Fusarium tricinctum and use thereof

Abstract

The application discloses a kind of Fusarium tricinctum and application, belong to the field of agricultural microorganism, the preservation number of this Fusarium tricinctum is CGMCC No.40248.The application obtains a strain of biocontrol weed strain from the collection and purification of the diseased weed disease sample in different areas of Qinghai province, carries out weed pathogenicity determination, crop safety determination, strain classification and identification, and optimal carbon and nitrogen source screening.The results show that: the application obtains a strain with weed inhibition activity-Fusarium tricinctum, which provides basis and basis for the utilization of weed pathogenic fungal resources and the research of microbial herbicide, and provides a safe, efficient and pollution-free microbial herbicide for weed control in farmland of Qinghai province.

Description

Technical Field

[0001] This invention relates to the field of agricultural microbiology, and in particular to a Fusarium trifidum and its applications. Background Technology

[0002] Weeds compete with cash crops for space, nutrients, and solar energy, thereby reducing crop yields and interfering with harvesting operations in farmland and plantations. One of the biggest challenges facing sustainable agriculture is weed control, as weeds impact ecosystems, leading to reduced food yields and quality. The continued use of chemical pesticides not only leads to weed resistance but also to the accumulation and amplification of chemicals, posing threats to human health and the environment. Using biocontrol fungi to control weeds offers advantages such as high selectivity, minimal environmental negative effects, low toxicity, low residue, and high crop safety, aligning with the requirements of sustainable agricultural development.

[0003] Fusarium species live in soil and plant tissues, typically as saprophytes and endophytes, but can also act as pathogens of plants, animals (including humans), and even other fungi. Currently, over 500 species of Fusarium have been reported, such as *Fusarium oxysporum* causing alfalfa root rot, *Fusarium moniliforme* causing corn ear rot, and *Fusarium graminearum* causing wheat red rot. Fusarium species exhibit diverse lifestyles, and different species play important roles in weed biocontrol. Wang Zhiyue et al. from the Hami Plant Inspection Station in Xinjiang isolated *Fusarium orobanches* from naturally infected and dead *Broomrape cylindrica* plants and formulated it into a fungal agent, "F798," which was used to control *Broomrape cylindrica* using a stem-cutting application method, achieving a biocontrol effect of over 95%. Research by Marley et al. indicates that *Fusarium oxysporum* can effectively reduce the amount of *Striga asiatica* in the field and increase crop yield, making it a fungus with weed-control potential. Barton et al., through pathogenicity testing on 20 plants, found that *Fusarium tumidum* causes tissue necrosis in plants such as *Broomnia marina*, demonstrating weed-control potential. Dor et al. discovered that the toxic metabolite fusaric acid of *Fusarium verticillioides* can control *Broomnia marina* and is highly pathogenic to it. Studies by Fu Jie et al. show that the toxin of *Fusarium graminearum* significantly inhibits the growth of young roots and shoots of *Amaranthus retroflexus* and ryegrass seeds.

[0004] Safety and pollution-free practices are prerequisites for sustainable agriculture, which compels us to achieve significant breakthroughs in the research of biopesticides and microbial herbicides, opening up a new era. Given the varying climatic conditions in different regions, the types and growth characteristics of weeds affecting agricultural production differ. Therefore, it is necessary to develop a wider variety of bio-based herbicides to enrich the types of bio-herbicides and meet the needs of different regions. Summary of the Invention

[0005] The purpose of this invention is to provide a Fusarium trifidum strain and its application to solve the problems existing in the prior art. Based on morphological and molecular biological identification methods, a Fusarium trifidum strain with weed-suppressing activity was identified, providing a basis and evidence for the utilization of weed pathogenic fungal resources and the research of microbial herbicides.

[0006] To achieve the above objectives, the present invention provides the following solution:

[0007] This invention provides a Fusarium tricinctum, whose accession number is CGMCC No. 40248, the accession date is July 18, 2022, the depositary institution is the China General Microbiological Culture Collection Center, and the depositary address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing.

