Preparation and Application of Gold Cluster-Aptamer and Its Derivative Assemblies

Abstract

The present invention describes the preparation and application of an assembly of gold clusters - aptamers and their derivatives, including steps such as synthesis and purification, design and preparation of gold clusters - aptamers and their derivatives, etc. The gold cluster - aptamer nanomaterial comprises at least one aptamer and / or its derivative, and gold nanoclusters (GNCs); the aptamer and / or its derivative form a nanomaterial by self - assembling with the gold nanoclusters (GNCs), and the derivatives include, but are not limited to, conjugates of aptamers with drugs, fluorescent molecules, and contrast agents such as iron (Fe), manganese (Mn), copper (Cu), etc. The preparation steps of the nanomaterial used in the present invention are simple, with good controllability and repeatability, and because of their small size, GNCs can be excreted from the body through the kidneys, greatly enhancing the effect of targeting tumor cells and reducing their side effects.

Description

Technical Field

[0001] The present invention relates to the field of biomedical tumor diagnosis and treatment, and particularly to a preparation method and application of a self-assembled nanomaterial of a stable, size-tunable, biodegradable aptamer, aptamer-drug conjugate (ApDCs) and its derivatives prepared based on gold nanoclusters. Background Art

[0002] Cancer is a serious disease that seriously affects the health and life of all mankind. Accurately diagnosing cancer at an early stage and promptly taking effective treatment measures are the key factors for successful cancer treatment. Traditional methods for detecting cancer have disadvantages such as poor specificity, low sensitivity, and harm to patients, making it difficult to meet the requirements of early tumor detection, leading to the spread and metastasis of cancer and missing the best treatment opportunity. In recent years, a series of new molecules targeting tumor markers have been continuously developed, providing new opportunities for the clinical application of early tumor diagnosis. On the other hand, timely and effective treatment after diagnosing cancer is of great significance for improving the survival rate of patients.

[0003] Nucleic acid aptamer is a single-stranded oligonucleotide that can bind to target molecules with high specificity and high affinity, screened from an artificially synthesized DNA / RNA library. The basis of its molecular recognition is not base complementary pairing, but folding into secondary and tertiary structures, and specifically recognizing target molecules through the matching of the spatial structure with the conformation of the target molecule by means of intermolecular forces such as electrostatic attraction, hydrophobic interaction, and van der Waals force. Nucleic acid aptamers have a molecular recognition function similar to that of antibodies, but have more application advantages compared to antibodies. For example, they can be screened in vitro without relying on organisms, have a wide range of target molecules (metal ions, toxins, viruses, bacteria, cells, tissues, etc.), small molecular weight, low immunogenicity, easy solid-phase synthesis and labeling, good chemical stability, and can be stored at room temperature. Nucleic acid aptamers show great clinical application prospects in the fields of disease biomarker discovery, molecular diagnosis, targeted molecular medicine, molecular pathology, etc. To meet the requirements of "targeted therapy", artificial oligonucleotide aptamers are used as new targeted ligands to construct aptamer-drug conjugates (ApDCs) that can specifically bind to multiple targets. Compared with antibody-drug conjugates (ADCs), aptamer-drug conjugates (ApDCs) have several potential advantages. For example, nucleic acid aptamers can be chemically or enzymatically modified and bio-conjugated with therapeutic agents to optimize biological stability. The molecular weights of nucleic acid aptamers and aptamer-drug conjugates (ApDCs) are relatively small, and they are expected to penetrate tissues faster and deeper than antibody-drug conjugates (ADCs). Therefore, the application of nucleic acid aptamers in targeted drug delivery has received extensive attention due to their excellent selectivity, affinity, low immunogenicity, and easy synthesis.

[0004] However, one of the main problems with aptamer and aptamer-drug conjugates (ApDCs) therapy is their poor plasma stability and short half-life in serum, resulting in significant disadvantages in medical imaging diagnosis. At the same time, simple aptamers have poor stability and are vulnerable to degradation by enzymes in the complex physiological environment. One of the main problems with aptamer and ApDCs diagnosis and treatment is their plasma stability and half-life in serum.

[0005] In recent years, gold nanomaterials have become attractive materials for nucleic acid delivery due to their advantages such as tunable size and easy surface functionalization. Gold nanoclusters (GNCs) are a newly synthesized type of nanomaterial in recent years, with a particle size of about 2 nm, good fluorescence properties, and can be excreted from the body through various pathways in vivo, and the in vivo toxicity can be ignored. In addition, GNCs have excellent X-ray attenuation characteristics and can be used for computed tomography (CT) imaging. CT imaging can provide high spatial resolution, three-dimensional tomographic scan signals, and sufficient tissue penetration depth. Therefore, GNCs can be combined with aptamers or ApDCs for targeted drug delivery and CT diagnosis of tumors, and attempts are made to induce the self-assembly of aptamers or ApDCs with GNCs to form nanomaterials, thereby improving the stability of aptamers or ApDCs and solving the problem of difficult excretion of nanomaterials in the body. The research results have important scientific significance and clinical value for improving the stability of aptamers or ApDCs and the targeted precision diagnosis and treatment of tumors. Summary of the Invention

[0006] One aspect of the present invention relates to a method for assembling nucleic acid aptamers and ApDCs into nanomaterials by self-assembly, overcoming the problem of complex traditional preparation conditions, and this method does not affect the conformation or structure of nucleic acid aptamers, with strong applicability. Specifically, the present invention relates to a method for preparing a gold cluster-nucleic acid aptamer and its derivative assembly nanomaterial, and the method comprises the following steps:

[0007] 1) Synthesize and purify gold nanoclusters (GNCs):

[0008] After reacting chloroauric acid with GSH and polypeptide at 25-70 °C for 24-36 hours, the unreacted substances are removed by dialysis to obtain purified GNCs;

[0009] 2) Design and prepare nucleic acid aptamers and / or aptamer-drug conjugates (ApDCs) or their derivatives;

[0010] 3) Gold nanoclusters and nucleic acid aptamers and / or aptamer-drug conjugates or their derivatives are stirred at 4-37 °C for 1.5-2 hours and then self-assembled to form GNCs and nucleic acid aptamer nanocomposites (GNCs@nucleic acid aptamers and / or ApDCs or their derivatives).

