI at a volume ratio of 1:250, and then mix the mixture with the diluted PCR amplification product to prepare the instrumentation solution.
[0031] After running the prepared PCR mixture at 95°C for 3 minutes on the PCR instrument, cool it in an ice-water mixture for 5 minutes to ensure the temperature is around 0°C for denaturation treatment.
[0032] The genotyping mixture was analyzed using an ABI 3730xl sequencer, employing G5 color grouping. The genotyping parameters on the ABI 3730xl sequencer were set as follows: OVEN_Temperature 60℃, Buffer_Temperature 35℃; PreRun_Voltage 15kV, PreRun_Time 180s; Injection_Voltage 1.5kV; Injection_Time 15s; First ReadOut_Time 300ms; Second ReadOut_Time 300ms; electrophoresis voltage Run_Voltage 15kV; jump steps Voltage_Number_of_steps set to 10 steps; jump voltage Voltage_steps_Interval set to 20s; voltage tolerance Voltage_Tolerance set to 0.6kV; current Current_Stability 30uA; temperature delay Ramp_Delay 1s; date delay Data_Delay 600s; electrophoresis time Run_Time 1600s.
[0033] Furthermore, step 3) analyzing the GGGGCC hexanucleotide repeat in the C9orf72 gene includes:
[0034] Genemaker ID v2.6 software was used to interpret the genotyping results. After verifying the internal standard peak, 112 bp was defined as GGGGCC1. The number of GGGGCC repeats was determined based on the number of fluorescence spikes appearing approximately every 6 bp. The first peak after (GGGGCC)n corresponds to the first allele; if there are further fluorescence spikes, the second peak corresponds to the second allele.
[0035] Fourth, the present invention provides the application of the primer set for detecting dynamic mutations in the GGGGCC hexanucleotide repeat sequence in the preparation of a dementia-related C9orf72 gene diagnostic agent.
[0036] This invention provides the application of the kit in the preparation of a diagnostic agent for dynamic mutations in the C9orf72 gene GGGGCC repetitive sequence.
[0037] Fifth, a system for detecting dynamic mutations in the GGGGCC repetitive sequence of the C9orf72 gene, comprising:
[0038] An extraction and amplification module is used to extract DNA and perform PCR amplification using the primer set described in claim 1;
[0039] A capillary electrophoresis module is used to perform capillary electrophoresis on the products amplified by the PCR.
[0040] The analysis module is used to analyze the GGGGCC duplication status of the C9orf72 gene.
[0041] The beneficial effects of this invention are as follows: The primer set, kit, and detection method provided by this invention, through the design of specific primers, perform PCR amplification on the sample to generate a series of PCR products with different fragment lengths. One end of the product contains FAM fluorescence. Capillary electrophoresis of the PCR product can clearly show the number of GGGGCC repeats in the product, with an error of no more than one replicate. By detecting the number of (GGGGCC)n repeats in the C9orf72 gene, the C9orf72 gene can be evaluated. This allows for rapid detection and evaluation of the number of GGGGCC hexanucleotide repeats in the dementia-related C9orf72 gene. The detection process is simple, time-saving, and highly efficient. Attached Figure Description
[0042] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will now be described in further detail with reference to the accompanying drawings, wherein:
[0043] Figure 1 The waveform of a simulated positive plasmid sample analyzed using GeneMaker ID v2.6 is shown in this embodiment of the invention.
[0044] Figure 2 This is a waveform diagram of a negative sample analyzed using GeneMaker ID v2.6 in an embodiment of the present invention.
[0045] Figure 3 This is a waveform diagram of a negative sample analyzed using GeneMaker ID v2.6 in an embodiment of the present invention. Detailed Implementation
[0046] The present invention will be further described in detail below with reference to specific embodiments.
[0047] It should be noted that these embodiments are only used to illustrate the present invention and are not intended to limit the present invention. Simple improvements to the method under the premise of the present invention are all within the scope of protection claimed by the present invention.
[0048] This invention designs a pair of specific primers for the GGGGCC hexanucleotide repeat in the C9orf72 gene. PCR amplification using these primers produces a series of PCR products of varying fragment lengths, each containing FAM fluorescence at one end. Capillary electrophoresis of the PCR products clearly shows the number of GGGGCC repeats within the products, with an error not exceeding one replicate.