[0008] The present invention also provides a product comprising the aforementioned Fusarium trifidum, spores of the aforementioned Fusarium trifidum, or secondary metabolites of the aforementioned Fusarium trifidum.

[0009] Preferably, the product includes a herbicide.

[0010] The present invention also provides a method for culturing the aforementioned Fusarium trifidum, wherein the Fusarium trifidum is cultured using a modified PDA medium at a constant temperature of 22-26℃ for 3-7 days to obtain the culture.

[0011] Preferably, the improved culture medium comprises 200 parts potato, 20 parts wheat bran, 20 parts NaNO3, 18 parts agar, and 1000 parts water.

[0012] The present invention also provides the application of the aforementioned Fusarium trifidum in the preparation of herbicides for gramineous crops, wherein the herbicide uses Fusarium trifidum, Fusarium trifidum spores, or Fusarium trifidum secondary metabolites as active ingredients.

[0013] This invention provides the application of the aforementioned Fusarium trifidum in the removal of field weeds from crops of this family, including mallow, lambsquarters, sorrel, and elm.

[0014] Preferably, the gramineous crops include broad beans, peas, rapeseed, wheat, or barley.

[0015] The present invention discloses the following technical effects:

[0016] This invention involves collecting diseased weed samples from different regions of Qinghai Province, isolating and purifying them to obtain a biocontrol herbicide strain. Experimental verification revealed that: In vitro leaf inoculation showed that strain DT-16 was pathogenic to four common farmland weeds, with all reaching a disease severity level of 6; in pot experiments, the pathogenicity, from strongest to weakest, was: lambsquarters > Elsholtzia ciliata > Malva verticillata > Rumex japonicus; safety results showed that the strain had no effect on the growth of wheat (Triticum aestivum L.) and barley (Hordeum vulgare L.), indicating safety. Therefore, this invention applies Fusarium trifidum to weed biological control, providing a theoretical basis for the development and utilization of biocontrol bacteria for farmland weeds in Qinghai Province. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1 The colony morphology of strain DT-16;

[0019] Figure 2 A phylogenetic tree constructed based on rDNA-ITS gene sequences;

[0020] Figure 3 Colony morphology of strain DT-16 on different carbon source media;

[0021] Figure 4 Colony morphology of strain DT-16 on different nitrogen source media;

[0022] Figure 5 The pathogenicity of DT-16 under in vitro inoculation is determined by: A. Chenopodium album; B. Malva verticillata; C. Elsholtzia ciliata; D. Rumex japonica;

[0023] Figure 6 The effect of DT-16 strain fermentation broth on live *Chenopodium album* (inoculated for 5 days); A. *Chenopodium album*; B. *Elsholtzia ciliata*; C. *Polygonum cuspidatum*; D. *Malva verticillata*;

[0024] Figure 7 The results of the safety determination of the fermentation broth of strain DT-16 on crops are as follows: A. broad bean; B. pea; C. rapeseed; D. wheat; E. highland barley. Detailed Implementation

[0025] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0026] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Every smaller range between any stated value or intermediate value within a stated range, and any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0027] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0028] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be obvious to those skilled in the art. This application specification and embodiments are merely exemplary.

[0029] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0030] Example 1: Isolation and purification of biocontrol strains

[0031] (1) Separation and purification

[0032] Diseased weed samples collected from different regions of Qinghai Province were brought back to the laboratory. The boundary between diseased and healthy tissue was cut into 0.5-1.0 cm sections using a sterile knife. 2 The pieces are sized and then immersed in 70% alcohol for 10 seconds, 0.1% sodium hypochlorite for 2-5 minutes, rinsed three times with sterile water, air-dried, and cut into 25mm lengths. 2 Small fragments of varying sizes were placed into Petri dishes containing PDA medium, 5-8 fragments per dish. The dishes were sealed with sealing film and incubated at 25°C inverted. After 5 days, uniformly grown and colored colonies were selected and transferred to new dishes, 2-4 fragments per dish, and incubated inverted at 25°C. The purified strain (named DT-16) was stored at 4°C.