[0011] The nucleic acid aptamers are selected from one or more or a combination of nucleic acid aptamers such as Sgc8, PD-L1, XQ-2D, c-Met, As1411, etc.; for example, Sgc8 is described in the reference J Am Chem Soc, 2019.141(10): p. 4282-4290; the PD-L1 nucleic acid aptamer is as described in the reference Angew Chem Int Ed Engl, 2020.59(12): p. 4800-4805; the XQ-2D nucleic acid aptamer is as described in the reference J Am Chem Soc, 2019.141(27): p. 10760-10769; the c-Met aptamer is as described in the reference J Am Chem Soc, 2019.141(32): p. 12673-12681. The As1411 nucleic acid aptamer is as described in the reference Nanomedicine, 2019.21: p. 102060.

[0012] The aptamer-drug conjugates (ApDCs) are selected from one or more or a combination of 5-Fu (5-fluorouracil) aptamer-drug conjugates, gemcitabine aptamer-drug conjugates, doxorubicin (DOX) aptamer-drug conjugates, cisplatin aptamer-drug conjugates; preferably, the aptamer-drug conjugates are derived from nucleic acid aptamers such as Sgc8, PD-L1, XQ-2D, c-Met, As1411, etc.; preferably, the aptamer-drug conjugates are derived from the nucleic acid aptamer Sgc8; preferably, the aptamer-drug conjugate is the Sgc8 nucleic acid aptamer modified with 5-Fu.

[0013] The molar ratio of chloroauric acid, GSH, and polypeptide is 1:5:5

[0014] In this application, nucleic acid aptamers and ApDCs are self-assembled with GNCs to form nanoparticles. Since the nucleic acid aptamers and ApDCs are located inside the particles, their rapid degradation by nucleases is avoided, and the circulation time of nucleic acid aptamers and ApDCs in the blood and the tumor retention time are prolonged.

[0015] The derivatives include, but are not limited to, conjugates of nucleic acid aptamers with drugs, fluorescent molecules, and contrast agents such as iron (Fe), manganese (Mn), copper (Cu), etc.

[0016] Another aspect of the present invention relates to gold cluster-nucleic acid aptamer nanomaterials, which comprise

[0017] at least one nucleic acid aptamer and / or its derivative, and

[0018] gold nanoclusters (GNCs);

[0019] The nucleic acid aptamer and / or its derivatives form a nanomaterial by self-assembling with the gold nanoclusters (GNCs), wherein the nucleic acid aptamer interacts with the gold nanoclusters through non-covalent bonds;

[0020] The gold cluster-nucleic acid aptamer nanomaterial and / or its derivative nanomaterial have biocompatibility, targeting, specificity, and stability;

[0021] The derivatives include conjugates of nucleic acid aptamers with drugs, fluorescent molecules, and contrast agents such as iron (Fe), manganese (Mn), and copper (Cu).

[0022] The derivatives are nucleic acid aptamers modified with chemical drugs or antibody drugs; the derivatives are nucleic acid aptamers modified with chemical drugs and antibody drugs; wherein the derivatives are aptamer-drug conjugates (ApDCs) and aptamer conjugates for imaging diagnosis; the drug molecules in the aptamer-drug conjugates are one or more of 5-Fu, gemcitabine, doxorubicin, and cisplatin;

[0023] The aptamer-drug conjugates are derived from nucleic acid aptamers such as Sgc8, PD-L1, XQ-2D, c-Met, As1411, etc., and / or conjugates of nucleic acid aptamers with fluorescent molecules and contrast agents such as iron (Fe), manganese (Mn), and copper (Cu); preferably, the aptamer-drug conjugates are nucleic acid aptamers Sgc8 and XQ-2D modified with 5-Fu.

[0024] Alone, ApDCs have poor stability and are easily degraded, so their therapeutic effects are significantly affected during treatment. Enhancing the therapeutic effect of 5-Fu is also an urgent problem to be solved. The assembly of ApDCs and gold nanoclusters can improve the stability of ApDCs, help extend the circulation time of ApDCs in the blood and the tumor retention time. And the long-term retention of ApDCs in tumors helps improve the therapeutic effect and promote drug-induced tumor cell death. Solve the problem of the retention of nanomaterials in the body. After the disassembly of the GNCs@ApDCs assembly, ApDCs can be biodegradable, and the gold nanoclusters can be excreted from the body through the kidneys.

[0025] The present invention specifically relates to a gold nanocluster-nucleic acid aptamer Sgc8 assembly, which includes,

[0026] At least one nucleic acid aptamer Sgc8, and

[0027] Gold nanoclusters (GNCs),

[0028] The nucleic acid aptamer Sgc8 forms a nanomaterial by self-assembling with the gold nanoclusters (GNCs);

[0029] The nucleic acid aptamer Sgc8 is modified with different contents of 5-fluorouracil, and the targeting property of the nucleic acid aptamer Sgc8 is not changed;

[0030] The gold nanocluster-nucleic acid aptamer Sgc8 assembly has targeting property, stability and biocompatibility.

[0031] Among them, for the above-mentioned gold nanocluster-nucleic acid aptamer Sgc8 assembly, one or more of the 5-fluorouracils are inserted or replace the nucleotides of the nucleic acid aptamer Sgc8, or modify both ends of the nucleic acid aptamer Sgc8; preferably, the 5-fluorouracil modifies both ends of the nucleic acid aptamer Sgc8;

[0032] Preferably, the 5-fluorouracil modifies the 5' end of the nucleic acid aptamer Sgc8; preferably, the sequence of the 5' end of the nucleic acid aptamer Sgc8 modified by 5-fluorouracil is: 5-Fu, (5-Fu)T(5-Fu)-, (5-Fu)T(5-Fu)T(5-Fu)-, (5-Fu)(5-Fu)(5-Fu)(5-Fu)(5-Fu)-.