[0049] Example 1
[0050] A set of specific primers was designed targeting the GGGGCC hexanucleotide repeat in the C9orf72 gene. Primer C9R4 has a fluorescent label at its 5' end. The primer sequences are as follows:
[0051] C9F1:CGCAGCCTGTAGCAAGCTCTGGAACTC
[0052] C9T2:TACGCATCCCAGTTTGAGACG
[0053] C9T3: TACGCATCCCAGTTTTGAGACGCCGGGGCCGGGGCCGGGGCCGGGG
[0054] C9R4: TGCGCTCCGCCCGCCGCGGGCGCAGGCACCGCA
[0055] C9R4-FAM: TCGGCTCCGCCGCCCGCGGGCGCAGGCACCGCA.
[0056] Example 2: gDNA extraction from blood samples
[0057] The primer set designed in Example 1 was used to test the blood sample.
[0058] Blood samples were extracted using the magnetic bead method universal genomic DNA extraction kit (DP705-02) manufactured by Tiangen Biotech (Beijing) Co., Ltd.
[0059] 1. Take 250 μl of blood sample into a 2 ml centrifuge tube, add 20 μl of Proteinase K solution and 300 μl of lysis buffer GHL, vortex to mix, and lyse at 75°C for 15 min, inverting the tube 3 times during lysis, 3-5 times each time. When the number of samples is relatively large, the lysis buffer GHL and Proteinase K can be pre-mixed and prepared fresh each time.
[0060] 2. Add 300 μl of isopropanol and shake to mix for 10 seconds.
[0061] 3. Add 15 μl of magnetic bead suspension GH, shake to mix for 1 min, let stand for a total of 9 min, shake to mix for 1 min every 3 min.
[0062] 4. Place the centrifuge tubes on the magnetic rack and let them stand for 30 seconds. After the magnetic beads are completely attracted, remove the liquid.
[0063] 5. Add 900 μl of buffer GDZ and vortex to mix for 2 min.
[0064] 6. Place the centrifuge tubes on the magnetic rack and let them stand for 30 seconds until the magnetic beads are completely attracted, then remove the liquid.
[0065] 7. Add 500 μl of buffer GDZ and vortex to mix for 2 min.
[0066] 8. Place the centrifuge tubes on the magnetic rack and let them stand for 30 seconds until the magnetic beads are completely attracted, then remove the liquid.
[0067] 9. Remove the centrifuge tube from the magnetic rack, add 900 μl of PWD wash buffer (please check that anhydrous ethanol has been added before use), and shake to mix for 2 min.
[0068] 10. Place the centrifuge tubes on the magnetic rack and let them stand for 30 seconds until the magnetic beads are completely attracted, then remove the liquid.
[0069] 11. Remove the centrifuge tube from the magnetic rack, add 300 μl of PWD wash solution, and shake to mix for 2 min.
[0070] 12. Place the centrifuge tubes on the magnetic rack and let them stand for 30 seconds until the magnetic beads are completely attracted, then remove the liquid.
[0071] 13. Place the centrifuge tubes on a magnetic rack and air dry at room temperature for 10-15 minutes. Residual ethanol will inhibit subsequent enzyme reactions, so ensure that all ethanol evaporates completely during air drying.
[0072] 14. Remove the centrifuge tube from the magnetic rack, add 50 μl of elution buffer TB, vortex to mix, and incubate at 56°C for 10 min, inverting the tube 3 times during the incubation period, 3-5 times each time.
[0073] 15. Transfer the gDNA solution to a new centrifuge tube, determine its concentration using nanodrop, and concentrate or dilute the gDNA to 20 ng / μL according to the determined concentration before proceeding with subsequent experiments. It is recommended to perform PCR amplification immediately after extraction of gDNA, or store it directly at -20±5℃ for no more than one month.
[0074] Example 3: PCR amplification of extracted DNA
[0075] Using the above primer pairs to perform PCR amplification on blood samples and simulated positive plasmid samples (20 ng / μL) will produce a series of PCR products of varying fragment lengths, with one end of each product containing fam fluorescence.
[0076] PCR was performed using a commercially available PCR kit. In this example, the kit brand was Kangwei Century, the name was 2xGoldStar Best MasterMix, and the catalog number was CW0656S.
[0077] 1. Reagent Preparation: Prepare the amplification reaction mixture according to the number of DNA samples to be tested. The reagent quantities in the amplification reaction mixture are as follows:
[0078]
[0079] Where n = number of samples tested + 1.
