A KASP marker associated with wheat grain morphological traits and its application

By detecting A or G bases using KASP markers at position 12610251bp on wheat chromosome 4B, the problem of efficient detection of wheat grain morphology traits in early generations was solved, enabling early screening and genetic improvement in wheat breeding, and improving detection rate and breeding efficiency.

CN115612750BActive Publication Date: 2026-04-17CHENGDU INSTITUTE OF BIOLOGY CHINESE ACADEMY OF SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
CHENGDU INSTITUTE OF BIOLOGY CHINESE ACADEMY OF SCIENCES
Filing Date
2022-10-11
Publication Date
2026-04-17

AI Technical Summary

Technical Problem

Existing technologies make it difficult to efficiently and non-destructively detect wheat grain morphological traits in early generations, affecting the speed and effectiveness of wheat breeding and selection.

Method used

A KASP marker located at 12610251 bp on wheat chromosome 4B was developed. By detecting A or G bases using specific primer pairs, molecular marker-assisted selection of grain roundness and grain size ratio was achieved, providing tightly linked KASP markers for the identification and typing of grain morphological traits.

Benefits of technology

It enables early screening of wheat grain morphological traits and efficient detection during the breeding process, shortens the breeding process, provides target loci for grain morphological genetic improvement, and improves detection rate and breeding efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0003884241060000061
    Figure BDA0003884241060000061
  • Figure BDA0003884241060000071
    Figure BDA0003884241060000071
  • Figure BDA0003884241060000072
    Figure BDA0003884241060000072
Patent Text Reader

Abstract

The application belongs to the field of molecular biology, and particularly relates to a KASP marker related to a wheat kernel morphology trait and application thereof. The specific technical scheme is as follows: application of a QTL site in wheat breeding, the QTL site is located in the 12.5-23.5 cM interval of the 4B chromosome of wheat. The developed KASP marker is located at 12610251 bp in the interval, and the 12610251th base is A or G. The application locates a main stable QTL site capable of simultaneously controlling the grain roundness and grain size ratio traits on the short arm of the 4B chromosome of wheat, and provides a target site for genetic improvement of the wheat kernel morphology. The application also develops a closely linked KASP marker based on the QTL site, which is convenient to detect, and provides a marker for molecular marker assisted selection in the process of genetic improvement and breeding of the wheat kernel morphology, so that the detection rate can be effectively improved, and the breeding process is shortened.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular biology, specifically relating to a KASP marker related to wheat grain morphology traits and its application. Background Technology

[0002] Wheat is one of the most important and widely planted grain crops in my country and even globally. Wheat grain traits, including grain morphology and size, are important factors affecting wheat marketability and have long been a focus of breeders.

[0003] Traditional methods for evaluating wheat grain quality involve analyzing processing quality indicators. However, analyzing these indicators, such as extensibility and maximum tensile resistance, presents significant challenges. It typically requires grinding large quantities of grain to meet the testing needs, making the process time-consuming, labor-intensive, and demanding. Furthermore, it imposes requirements on seed quantity and causes irreversible damage to the seeds, hindering early-generation selection. While advancements in phenomics have led to the development of non-destructive methods for predicting wheat processing quality indicators, such as near-infrared spectroscopy, these methods still only allow for post-harvest analysis and are not entirely applicable to early generations with heterozygous genotypes, thus impacting breeding speed.

[0004] In contrast, marker-assisted selection is an effective method for predicting corresponding traits through genotype detection. The detection time is not affected by factors such as generations, development time, and growth environment, making it more efficient, scientific, and accurate.

[0005] The morphological characteristics of grains are important features affecting the milling process and yield formation. Previous studies have found that rice grain traits (roundness, grain size ratio, etc.) have a significant impact on rice processing and cooking quality. However, unlike rice, wheat grain morphology has not historically been as a focus of breeding selection as grain size, as wheat is primarily used for flour production and processing. However, recent studies have increasingly revealed a significant correlation between wheat grain quality and grain morphology. For example, reports indicate that hemispherical wheat grains have a higher flour extraction rate than elongated grains. Therefore, predicting wheat quality through grain morphology is a possible approach. However, current research on wheat grain morphology is relatively limited compared to studies on grain size.

[0006] If molecular markers related to wheat grain morphology can be provided, it is expected to enable early-generation screening of wheat traits, which has important scientific research value and application prospects. Summary of the Invention

[0007] The purpose of this invention is to provide a KASP marker related to wheat grain morphology traits and its application.

[0008] To achieve the above-mentioned objective, the technical solution adopted by the present invention is: the application of a KASP marker in wheat breeding, wherein the KASP marker is located at 12610251bp on wheat chromosome 4B, and the base of the 12610251bp is A or G.

[0009] Preferably, the KASP marker is used to detect QTL sites located in the 12.5–23.5 cM region of wheat chromosome 4B.

[0010] Correspondingly, primer pairs are used to amplify the QTL sites.