[0033] The above-mentioned gold nanocluster-nucleic acid aptamer Sgc8 assembly can, by changing the aptamer, achieve targeted diagnosis and treatment of various tumors, has strong universality, and solves the problems of site specificity of traditional chemical methods and complex production steps. The aptamer-drug conjugate is derived from nucleic acid aptamers such as Sgc8, PD-L1, XQ-2D, c-Met, As1411, etc.; preferably, the aptamer-drug conjugate is the nucleic acid aptamer Sgc8 modified with 5-Fu.

[0034] Another aspect of the present invention relates to the use of the gold cluster-nucleic acid aptamer nanomaterial for PET and / or CT imaging of tumors. The gold nanocluster-nucleic acid aptamer nanomaterial is as described in any one of the above; the nucleic acid aptamer is modified with a contrast molecule, a imaging molecule or a fluorescent molecule, etc., so as to be able to be used for PET imaging and / or CT imaging of tumors, etc.; preferably, the nucleic acid aptamer is the nucleic acid aptamer modified with NOTA. The nucleic acid aptamer in the self-assembled nanomaterial for tumor diagnosis and treatment can be modified with NOTA and used for PET imaging of tumors. At the same time, the GNCs in the self-assembled nanomaterial can be used for CT imaging of tumors.

[0035] The present invention also relates to the use of the gold cluster-nucleic acid aptamer nanomaterial for tumor treatment. The gold nanocluster-nucleic acid aptamer nanomaterial is as described in any one of the above; the nucleic acid aptamer contains a chemotherapeutic drug or an antibody drug and can be targeted and delivered to the tumor site.

[0036] The chemotherapeutic drug can be 5-Fu, gemcitabine, cisplatin, doxorubicin; preferably, the dosage of the pharmaceutical composition is lower than that of the pharmaceutical composition containing only the single nucleic acid aptamer. In a specific embodiment, the self-assembled nanomaterial for tumor diagnosis and treatment is administered by tail vein injection when used for animal diagnosis and treatment.

[0037] In the present invention, GNCs are used as a carrier, and 5-FuSgc8 aptamer and other aptamers such as PD-L1, XQ-2D, C-MET, etc. synthesized by solid phase are assembled into a nanomaterial with good biocompatibility through self-assembly for near-infrared imaging, CT imaging, PET imaging and treatment of animals. The self-assembly conditions of GNCs and nucleic acid aptamers are simple, and by changing the nucleic acid aptamer, the targeted diagnosis and treatment of various tumors can be realized, so it has strong universality.

[0038] Beneficial effects:

[0039] 1. The preparation conditions of the nanomaterial used in the present invention are mild, the steps are simple, controllable and have good repeatability.

[0040] 2. The prepared nano-drug carrier in the present invention has good biocompatibility. After the self-assembled nanomaterial disintegrates, the nucleic acid aptamer can be degraded by nuclease, and GNCs can be excreted from the body through the kidney due to their small size.

[0041] 3. The prepared nanomaterial in the present invention contains a targeting aptamer and has a good effect on targeting tumor cells.

[0042] 4. The targeting aptamer of the prepared nanomaterial in the present invention can further lead the nano-drug carrier into tumor cells, so the treatment effect is good.

[0043] 5. The chemotherapeutic drug 5-Fu in the prepared nano-drug carrier in the present invention can be replaced with gemcitabine, cisplatin, doxorubicin, etc.

[0044] 6. The nucleic acid aptamer in the prepared nano-drug carrier in the present invention can be replaced with PD-L1, XQ-2D, C-MET, As1411, etc., so it has strong universality.

[0045] 7. The prepared nanomaterial in the present invention can be used for PET / CT imaging of tumors, with low background, good interference, high penetration depth and sensitivity. SEQUENCE LISTING <110> Renji Hospital, Shanghai Jiao Tong University School of Medicine <120> Preparation and Application of Gold Cluster-Nucleic Acid Aptamer and Its Derivative Assembly <130> DPC.RJ.0021 <160> 1 <170> PatentIn version 3.3 <210> 1 <211> 41 <212> DNA <213> Artificial Sequence <400> 1 atctaactgc tgcgccgccg ggaaaatact gtacggttag a 41 BRIEF DESCRIPTION OF THE DRAWINGS

[0046] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the description of the embodiments or the prior art. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0047] Figure 1 It is a schematic structural diagram of a gold nanocluster aptamer-drug conjugate nanomedicine delivery carrier;

[0048] Figure 2 It is a TEM characterization diagram of gold nanoclusters and a gold nanocluster aptamer-drug conjugate nanomedicine delivery carrier;

[0049] Figure 3 It is an ultraviolet absorption picture and a fluorescence spectrum diagram of a gold nanocluster aptamer-drug conjugate nanomedicine delivery carrier;

[0050] Figure 4 It is a hydrodynamic particle size distribution picture and a ζ potential diagram of a gold nanocluster aptamer-drug conjugate nanomedicine delivery carrier;

[0051] Figure 5 It is a diagram of the experimental results of the stability of a gold nanocluster aptamer-drug conjugate nanomedicine delivery carrier and the stability of nucleic acid aptamers;

[0052] Figure 6 It is a diagram of the experimental results of the binding ability of a gold nanocluster aptamer-drug conjugate nanomedicine delivery carrier to colon cancer HCT116 cells;

[0053] Figure 7 It is a diagram of the experimental results of the test of a gold nanocluster nucleic acid aptamer (PD-L1, XQ-2D) nanodelivery carrier;

[0054] Figure 8 It is a diagram of the CCK-8 experimental results of a gold nanocluster aptamer-drug conjugate nanomedicine delivery carrier for the treatment of colon cancer HCT116;

[0055] Figure 9 It is a PET / CT imaging diagnosis diagram of a gold nanocluster aptamer-drug conjugate nanomedicine delivery carrier.