[0033] (2) Morphological identification

[0034] DT-16 mycelial discs with a diameter of 8 mm were inoculated onto PDA medium plates (9 cm) and incubated at 25°C. The colony growth rate, morphology, and color changes were observed periodically. Preliminary identification was performed using the *Handbook of Fungal Identification*.

[0035] The results are as follows Figure 1 As shown, DT-16 colonies are loose and easy to pick up on PDA plates. The colonies are round, white in color, and grow rapidly. The newly formed hyphae are transparent, and the color gradually darkens until they cover the entire plate.

[0036] (3) Molecular biological identification

[0037] Genomic pathogen DNA was extracted using the CTAB method. After determining the DNA concentration and quality, it was stored at -20°C for later use. Amplification was performed using primers ITS1 (TCCGTAGGTGAACCTGCGG) / ITS4 (TCCTCCGCTTATTGATATGC). The PCR amplification volume was 25 μL for each sample. The reaction conditions for ITS target fragment amplification were: 94°C pre-denaturation for 90 s; 94°C denaturation for 20 s, 59°C annealing for 20 s, 72°C extension for 50 s, for a total of 30 cycles; final extension at 72°C for 5 min. Annealing was performed at 56°C for 45 s for the GAPDH gene, 55°C for 20 s for the TUB2 gene, 59°C for 20 s for the CHS-1 gene, 55°C for 30 s for the ACT gene, and 59°C for 20 s for the CAL gene. After detection by 1% agarose gel electrophoresis, the target fragment was sent to Shanghai Sangon Biotech Co., Ltd. for bidirectional sequencing. The obtained target fragment sequences were proofread and subjected to BLAST homology analysis in the NCBI (National Center for Biotechnology Information) database. A multi-site phylogenetic tree was constructed using MEGA 7.0 software with maximum likelihood estimation.

[0038] The sequence results of the bacterial strain were analyzed and processed by Shanghai Sangon Biotech Co., Ltd., revealing a 540bp fragment length in the ITS region of strain DT-16. The sequence was registered with NCBI and BLAST-aligned with known sequences in GenBenk. The strains with the highest similarity to this strain were MK842094 *Fusarium tricinctum* and OK617305 *Fusarium tricinctum*. Based on... Figure 2The phylogenetic tree shown indicates that strain DT-16 clusters in the same branch as Fusarium tricinctum and OK617305 Fusarium tricinctum, and receives 95% support. Based on the morphological characteristics of DT-16, strain DT-16 can be identified as Fusarium tricinctum.

[0039] The ITS segment sequence is as follows:

[0040] .

[0041] The Fusarium tricinctum was deposited on July 18, 2022, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 40248. The deposit address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0042] Example 2: Determination of the optimal carbon and nitrogen source for strain DT-16

[0043] Soluble starch (C1), wheat bran (C2), sucrose (C3), corn flour (C4), and wheat flour (C5) were used as carbon sources, added to PDA medium at 2% of the medium volume to replace glucose (C6) in the basal medium. Soybean flour (N1), yeast extract (N2), peptone (N3), NaNO3 (N4), (NH4)2SO4 (N5), and urea (N6) were used as external nitrogen sources, also added to PDA medium at 2% of the medium volume. The control group consisted of PDA medium without nitrogen sources (N7). Mycelial cakes (Φ=8mm) were punched using a sterile punch and inoculated into the center of the medium (Φ=9cm). The median culture was placed in a 25℃ incubator, and colony diameters were measured at 3, 5, and 7 days. After 7 days, 10 mL of sterile water was added to the culture medium, the hyphae were gently scraped off with a glass slide, filtered through 4 layers of sterile gauze to obtain a spore suspension, the OD value at a wavelength of 600 nm was measured, and the spore production was counted. Each treatment was repeated in two replicates.

[0044] From Table 1 and Figure 3 It can be seen that strain DT-16 has the largest growth diameter and the fastest growth rate on C2 medium, with an OD of [missing value]. 600nm The values ​​also showed significant differences compared to other carbon source media. On C3 medium, the colony diameter was slightly smaller, and the growth rate was significantly slower than on C2. On C1 and C4, the growth rate was not significantly different, but the colony diameter was significantly smaller. On C5 and C6, the colony growth rate was the slowest, and the colony diameter was also the smallest. Therefore, the optimal carbon source for strain DT-16 is C2: wheat bran.