[0011] Preferably, the primer pair includes: a first forward primer: first probe - TCTGCTTAACAACACTAGCCTAAT-A; a second forward primer: second probe - TCTGCTTAACAACACTAGCCTAAT-G; and a reverse primer: ACAAAAAAGACTATTCATACGCCCA, wherein the first probe and the second probe are different probes.

[0012] Preferably, the first probe and the second probe are each bound with different fluorescent groups.

[0013] Accordingly, a set of primer pairs includes: a first forward primer GAAGGTGACCAAGTTCATGCTTCTGCTTAACAACACTAGCCTAATA; a second forward primer GAAGGTCGGAGTCAACGGATTTCTGCTTAACAACACTAGCCTAATG; and a reverse primer ACAAAAAAGACTATTCATACGCCCA.

[0014] Accordingly, the primer pair is used in amplifying the QTL site of claim 2 or in wheat breeding.

[0015] Accordingly, products for identifying wheat varieties or breeding wheat are prepared using the KASP marker, the QTL site, or the primer pair.

[0016] Preferably, the product is any one of reagents, test strips, and kits.

[0017] This invention offers the following advantages: This patent locates a major-effect stable QTL locus on the short arm of wheat 4B that can simultaneously control grain roundness and diameter ratio traits, providing a target locus and its marker for the genetic improvement of wheat grain morphology. Based on this QTL locus, this invention also develops a tightly linked, easily detectable KASP marker, providing a marker for marker-assisted selection in the genetic improvement of wheat grain morphology and the breeding process, effectively improving detection speed and shortening the breeding process. This molecular marker not only enables the identification and typing of grain morphology but also has a certain detection effect on maximum tensile resistance, providing a reference for selecting breeding parents for different processing uses and laying the foundation for simultaneously breeding high-quality wheat with excellent grain performance and good marketability. Attached Figure Description

[0018] Figure 1 A schematic diagram showing that QKrd.cib-4B.1 and QLwr.cib-4B.1 are co-located in the candidate interval;

[0019] Figure 2 A schematic diagram of the QTL mapping results for two grain morphological traits in the new genetic map after adding KASP markers. Detailed Implementation

[0020] This invention provides a key QTL cluster that can simultaneously control wheat grain roundness and grain size ratio. It aggregates two major-effect stable QTLs, QKrd.cib-4B.1 and QLwr.cib-4B.1, which respectively control grain roundness and grain size ratio, with average LOD values ​​of 6.12 and 6.06, explaining 11.54% and 12.53% of the phenotypic variation. Both QTLs are repeatedly detectable in all different environments and are stable major-effect QTL sites. Furthermore, the two QTLs co-localize to the same candidate region, namely the 12.5-23.5 cM interval. Figure 1 The corresponding physical location range of 12.54-41.56 Mb in the wheat reference genome indicates that the two may be controlled by the same gene, which is derived from the allele of Zhongkemai 138. It can reduce grain roundness and increase grain size ratio, and may be an important genetic basis affecting the morphological traits of wheat grains.

[0021] However, the flanking markers for this localization result all originated from the wheat 55K SNP chip, and the corresponding flanking SNP markers could not be tracked and verified for the target site in a conventional laboratory. To further improve the site detection method, this invention, based on the genomic information of the candidate region localization and the parental resequencing results, developed single nucleotide polymorphism (SNP) detection markers and corresponding competitive allele-specific PCR (KASP) markers. Within the candidate region, a single nucleotide polymorphism (SNP) of A / G was found at position 12610251. When the base expression was A, the grain roundness decreased and the grain size ratio increased; when the base expression was G, the grain roundness increased and the grain size ratio decreased.

[0022] Based on this QTL site, the present invention further provides a set of primer pairs. The primer pair consists of three sequences, specifically including: a forward primer Chr4B-12610251-A, where the F probe is GAAGGTGACCAAGTTCATGCT; and a primer for binding a first fluorescent group, such as the FAM fluorescent group, with the primer GAAGGTGACCAAGTTCATGCT. TCTGCTTAACAACACTAGC CTAAT A; Forward primer Chr4B-12610251-G, where the H probe is: GAAGGTCGGAGTCAACGGATT, and the primer for binding to a second fluorescent group of a different type and color than the corresponding fluorescent group of the F probe is: GAAGGTCGGAGTCAACGGATT. TCTGCTTAACAACACTAGCCTAAT G; Reverse primer: Chr4B-12610251-Common, primers are: ACAAAAAGACTATTCATACGCCC A.

[0023] The primers can successfully label the wheat grain perimeter trait. The genotype carrying the first fluorescent group is a genotype that reduces grain roundness and increases grain diameter ratio (the base at the site is A), and is defined as genotype A. The genotype carrying the second fluorescent group is a genotype that can increase grain roundness and reduce grain diameter ratio (the base at the site is G), and is defined as genotype B.

[0024] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. All obtained data are average values ​​obtained after at least three repetitions, and each repetition yields valid data.

[0025] Example

[0026] 1. Using the above primers, seedling DNA was extracted using the CTAB method, and marker polymorphism was tested on the parents of the QTL mapping population, Kemai 138 and Kechengmai 2.