[0056] Detailed description

[0057] The following combines the accompanying drawings and examples to further describe the specific implementation manners of the present invention. The following examples are only used to more clearly illustrate the technical solutions of the present invention and cannot be used to limit the protection scope of the present invention.

[0058] Nanomaterials

[0059] The present invention describes a nanomaterial, which includes nucleic acid aptamers and gold nanoclusters (GNCs). Among them, the nucleic acid aptamers are self-assembled and combined with the gold nanoclusters (GNCs) through non-covalent interactions. For example, as Figure 1 shown, the positive charge (NH 3+ ) carried by the gold nanoclusters forms an ionic bond with the negative charge carried by the phosphate group (PO 4- ) of the nucleic acid aptamer to self-assemble into a nanomaterial.

[0060] The nanomaterial involved in the present invention can be applicable to various nucleic acid aptamers. For example, in a specific embodiment of the present invention, the nucleic acid aptamer is Sgc8; in an alternative embodiment, the nucleic acid aptamer is PD-L1 or XQ-2D; in another embodiment, the nucleic acid aptamer is c-Met or As1411 nucleic acid aptamer. The above self-assembled nanomaterial can be represented by GNCs@nucleic acid aptamer / ApDCs, such as GNCs@Sgc8, GNCs@PD-L1, GNCs@XQ-2D, etc.

[0061] The nucleic acid aptamers described above can also be replaced by their derivatives, and the derivatives include but are not limited to conjugates of nucleic acid aptamers with drugs, fluorescent molecules, and contrast agents such as iron (Fe), manganese (Mn), copper (Cu), etc.

[0062] Uses of Nanomaterials

[0063] Imaging diagnosis

[0064] After the nucleic acid aptamers of the gold cluster-nucleic acid aptamer and its derivative assemblies described above are modified with contrast molecules, imaging molecules or fluorescent molecules to form conjugates with fluorescent molecules, contrast agents such as iron (Fe), manganese (Mn), copper (Cu), etc., they can be used for near-infrared imaging, MRI, PET imaging, CT imaging, etc. of tumors to perform imaging diagnosis on tumor cells.

[0065] Tumor treatment

[0066] When chemotherapeutic drugs or antibody drugs (e.g., 5-Fu, gemcitabine, cisplatin, doxorubicin) are conjugated to the aptamers in the gold nanocluster-aptamer and its derivative assemblies described above, they can be conjugated with appropriate excipients to form a drug composition, which can be targeted to the tumor site for tumor treatment. In a specific embodiment, as a preferred option, the dosage of the drug composition can be lower than that of the drug composition containing only the aptamer alone.

[0067] Aptamer-Drug Conjugates (ApDCs)

[0068] Aptamers can be modified in practical applications, such as being modified with drug groups or fluorescent groups, etc. In a specific embodiment of the present invention, the aptamer is conjugated with a chemotherapeutic drug to form an aptamer-drug conjugate (ApDCs). The chemotherapeutic drugs selected in the present invention include 5-fluorouracil (5-Fu), gemcitabine, cisplatin, doxorubicin (DOX), and the embodiments described in the present invention can be selected from one or more of the above chemotherapeutic drugs.

[0069] The aptamer-drug conjugates are derived from aptamers such as Sgc8, PD-L1, XQ-2D, c-Met, As1411, etc., and / or conjugates of aptamers with fluorescent molecules and contrast agents such as iron (Fe), manganese (Mn), copper (Cu); preferably, the aptamer-drug conjugate is an aptamer Sgc8 or XQ-2D modified with 5-Fu.

[0070] The nanomaterials with good biocompatibility assembled by self-assembly can also be used for CT imaging, PET imaging and treatment of animals. The aptamers can be modified with contrast molecules, imaging molecules or fluorescent molecules that can be used for PET and CT imaging. As a preferred option, the aptamers in the nanomaterials for tumor diagnosis and treatment can be used for tumor PET imaging after being modified with NOTA. At the same time, as described above, the gold nanoclusters (GNCs) in the nanomaterials can be used for tumor CT imaging, and those skilled in the art can also apply the methods described in the present invention to near-infrared imaging and MRI imaging using a similar principle.

[0071] Gold Nanocluster-Nucleic Acid Aptamer

[0072] The Sgc8 nucleic acid aptamer described in the present invention can specifically recognize tyrosine protein kinase 7 (PTK7), for example, expressed in human acute lymphoblastic leukemia T lymphocytes (CCRF-CEM). In one embodiment, the nucleic acid aptamer Sgc8 self-assembles and binds to the gold nanoclusters (GNCs) through non-covalent interactions to form a gold cluster-nucleic acid aptamer Sgc8 nanomaterial. In this embodiment, the nucleic acid aptamer Sgc8 can be modified with 5-fluorouracil while ensuring that the targeting performance of the modified nucleic acid aptamer Sgc8 is not affected. This nanomaterial is denoted as GNCs@5-FuSgc8.

[0073] In one embodiment, one or more 5-fluorouracils are inserted into the nucleotides of the nucleic acid aptamer Sgc8, or directly replaced, and it can also be used to modify both ends of the nucleic acid aptamer Sgc8. As a preferred option, 5-fluorouracil is used to modify both ends of the nucleic acid aptamer Sgc8. Further preferably, 5-fluorouracil is used to modify the 5' end of the nucleic acid aptamer Sgc8. At this time, the sequence of the 5' end of the nucleic acid aptamer Sgc8 modified with 5-fluorouracil is: 5-Fu, (5-Fu)T(5-Fu)-, (5-Fu)T(5-Fu)T(5-Fu)-, (5-Fu)(5-Fu)(5-Fu)(5-Fu)(5-Fu)-. In one embodiment, the Sgc8 nucleic acid aptamer described in the present invention can be chemically conjugated with the chemotherapeutic drug DOX to form an acid-labile hydrazone bond. After specifically targeting CCRF-CEM cells, the conjugate is endocytosed into the endosomes of tumor cells, and the hydrazone bond breaks under low pH conditions to release the drug.