[0045] Table 1. Colony diameter and OD value of DT-16 on different carbon source media

[0046]

[0047] From Table 2 and Figure 4 It can be seen that strain DT-16 exhibits the best growth performance on N4 medium, with the largest colony diameter and fastest growth rate. The OD value of N4 medium... 600nm The OD values ​​of N4 and other nitrogen source media showed significant differences, with N4 exhibiting a significantly higher OD value than the others. Compared to the control group PDA medium, only N4 medium showed superior growth, indicating a promotion of colony growth. Furthermore, only N4 medium showed higher sporulation than PDA medium in terms of OD value. The colony diameters on N1, N2, N3, N5, and N6 media were significantly smaller than those on PDA medium, thus these media inhibited colony growth. N6 medium showed no colony growth at all, indicating that it had the strongest inhibitory effect on DT-16, almost completely suppressing its growth and sporulation. Therefore, the optimal nitrogen source for DT-16 is N4:NaNO3.

[0048] Table 2. Colony diameter and OD value of DT-16 on different nitrogen source media

[0049]

[0050]

[0051] Example 3: In vitro pathogenicity determination of strain DT-16

[0052] The main weeds in farmland of Qinghai Province, including winter mallow (Semen Abutili), quinoa (Chenopodium album), sorrel-leaved knotweed (Polygonum lapathifolium L.), and dense-flowered elm (Elsholtzia densa Benth), were used as test weeds.

[0053] Leaves of weeds without disease spots or mechanical damage were picked, washed, and dried on filter paper. Three to four leaves were placed in each petri dish lined with moistened filter paper. Candidate strains were perforated using a sterile punch (Φ=8mm), and mycelial cakes were transferred onto the leaves. Three replicates were performed for each weed species, with a control without mycelial cakes. Sterile water was added to maintain humidity, and the disease incidence on the leaves was observed. The leaves were graded according to the percentage of diseased area relative to the total leaf area, using Liu Xuemin's "Grading Standard for the Severity of Leaf Lesions in Soybean Gray Spot Disease," which specifies the following grading standards: Grade 1 = 0; Grade 2 = 0–3.0%; Grade 3 = 3.0–6.0%; Grade 4 = 6.0–12.0%; Grade 5 = 12.0–25.0%; Grade 6 > 25.0%.

[0054] The pathogenicity test results of the fungal cake showed that strain DT-16 had strong infectivity on the leaves of lambsquarters, mallow, Elsholtzia ciliata, and Polygonum sambac. Figure 5 As shown, 5 days after inoculation, obvious white mycelium was visible at the inoculation site of the weed leaves, and the mycelium penetrated the entire leaf. The center of the inoculation site was black, and brown lesions appeared at the edge. The lesion area of ​​the four weeds accounted for more than 90% of the leaf area, and the disease level reached the highest level 6.

[0055] Example 4: Pathogenicity determination of strain DT-16 in potted weeds

[0056] After inoculating 50 mL of PDB medium with one Φ=8 mm mycelial cake, the mixture was placed on a shaker and cultured for 7 days (speed 160 r / s). The culture was then filtered through sterile gauze and stored for later use. Next, normally growing weeds such as lambsquarters and winter mallow at the 4-5 leaf stage from the experimental field of the Qinghai Academy of Agricultural Sciences were transplanted into flowerpots and cultured in a greenhouse for one week. The fermentation broth was filtered through four layers of gauze, and Tween was added. The mixture was then sprayed onto the weed plants until dripping liquid appeared on the stems and leaves. This was done once daily for three consecutive days. The experiment was conducted in triplicate. After inoculation, the disease incidence of the weeds was observed, and the severity of the disease was investigated. The severity of the disease was graded according to the published literature by Zhu Yunzhi et al., "Influencing Factors of Fungal Strain QZ-2000 on the Pathogenicity of Digitaria sanguinalis". The specific grading criteria are as follows:

[0057] Grade 0: No lesions on the leaves; Grade 1: Scattered lesions on the leaves; Grade 2: 1 / 3 to 2 / 3 of the leaves are rotten; Grade 3: More than 2 / 3 of the leaves are rotten; Grade 4: All the leaves are rotten.