[0027] The quantitative real-time PCR reaction system was as follows: 0.8 μl (10 μM) of primer set, in which the ratio of Chr4B-12610251-A, Chr4B-12610251-G and Chr4B-12610251-Common was 1:1:2 (volume ratio); 5 μl of 2×Master Mix; 2 μl of DNA template with a concentration of 50–200 ng / μl; and finally, deionized water was added to a total reaction volume of 10 μl.

[0028] Pre-denaturation at 95℃ for 10 minutes, denaturation at 95℃ for 20 seconds, annealing and extension at 61℃ for 40 seconds, 10 cycles, with the annealing and extension temperature decreasing by 0.6℃ in each cycle, denaturation at 95℃ for 20 seconds, annealing and extension at 55℃ for 40 seconds, 30 cycles, holding at 10℃, and collecting fluorescence patterns.

[0029] The results showed that Zhongkemai 138 carried the FAM fluorescent group and was identified as a genotype with reduced roundness and increased particle size ratio; Kechengmai 2 carried the HEX fluorescent group and was identified as a genotype with increased roundness and decreased particle size ratio; the heterozygous control was a heterozygous genotype. The identification results were consistent with the actual situation.

[0030] 2. Following the above method and reaction system, the primer set was used to perform genotyping and identification of the population families. Seed phenotype source: Planting was conducted in four environments in Shifang and Shuangliu during the 2020 and 2021 growing seasons. Environment 1: Shifang, 2020; Environment 2: Shuangliu, 2020; Environment 3: Shifang, 2021; Environment 4: Shuangliu, 2021. After the seeds matured in each environment, they were naturally air-dried. Six individual plants were randomly selected from each family. The roundness, diameter ratio, and other morphological traits of the seeds in all four environments were investigated using a Wanshen SC-G automatic seed analysis instrument. The maximum tensile resistance and other processing quality traits of the seeds in the Shifang and Shuangliu environments in 2021 were detected using a Perten DA7250 near-infrared analyzer. A new genetic map was constructed (e.g., Figure 1 As shown in the figure, the roundness and diameter ratio of the grains are repositioned.

[0031] The relocation results are shown in Table 1. Through relocation, KASP4BKM61 was detected as a candidate interval side marker, and the physical location of the candidate segment was successfully narrowed down to within 0.08 MB (e.g., ...). Figure 2 As shown in the figure, this indicates that the marker is closely linked to the target segment and can be used as a filtering marker for the target segment.

[0032] Table 1. Relocation results of grain morphology traits after adding KASP markers

[0033] QTL Side marker 1 Side marker 2 LOD value PVE value (%) Additive effect value QKrd.cib-4B.1 KASP4BKM61 AX-111640796 4.48 12.88 -0.01 QLwr.cib-4B.1 KASP4BKM61 AX-111640796 4.76 13.80 0.04

[0034] The phenotypic analysis results are shown in Tables 2 and 3.

[0035] Table 2. Genetic analysis and corresponding phenotypes of ZK-RILs population

[0036]

[0037]

[0038] Table 3. Population genotyping and corresponding phenotypic statistics

[0039]

[0040] The grain roundness, grain size ratio, and maximum tensile resistance in Table 4 are all average values. The primer set successfully genotyped the population families, identifying 65 genotypes in group A and 60 genotypes in group B. Based on the genotyping results, statistical analysis of the differences in phenotypes between the two groups revealed that grain roundness and grain size ratio could be significantly separated between different genotypes (P < 0.001), indicating that this marker is an effective marker for detecting grain morphological traits. Simultaneously, different genotypes significantly separated the phenotype of maximum tensile resistance, a parameter affecting wheat processing quality (P < 0.001). Genotype A showed an increase of 33.87 EU in maximum tensile resistance, indicating that this marker can not only detect grain morphological markers but also be used for screening and classifying grain quality processing parameters.

[0041] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Any modifications, alterations, substitutions, or variations made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention shall fall within the protection scope defined by the claims of the present invention.

Claims

1. A set of primer pairs for use in breeding for grain roundness or grain size ratio in wheat, characterised in that: The primer pair is used to detect the KASP marker located at 12610251 bp on wheat chromosome 4B, where the base at 12610251 bp is A or G. The primer pair includes: a first forward primer: first probe -TCTGCTTAACAACACTAGCCTAAT-A; a second forward primer: second probe -TCTGCTTAACAACACTAGCCTAAT-G; and a reverse primer: ACAAAAAGACTATTCATACGCCCA. The first and second probes are different probes.

2. Use according to claim 1, characterized in that: The first and second probes are each bound to different fluorescent groups.

3. Use according to claim 1, characterized in that: The primer pair includes: a first forward primer GAAGGTGACCAAGTTCATGCTTCTGCTTAACAACACTAGCCTAATA; a second forward primer GAAGGTCGGAGTCAACGGATTTCTGCTTAACAACACTAGCCTAATG; and a reverse primer ACAAAAAAGACTATTCATACGCCCA.