[0074] The PD-L1 nucleic acid aptamer described in the present invention is a nucleic acid aptamer that specifically recognizes and binds to cells with high expression of the PD-L1 protein, and has a strong binding force with cells. It can specifically recognize cells with high expression of the PDL1 protein. Programmed death molecule 1 (PD1) and its aptamer (programmed death ligand, PDL) belong to the co-stimulatory molecules of the B7 family and mediate negative regulatory signals of immune responses, playing a specific regulatory role in tumorigenesis, viral infections, and autoimmune diseases.

[0075] The XQ-2D nucleic acid aptamer described in the present invention can specifically recognize cancer cells such as pancreatic cancer cells. The nucleic acid aptamer XQ-2D can specifically bind to the CD71 glycoprotein and load the chemotherapeutic drug DOX, thereby achieving targeted delivery of the chemotherapeutic drug and targeted treatment of pancreatic cancer.

[0076] The nucleic acid aptamer c-Met described in the present invention is a type of receptor tyrosine kinase, which is c-Mesenchymal-epithelial transition factor (c-Met). The Met gene is located on the long arm of human chromosome 7 (7q21-31), about 125 kb in length, and contains 21 exons. c-Met is a transmembrane receptor encoded by the Met gene with autophosphorylation activity, belonging to the receptor tyrosine kinases (RTKs) superfamily. It consists of an extracellular Sema domain, PSI domain, IPT domain and an intracellular JM domain, catalytic TK domain, and C-terminus, and is mainly expressed in epithelial cells. The structure of c-Met is composed of an α chain and a β chain linked by disulfide bonds, and is divided into an extracellular domain, a transmembrane helical domain and an intracellular domain. Its extracellular domain contains three different functional regions: the SEMA domain (semaphorin, amino acid residues 25-514) covering the entire α chain and part of the N-terminus of the β chain, the cysteine-rich domain with 4 disulfide bonds (plexins-semaphorins-integrins, PSI, amino acid residues 515-561), and 4 immunoglobulin regions (immunoglobulin-plexin-transcription, IPT, amino acid residues 562-922). After the transmembrane region of the helical structure (amino acid residues 923-956), the intracellular domain (amino acid residues 957-1390) is also composed of three regulatory regions, namely the juxtamembrane domain containing the phosphorylation sites of Tyr1003 and Ser985, the catalytic domain containing the phosphorylation sites of Tyr1234 and Tyr1235, and the C-terminal multifunctional binding region containing Tyr1349 and Tyr1356. The extracellular SEMA domain is the key region for ligand binding. The juxtamembrane domain usually plays a negative regulatory function on c-Met signal transduction. The catalytic domain mainly undergoes autophosphorylation to activate downstream signals and plays a positive regulatory role in tyrosine kinase catalytic activity. The C-terminal multifunctional binding region mainly recruits various protein factors and adapter molecules in the cytoplasm and plays a role in signal transmission.

[0077] As1411 described in the present invention is a guanine-rich DNA aptamer containing a 26-nucleotide fragment and is considered the first anti-tumor aptamer to enter clinical research. As1411 is obtained through cell screening, and its mechanism of action is not very clear. It is generally believed that it binds to nucleolin located on the surface of tumor cells with high selectivity and specificity, and is then endocytosed by the cells, binds to nucleolin in the cytoplasm, inhibits nuclear factor kB, destabilizes the mRNA of the anti-apoptotic BCL-2 protein (B-cell Lymphoma protein), thereby causing the death of tumor cells. Reyesreyes et al. studied the mechanism of action of As1411 and believed that As1411 binds to nucleolin, continuously activates the Rac1 protein, overly stimulates macropinocytosis, and causes cell death.

[0078] Preparation and Application of Gold Cluster-Nucleic Acid Aptamer A nanomaterial under an embodiment described in the present invention can be prepared by the following method.

[0079] 1) Synthesis and purification of gold nanoclusters (GNCs): After chloroauric acid reacts with GSH and polypeptide at a certain ratio at a certain temperature for 24 hours, the reaction product is dialyzed with deionized water for 3 days to remove unreacted substances, and the final product GNCs is freeze-dried by a freeze dryer and stored in a -20°C refrigerator. The final product GNCs have the same morphology and a particle size of about 2 nm.

[0080] 2) Design and preparation of aptamers:

[0081] Design different aptamers while ensuring that the targeting performance of the modified aptamers is not affected. In this project, different aptamer drugs are synthesized by solid-phase synthesis. They are characterized by mass spectrometry, infrared absorption spectroscopy, etc.

[0082] 3) Preparation of self-assembled nanomaterials GNCs@aptamer / ApDCs with targeting function: Explore the assembly conditions and ratios of GNCs and aptamer / ApDCs, and screen out the optimal assembly ratio and conditions. Control the size and charge properties of GNCs@aptamer / ApDCs by the mass ratio of GNCs to aptamer / ApDCs.

[0083] 4) Preparation of self-assembled nanomaterials GNCs@PD-L1: Select the PD-L1 aptamer targeting tumor cells, and the preparation method of GNCs@PD-L1 is the same as that in 3).

[0084] 5) Preparation of self-assembled nanomaterials GNCs@XQ-2D: Select the aptamer XQ-2D targeting pancreatic cancer cells, and the preparation method of GNCs@XQ-2D is the same as that in 3).

[0085] 6) Self-assembled nanomaterials with targeting functions, such as GNCs@ApDCs, GNCs@PD-L1, and GNCs@XQ-2D, are used for the diagnosis and treatment of tumors.