[0080] 2. Sample addition: Add 1 μL of DNA to a 24 μL amplification reaction mixture;
[0081] 3. Amplification: Perform PCR amplification using a PCR instrument. The amplification program is as follows:
[0082] Denature at 98°C for 5 minutes in a PCR instrument; then run the following cycle 35 times: denature at 98°C for 35 seconds, anneal at 62°C for 35 seconds, extend at 72°C for 3 minutes; then extend at 72°C for 10 minutes, and store at 4°C.
[0083] Example 4: Capillary electrophoresis of PCR products
[0084] 1. Sample dilution: Dilute the PCR product 100-fold and add 1ul of PCR amplification product to 99ul ddH2O.
[0085] 2. Prepare the PCR mixture: Mix ABI GS500-LIZ internal standard and HIDI at a volume ratio of 1:250, then mix 9 μL of the mixture with 1 μL of diluted PCR amplification product to prepare the PCR mixture.
[0086] 3. Pre-denaturation: After running the prepared PCR mixture at 95°C for 3 minutes on the PCR instrument, rapidly cool it in an ice-water mixture for 5 minutes until the temperature is around 0°C to perform denaturation treatment.
[0087] 4. Capillary electrophoresis: The mixed solution was detected in an ABI 3730xl sequencer using G5 color grouping. The genotyping parameters in the ABI 3730xl sequencer are shown in the table below.
[0088] Name Value OVEN_Temperature 60℃ Buffer_Temperature 35℃ PreRun_Voltage 15kV PreRun_Time 180s Injection_Voltage 1.5kV Injection_Time 15s First_ReadOut_Time 300ms Second_ReadOut_Time 300ms Run_Voltage 15kV Voltage_Number_of_steps 10 Voltage_steps_Interval 20s Voltage_Tolerance 0.6kV Current_Stability 30uA Ramp_Delay 1s Data_Delay 600s Run_Time 1600s
[0089] The detection parameters were: OVEN_Temperature 60℃, Buffer_Temperature 35℃; PreRun_Voltage 15kV, PreRun_Time 180s; Injection_Voltage 1.5kV; Injection_Time 15s; First_ReadOut_Time 300ms; Second_ReadOut_Time 300ms; Run_Voltage 15kV; Voltage_Number_of_steps 10 steps; Voltage_steps_Interval 20s; Voltage_Tolerance 0.6kV; Current_Stability 30uA; Ramp_Delay 1s; Data_Delay 600s; Run_Time 1600s.
[0090] Implement 5 detection systems
[0091] Using the detection methods described in Examples 1-4, a system for detecting dynamic mutations in the GGGGCC repetitive sequence of the C9orf72 gene was designed, comprising:
[0092] An extraction and amplification module is used to extract DNA and perform PCR amplification using the primer set described in claim 1;
[0093] A capillary electrophoresis module is used to perform capillary electrophoresis on the products amplified by the PCR.
[0094] The analysis module is used to analyze the GGGGCC duplication status of the C9orf72 gene;
[0095] If the number of GGGGCC repeats in the C9orf72 gene is 0-30, the test result of the DNA to be tested is normal; otherwise, it is abnormal.
[0096] Example 6 Data Analysis
[0097] After genotyping with the 3730xl sequencer, the genotyping results were interpreted in Genemarker ID v2.6. After verifying the internal standard peaks, the 112bp position was defined as (GGGGCC)1. The number of GGGGCC repeats was determined based on the number of fluorescence spikes appearing approximately every 6bp. The GGGGCC repeat number corresponding to the first peak after (GGGGCC)n is the first allele, and the second peak is the second allele. See [link to documentation]. Figure 1 The simulated positive plasmid GGGGCC has 200 repeats, consistent with the synthesized plasmid sequence; see [link to relevant documentation]. Figure 2 The negative sample contained two alleles; see [link to relevant documentation]. Figure 3 The negative sample contained two alleles.
[0098] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described with reference to preferred embodiments, those skilled in the art should understand that various changes in form and detail can be made without departing from the spirit and scope of the invention as defined in the appended claims.