[0058] The results are as follows Figure 6 As shown, 3 days after spraying the bacterial solution, infection symptoms appeared on the weeds *Chenopodium album*, *Elsholtzia ciliata*, and *Malva verticillata*, with leaves exhibiting wilting and curling. After 5 days, more than two-thirds of the leaves of *Chenopodium album*, *Elsholtzia ciliata*, and *Malva verticillata* died, reaching a disease severity level of 3. *Polygonum saffron* also showed symptoms of damage, manifesting as leaf curling. After 7 days, the disease severity of *Chenopodium album*, *Elsholtzia ciliata*, and *Malva verticillata* reached level 4, while *Polygonum saffron* was at level 2. The pathogenicity of strain DT-16 to the four weeds, from strongest to weakest, was: *Chenopodium album* > *Elsholtzia ciliata* > *Malva verticillata* > *Polygonum saffron*.

[0059] Example 5: Crop safety determination of strain DT-16

[0060] Seeds of the main crops grown in Qinghai Province—wheat, peas, highland barley, broad beans, and rapeseed—were planted in flowerpots and cultured indoors. After culturing strain DT-16 as described above, it was sprayed onto healthy crop plants. Sterile water was used as a blank control. Each treatment was replicated in triplicate. Inoculated crop plants were placed in a greenhouse and cultured under humidity. Disease incidence was observed in the tested crops. Note: NS indicates no symptoms (no lesions, normal plant growth); LS indicates mild reaction (sparse lesions on leaves, slightly inhibited plant growth); MS indicates moderate susceptibility (lesions appear on 1 / 5 to 1 / 4 of the leaf area, inhibited plant growth); SS indicates severe susceptibility (lesions appear on more than 1 / 4 of the leaf area, severely inhibited growth).

[0061] like Figure 7As shown in Table 3, the fermentation broth of strain DT-16 was not pathogenic to wheat or barley and was relatively safe. Compared with the blank control plants, the growth and plant height of the crops were not affected in any way, showing no reaction (NS). It had a slight effect on peas, broad beans and rapeseed, with slight yellowing at the tips of the inoculated leaves. However, the disease did not spread in the later stage and was relatively safe, showing a mild reaction (LS).

[0062] Table 3. Sensitivity of tested crops to fermentation broth of strains

[0063]

[0064] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A trilinear fusarium (Fusarium trilobitum) characterized in that, Fusarium tricinctum The preservation number of the Fusarium tricinctum is CGMCC No.40248. ​ 2. A product characterized by, The product comprises the Fusarium tricinctum or spores of the Fusarium tricinctum according to claim 1.

3. The product of claim 2, wherein, The product is a herbicide.

4. A method of culturing the tripartite falcate fusarium of claim 1, wherein, The Fusarium tricinctum is cultured by using a modified PDA medium, and the culture temperature is 22-26℃, and the culture time is 3-7 days.

5. The method of claim 4, wherein, The modified medium comprises potato 200 parts, wheat bran 20 parts, NaNO3 20 parts, agar 18 parts and water 1000 parts.

6. Use of the tripartite Fusarium oxysporum of claim 1 for the preparation of a microbial herbicide for grassy crop fields, characterized in that, The herbicide uses the Fusarium tricinctum or spores of the Fusarium tricinctum as an active ingredient, and the herbicide is applied to remove winter purslane, goosegrass, knotweed and denseflower elsholtzia.

7. The use of a triallate in non-crop field weeds as claimed in claim 1, wherein, The weeds are winter purslane, goosegrass, knotweed and denseflower elsholtzia.

8. Use according to claim 6 or 7, wherein the compound is ###0002### The Gramineae crops are broad bean, pea, rape, wheat or highland barley.

Images