[0086] Furthermore, the aptamer / ApDCs in step 2) can improve the targeting performance of the self-assembled nanomaterial GNCs@5-FuSgc8.

[0087] Furthermore, the assembly conditions in step 3) are mild and simple, without complex experimental steps, with low requirements for experimental operators, and can achieve quantitative production.

[0088] The chemotherapeutic drugs in step 3) can be used for the treatment of tumors, and the chemotherapeutic drugs can be 5-fluorouracil (5-Fu), gemcitabine, cisplatin, doxorubicin (DOX), etc.

[0089] Among them, the single aptamer / ApDCs in step 3) have poor stability and are easily degraded, so their effects are significantly affected during treatment. After ApDCs(5-FuSgc8) self-assembled with gold nanoclusters to form the nanomaterial GNCs@aptamer / ApDCs, because some of the aptamer / ApDCs are located inside the nanomaterial, it avoids their rapid degradation by nucleases, prolongs the circulation time of aptamer / ApDCs in the blood and the tumor retention time, and the long-term retention of aptamer / ApDCs in tumors helps to improve the curative effect and promote drug-induced tumor cell death.

[0090] Steps 4) and 5) can achieve targeted diagnosis and treatment of different tumors by replacing the aptamer. Due to the easy operation and batch stability of aptamer synthesis and preparation, through this assembly method and steps, targeted diagnosis and treatment of multiple tumors can be achieved by replacing the aptamer.

[0091] The dose of GNCs@aptamer / ApDCs used for tumor cell treatment in step 6) is lower than that of the single drug.

[0092] The self-assembled nanomaterials used for tumor diagnosis and treatment in step 6) are administered by tail vein injection when used for animal diagnosis and treatment.

[0093] The aptamer in the self-assembled nanomaterials used for tumor diagnosis and treatment in step 6) can be modified with NOTA and used for PET imaging of tumors. At the same time, the GNCs in the self-assembled nanomaterials can be used for CT imaging of tumors, such as PET imaging as Figure 9 shown.

[0094] When used for targeted diagnosis and treatment of tumors in step 6), targeted diagnosis and treatment of specific tumors can be achieved by replacing the aptamer according to the specificity of different aptamers. And the steps are simple to operate and do not require too much condition exploration.

[0095] The nucleic acid aptamers and aptamer-drug conjugates (ApDCs) described above can be replaced with their derivatives. Examples

[0096] Example 1

[0097] Preparation of gold nanoclusters (GNCs):

[0098] Add 1 mL of deionized water to a 1.5 mL centrifuge tube, then continue to add freshly prepared 95 mM chloroauric acid. Subsequently, add freshly prepared 150 mM glutathione and thiol polypeptide, heat to 70 °C at a rotation speed of 500 rpm, and continue stirring for 24 hours.

[0099] Purification of gold nanoclusters (GNCs):

[0100] Add methanol to the synthesized gold nanoclusters (GNCs), then centrifuge at 9000 rpm for 10 minutes to remove insoluble impurities, completing the primary purification. Subsequently, place the preliminarily purified gold nanoclusters in a dialysis bag, dialyze with deionized water for 3 days, and freeze-dry under vacuum using a freeze dryer. After drying, store at -20 °C in a refrigerator for later use.

[0101] Self-assembly:

[0102] Gold nanoclusters (GNCs) self-assemble with the nucleic acid aptamer Sgc8 modified with 5-fluorouracil to form the nanomaterial GNCs@5-FuSgc8 as described above. Design nucleic acid aptamers modified with 5-Fu at different contents while ensuring that the targeting performance of the modified nucleic acid aptamer is not affected; the sequence of Sgc8 is:

[0103] ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA (SEQ ID NO.: 1).

[0104] In this project, nucleic acid aptamer drugs (5-FuSgc8) modified with 5-Fu at different contents are synthesized by solid-phase synthesis. 5-FuSgc8 is characterized by mass spectrometry, infrared absorption spectroscopy, etc.

[0105] 1-1(5-Fu)Sgc8 (FAM)(5-Fu)ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA 2-2(5-Fu)Sgc8 (FAM)(5-Fu)T(5-Fu)ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA 3-3(5-Fu)Sgc8 (FAM)(5-Fu)T(5-Fu)T(5-Fu)ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA 4-5(5-Fu)Sgc8 (FAM)(5-Fu)(5-Fu)(5-Fu)(5-Fu)(5-Fu)ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA 5-5(5-Fu)Sgc8 (Cy5)(5-Fu)(5-Fu)(5-Fu)(5-Fu)(5-Fu)ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA

[0106] Table 1. Design of ApDCs (5-FuSgc8)

[0107] Exploration of the assembly conditions and methods of gold nanoclusters (GNCs) and (5-FuSgc8):

[0108] First, the pre-prepared positively charged gold nanoclusters were dissolved in an aqueous solution with a pH of 7.4 and ultrasonically dispersed. Subsequently, 5-FuSgc8 was treated at 95 °C for 5 min. After an ice bath for a period of time, it was slowly added to the aqueous solution containing gold nanoclusters and stirred at room temperature for 15 min (GNCs and 5-FuSgc8 were in a certain mass ratio). The prepared product was collected and stored at 4 °C for later use. It was found by transmission electron microscopy characterization that gold nanoclusters (GNCs) and 5-FuSgc8 could be assembled into spherical nanomaterials GNCs@5-FuSgc8. To explore the optimal assembly ratio of gold nanoclusters (GNCs) and 5-FuSgc8, different gradient mass ratios of gold nanoclusters (GNCs) and 5-FuSgc8 were set, and the size and charge properties of GNCs@5-FuSgc8 were tested by transmission electron microscopy and nanoparticle sizer. Finally, it was found that the size and charge performance of GNCs@5-FuSgc8 could be controlled by the mass ratio of GNCs and 5-FuSgc8. Considering its biological applications and the stability of aptamers, self-assembled particles with a size of about 100 nm were selected for subsequent biological experiments and applications. By observing the distribution of GNCs in the GNCs@5-FuSgc8 nanomaterial through HRTEM, it was found that gold nanoclusters (GNCs) were uniformly distributed in the nanomaterial GNCs@5-FuSgc8.