Claims
1. A primer set for detecting dynamic mutation of GGGGCC repeat sequence of C9orf72 gene, characterized in that, The forward primer C9R4 of the primer set has a fluorescent label at its 5' end, and the primer set sequence is as follows: C9F1: CGCAGCCTGTAGCAAGCTCTGGAACTC; C9T2: TACGCATCCCAGTTTTGAGACG; C9T3: TACGCATCCCAGTTTTGAGACGCCGGGGCCGGGGCCGGGGCCGGGG; C9R4: TGCGCTCCGCCCGCCGCGGGCGCAGGCACCGCA; The concentration of primer C9F1 is 10 μM, and the amount used is 1 × n μl; the concentration of primer C9T2 is 10 μM, and the amount used is 1 × n μl; the concentration of primer C9T3 is 10 μM, and the amount used is 0.1 × n μl; the concentration of primer C9R4 is 10 μM, and the amount used is 2 × n μl; where n = number of samples to be detected + 1.
2. A kit characterized in that, The kit contains the primer set as described in claim 1.
3. The kit of claim 2, wherein The kit includes 2×GoldStar BestMaster Mix reagent at a volume of 12.5×nμl; DMSO at a volume of 1×nμl; and ddH2O at a volume of 6.4×nμl.
4. The primer set of claim 1 for detecting dynamic mutations in the GGGGCC repetitive sequence of the C9orf72 gene or the kit of claim 2, used in the preparation of a diagnostic agent for dynamic mutations in the hexanucleotide GGGGCC hexanucleotide of the C9orf72 gene associated with dementia.
5. A system for detecting dynamic mutation of GGGGCC repeat sequence of C9orf72 gene, characterized in that, include: An extraction and amplification module for extracting DNA and performing PCR amplification using the primer set described in claim 1; A capillary electrophoresis module is used to perform capillary electrophoresis on the products amplified by the PCR. The analysis module is used to analyze the GGGGCC duplication status of the C9orf72 gene; The PCR amplification includes: Prepare the amplification reaction mixture according to the number of DNA samples to be tested. The amplification reaction mixture includes 12.5 × n μl of 2 × GoldStarBest Master Mix reagent; 1 × n μl of 10 μM C9F1 primer; 1 × n μl of 10 μM C9T2 primer; 0.1 × n μl of 10 μM C9T3 primer; 2 × n μl of 10 μM C9R4 primer; 1 × n μl of DMSO; and 6.4 × n μl of ddH2O. Where n = number of samples to be tested + 1. Add 1 μl of DNA to 24 μl of amplification reaction mixture. Perform PCR amplification.
6. The system for detecting dynamic mutation of GGGGCC repeat sequence of C9orf72 gene according to claim 5, wherein, The PCR amplification includes: Denature at 98°C for 5 minutes in a PCR instrument; then run the following cycle 35 times: denature at 98°C for 35 seconds, anneal at 62°C for 35 seconds, extend at 72°C for 3 minutes; then extend at 72°C for 10 minutes, and store at 4°C.
7. The system for detecting dynamic mutation of GGGGCC repeat sequence of C9orf72 gene according to claim 5, wherein, The capillary electrophoresis process includes: Dilute the PCR amplification product and add it to ddH2O; mix ABI GS500-LIZ internal standard and HIDI at a volume ratio of 1:250, and then mix the mixture with the diluted PCR amplification product to prepare the PCR mixture; run the prepared PCR mixture on the PCR instrument at 95℃ for 3 minutes, then cool it in an ice-water mixture for 5 minutes, and perform denaturation treatment at 0℃; The genotyping mixture was analyzed using an ABI 3730xl sequencer, employing G5 color grouping. The genotyping parameters on the ABI 3730xl sequencer were set as follows: OVEN Temperature 60℃; Buffer Temperature 35℃; PreRun Voltage 15kV; PreRun Time 180s; Injection Voltage 1.5kV; Injection Time 15s; First ReadOut Time 300ms; Second ReadOut Time 300ms; Run Voltage 15kV; Voltage_Number_of_steps set to 10 steps; Voltage_steps_Interval set to 20s; Voltage_Tolerance set to 0.6kV; Current_Stability set to 30uA; Ramp_Delay set to 1s; Data_Delay set to 600s; Run_Time set to 1600s.
8. The system for detecting dynamic mutation of GGGGCC repeat sequence of C9orf72 gene according to claim 5, wherein, The analysis of GGGGCC duplication in the C9orf72 gene includes: Genemaker ID v2.6 software was used to interpret the genotyping results. After verifying the internal standard peak, 112 bp was defined as GGGGCC1. The number of GGGGCC repeats was determined based on the number of fluorescence tandem peaks that appeared every 6 ± 2 bp. The first peak after (GGGGCC)n corresponds to the first allele; if there are more fluorescence tandem peaks after that, the second peak corresponds to the second allele.