[0109] Figure 1 shows the structural schematic diagram and preparation method flowchart of the product to be fabricated in Example 1. The positive charges carried by the gold nanoclusters (GNCs) and 5-FuSgc8 ammonium ions (NH 3+ ) and the negative charges carried by phosphate groups (PO 4- ) form ionic bonds to assemble into the nanomaterial GNCs@5-FuSgc8. Figure 2 are the TEM result pictures of gold nanoclusters (GNCs) and GNCs@5-FuSgc8. It can be seen from the pictures that GNCs are spherical nanomaterials with a particle size of about 2 nm. After being assembled with 5-FuSgc8 into the nanomaterial GNCs@5-FuSgc8, the morphology is still spherical nanomaterials, but the particle size increases significantly, and the size varies due to the assembly ratio of the two. Figures 3-4 The distribution shows the ultraviolet absorption, hydrodynamic particle size distribution, and ζ-potential diagrams of Sgc8, 5-FuSgc8, gold nanoclusters (GNCs), and GNCs@5-FuSgc8. It can be seen from Picture 4 that the synthesized GNCs@5-FuSgc8 nanomaterial has a particle size of about 129 nm after assembly, which is significantly larger than the particle size of the unassembled gold nanoclusters (GNCs). Figure 3(Left figure) shows that GNCs@5-FuSgc8 has the ultraviolet absorption characteristic peaks of 5-FuSgc8, fully indicating that the self-assembled GNCs@5-FuSgc8 contains the characteristic absorption peaks of 5-FuSgc8. Figure 3 (Right figure) shows that GNCs@5-FuSgc8 contains the fluorescence of FAM on 5-FuSgc8. Figure 5 Shows the stability detection results of Sgc8 and GNCs@5-FuSgc8 in the presence of Dnase.

[0110] Example 2

[0111] Evaluation of the targeting binding ability of GNCs@5-FuSgc8 to leukemia cell CEM and colon cancer cell HCT116:

[0112] First, using Scramble and Library libraries as negative control strands, Sgc8 as the positive control strand, and the 5-FuSgc8 strand as the 5-Fu modified experimental group strand, after adding the binding buffer, co-incubate with HCT116 cells for 30 minutes, and then wash away the unbound nucleic acid aptamers with the washing solution. Explore the specific binding ability of the 5-Fu modified experimental group strand to PTK7-expressing positive cells such as leukemia CEM cells and human colon cancer HCT116 cells by flow cytometry and confocal microscopy. After testing that all 5-Fu modified strands do not affect their targeting performance, then determine the binding ability of GNCs@5-FuSgc8 and GNCs@Library to HCT116 cells and CEM cells by flow cytometry and confocal microscopy. At the same time, use FHC cells with low PTK7 expression content in colon cancer as the negative control. As Figure 6 shown, it was found that GNCs@5-FuSgc8 can target and bind well to PTK7-expressing positive cells (CEM cells and HCT116 cells).

[0113] Example 3

[0114] Experimental study on the universality of nanomaterial self-assembly:

[0115] Gold nanoclusters (GNCs) self-assembled with PD-L1 and XQ-2D nucleic acid aptamers respectively to form GNCs@PD-L1 and GNCs@XQ-2D. The structural information of the PD-L1 nucleic acid aptamer is recorded in the literature Angew Chem Int Ed Engl, 2020.59(12): p.4800-4805, and the XQ-2D nucleic acid aptamer is recorded in J Am Chem Soc, 2019.141(27): p.10760-10769. Through experimental exploration, it was found that gold nanoclusters (GNCs) can form uniform spherical nanomaterials with any nucleic acid aptamer. Therefore, gold nanoclusters (GNCs) were self-assembled with PD-L1 and XQ-2D in the manner of Example 2 to form uniform GNCs@PD-L1 and GNCs@XQ-2D nanomaterials. And the size and charge properties can be controlled by the mass ratio in the manner of Example 2. This fully demonstrates the universality of the experimental method and can be used for the self-assembly of various targeted nucleic acid aptamers. Replace the 5-Fu-modified Sgc8 nucleic acid aptamer with PD-L1, and self-assemble the PD-L1 nucleic acid aptamer with GNCs into the nanomaterial GNCs@PD-L1. Then, test the binding ability of the self-assembled nanomaterial to the PD-L1 high-expression cell line, and use the random sequence as the negative control strand.

[0116] The experimental results are as Figure 7 shown. The results show that the nucleic acid aptamer PD-L1 and the drug conjugate (ApDCs) nanodrug delivery carrier containing gold nanoclusters (GNCs) have universality, so different nucleic acid aptamers and chemotherapeutic drugs can be selected for self-assembly for different cancer treatments.

[0117] And so on, replace the 5-Fu-modified Sgc8 nucleic acid aptamer (5-FuSgc8) with the XQ-2D nucleic acid aptamer and assemble it with gold nanoclusters (GNCs) to form the self-assembled nanomaterial GNCs@XQ-2D and test its ability to target breast cancer cells. Test the targeting binding ability of GNCs@PD-L1 and GNCs@XQ-2D to breast cancer cells. The same as the steps in Example 2, mix GNCs@PD-L1 and GNCs@XQ-2D in the binding buffer and add them to MDR-231 cells for co-incubation for 30 minutes, and then wash away the unbound nucleic acid aptamer with the washing solution. Test the targeting binding ability of GNCs@PD-L1 and GNCs@XQ-2D to breast cancer cells and pancreatic cancer cells by flow cytometry and confocal microscopy. The results show that GNCs@PD-L1 has specific targeting binding ability to breast cancer cells. The targeting binding ability of GNCs@XQ-2D to pancreatic cancer cells is better than that of the single nucleic acid aptamer XQ-2D.

[0118] The results are as Figure 8As shown, the targeting ability of GNCs@PD-L1 to cell lines with high expression of PD-L1 is significantly better than that of the aptamer PD-L1 alone, and the targeting ability of GNCs@XQ-2D is better than that of the aptamer XQ-2D alone. The experimental results fully demonstrate that gold nanoclusters (GNCs) can be used for targeted therapy of different tumors after self-assembly with different aptamers. Therefore, the universality of this assembly method is strong and it is easy to promote and use.

[0119] Example 4

[0120] Stability test of GNCs@5-FuSgc8 nanomaterials in serum:

[0121] After self-assembly, GNCs@5-FuSgc8 was placed in a refrigerator at 4°C, and its hydrodynamic particle size distribution was measured at regular intervals to judge the stability of GNCs@5-FuSgc8 in aqueous solution. Stability test of GNCs@5-FuSgc8 nanoassemblies:

[0122] 5-FuSgc8 and GNCs@5-FuSgc8 were incubated with different amounts of enzymes at 37°C, and the stability of 5-FuSgc8 and GNCs@5-FuSgc8 was judged by agarose gel electrophoresis. The results are as Figure 5 shown, the stability of the assembled aptamer is significantly higher than that of 5-FuSgc8.

[0123] Example 5

[0124] Biocompatibility of gold nanoclusters (GNCs) and efficacy experiment of GNCs@5-FuSgc8 on HCT116 cells:

[0125] a. Biocompatibility of GNCs;

[0126] b. Efficacy of GNCs@5-FuSgc8 on HCT116 cells, detected by CCK-8 experiment:

[0127] HCT116 cells were seeded into 96-well plates at a density of 5000 cells per well. After culturing for 24 hours, fresh medium containing 5-Fu (0 - 30 μM), 5-FuSgc8 (0 - 30 μM), GNCs@5-FuSgc8 (0 - 30 μM, 5-FuSgc8), and GNCs (with the same GNC content as GNCs@5-FuSgc8) as well as PBS (control group) was added and cultured for a period of time. The absorbance at 450 nm was measured by a microplate reader and the efficacy of GNCs@5-FuSgc8 on HCT116 cells was calculated. The results are as Figure 8 shown, the efficacy of GNCs@5-FuSgc8 is significantly better than that of 5-FuSgc8.

[0128] The foregoing description of the disclosed embodiments enables those skilled in the art to implement or use the present application. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present application. Therefore, the present application is not limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. Preparation method of gold cluster-aptamer assembly, characterized in that, The method includes the following steps: 1) Synthesis and purification of gold nanoclusters (GNCs): After reacting chloroauric acid with GSH and polypeptide at 25 - 70 °C for 24 - 36 hours, unreacted substances are removed by dialysis to obtain purified GNCs; 2) Design and preparation of aptamers and / or aptamer-drug conjugates (ApDCs); 3) Gold nanoclusters and aptamers and / or aptamer-drug conjugates are self-assembled at 4 - 37 °C with stirring for 1.5 - 2 hours to form GNCs and aptamer nanocomposites (GNCs@aptamers and / or ApDCs); The aptamers are selected from one or more of Sgc8, PD-L1, and XQ-2D aptamers; The aptamer-drug conjugate is Sgc8 modified with 5-Fu, and the sequence at the 5' end of the 5-Fu-modified Sgc8 is: 5-Fu, (5-Fu)T(5-Fu)-, (5-Fu)T(5-Fu)T(5-Fu)-, (5-Fu)(5-Fu)(5-Fu)(5-Fu)(5-Fu)-.

2. Gold cluster-aptamer nanomaterials, characterized in that, It comprises, at least one aptamer and / or its derivative, and gold nanoclusters (GNCs); The aptamer and / or its derivative and the gold nanoclusters (GNCs) form a nanomaterial by self-assembly, wherein the aptamer and the gold nanoclusters interact through non-covalent bonds; The gold cluster-aptamer nanomaterial and / or its derivative nanomaterial has biocompatibility, targeting, specificity, and stability; The derivative is an aptamer-drug conjugate; the aptamer is selected from one or more of Sgc8, PD-L1, and XQ-2D aptamers; The aptamer-drug conjugate is Sgc8 modified with 5-Fu, and the sequence at the 5' end of the 5-Fu-modified Sgc8 is: 5-Fu, (5-Fu)T(5-Fu)-, (5-Fu)T(5-Fu)T(5-Fu)-, (5-Fu)(5-Fu)(5-Fu)(5-Fu)(5-Fu)-.

3. Gold nanocluster-aptamer Sgc8 assembly, characterized in that, It includes, at least one aptamer Sgc8, and gold nanoclusters (GNCs), The aptamer Sgc8 and the gold nanoclusters (GNCs) form a nanocomposite by self-assembly; The aptamer Sgc8 is modified with different contents of 5-fluorouracil without changing the targeting of the aptamer Sgc8, and the sequence at the 5' end of the 5-fluorouracil-modified Sgc8 is: 5-Fu, (5-Fu)T(5-Fu)-, (5-Fu)T(5-Fu)T(5-Fu)-, (5-Fu)(5-Fu)(5-Fu)(5-Fu)(5-Fu)-.

4. Use of the gold cluster-aptamer nanomaterial, characterized in that, The gold cluster-aptamer nanomaterial is as described in claim 2; the aptamer is modified with a contrast molecule, a developing molecule, or a fluorescent molecule for preparing drugs or kits required for tumor near-infrared imaging, MRI, PET imaging, and / or CT imaging.

5. The use according to claim 4, characterized in that, The gold cluster-aptamer nanomaterial is also used for preparing drugs or kits required for tumor treatment.

Images