Insect-resistant fusion gene M1CryAb-VIP3A, expression vector, product and application thereof

Abstract

The application discloses an anti-insect fusion gene M1 CryAb- VIP3A , an expression vector thereof, a product and application thereof, and aims to solve the technical problem that the existing Bt fusion gene is difficult to consider biological safety and insecticidal effect. M1 CryAb-VIP3A The nucleic acid sequence of the anti-insect fusion gene is shown as SEQ ID NO. 5, and the protein sequence corresponding to the nucleic acid sequence is shown as SEQ ID NO. 6. The fusion gene does not contain a sensitizer sequence and can be efficiently expressed, and the biological safety and insecticidal effect are considered, the anti-insect and insecticidal effect of the expression product is good and wide-spectrum. M1 CryAb-VIP3A M1 CryAb-VIP3A After the gene is introduced into corn, a new crop variety which is resistant to stink bugs and other lepidopteran pests or coleopteran pests (spodoptera frugiperda) is obtained; the anti-insect fusion gene expression protein M1CryAb-VIP3A has excellent insecticidal effect, can be applied to the preparation of an anti-insect preparation, is green and environment-friendly, and has no pollution.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, specifically to an insect-resistant fusion gene. M1CryAb-VIP3A Its expression carriers, products and their applications. Background Technology

[0002] According to relevant statistics, over one million species of pests have been identified that harm crops, causing enormous economic losses to agricultural production every year. Currently, pest control relies heavily on chemical pesticides, but the long-term, large-scale use of chemical pesticides severely damages the ecological environment. With the rapid development of genetic engineering technology, people have begun to use insect-resistant genes to transform plants, cultivating new transgenic plant varieties with resistance.

[0003] Existing clones of insect-resistant genes mainly include: Bacillus thuringiensis (Bt) Bacillus thuringiensis Bt (Bacillus thuringiensis) genes include insect-resistant genes, protease inhibitor genes, lectin genes, chitinase genes, scorpion toxin genes, pea lipoxygenase genes, insect female sterility protein factor genes, insect juvenile hormone lipase genes, and insect neurohormone genes. Among these, the application research of Bt insect-resistant genes is relatively extensive and in-depth. Currently, more than 90 gene-encoded insecticidal crystalline proteins have been discovered and isolated from a large number of Bt strains. Insect pathogens' Bt genes produce proteins such as Cry, Cyt, and Vips. Most Bacillus thuringiensis strains can produce several insecticidal crystalline proteins, but the host range of each insecticidal crystalline protein is very narrow.

[0004] However, the potential problems of insect-resistant plants derived from insect-resistant genes are becoming increasingly apparent, affecting their sustainable use. For example, transgenic plants obtained by directly applying the original insect-resistant gene to transgenic plants exhibit very low insect resistance and poor insect-resistant effects. The expression level of the toxic protein is low and the expression product is unstable, failing to meet the needs of pest control in agricultural production, and thus are mostly difficult to promote and apply. Moreover, with the widespread application of insect-resistant genes, insects may develop resistance to insecticidal proteins; the insect resistance spectrum of insect-resistant genes is relatively narrow; and the expression of exogenous genes in plants may exhibit gene "silencing," etc. Therefore, finding new insect-resistant genes or making full use of existing insect-resistant gene resources to address the trend of insect resistance to pesticides has become an essential approach.

[0005] By fusing or aggregating different Bt genes, not only can the insecticidal effect of crops be enhanced, but the insecticidal spectrum can also be broadened, resulting in new crop varieties that are resistant not only to stem borers but also to other lepidopteran or coleopteran pests (such as armyworms and cutworms). Gene aggregation refers to the introduction of two different insect-resistant genes into the same crop variety, using two Bt genes in common. This requires that the pests exhibit significant differences in the mechanisms of action of these two Bt insecticidal proteins, i.e., there is no cross-resistance.

[0006] For example, Chinese patent document CN111041036A discloses an insect-resistant fusion gene encoding an insecticidal protein. mCryAb-VIP3A This fusion gene enhances the insect resistance and insecticidal effects of the transformed crops to some extent. However, further research by the inventors revealed that, according to the Ministry of Agriculture's Announcement No. 1485-18-2010, "Food Safety Testing of Genetically Modified Organisms and Their Products—Bioinformatics Analysis Method for Exogenous Protein Allergenicity," the protein's amino acid sequence was compared with known allergen sequences in the Allergen Online Database using bioinformatics. Two sequences of 80 amino acids showed homology greater than 35% with known allergen sequences, at 42.9% and 41.01% respectively, indicating high sequence homology and a high potential for allergenicity. Furthermore, the protein shared at least eight consecutive identical amino acids at two locations with known allergen sequences, further suggesting the potential for allergenicity. Therefore, it is difficult to use this fusion protein for the industrial production of insect-resistant transgenic corn. Summary of the Invention

[0007] The purpose of this invention is to provide an insect-resistant fusion gene. M1CryAb-VIP3A The study aims to explore the expression vectors, products, and applications of Bt fusion genes to address the technical challenge of balancing biosafety and insecticidal efficacy.

[0008] To solve the above-mentioned technical problems, the present invention adopts the following technical solution:

[0009] Design an insect-resistant fusion gene M1CryAb-VIP3A Its nucleotide sequence is:

[0010] (1) A nucleic acid sequence as shown in SEQ ID NO.5; or

[0011] (2) A nucleic acid sequence with equivalent function derived from the nucleic acid sequence shown in SEQ ID NO.5.

[0012] The protein M1CryAb-VIP3A encoded by the insect-resistant fusion gene has the following amino acid sequence:

[0013] (1) The amino acid sequence as shown in SEQ ID NO.6; or

[0014] (2) The sequence of an active fragment or a conserved variant obtained by adding, deleting or replacing one or more amino acids based on the amino acid sequence shown in SEQ ID NO.6.

[0015] A fusion gene containing the insect-resistant gene was constructed. M1CryAb-VIP3A The carrier of expression.

[0016] A recombinant bacterium was constructed based on the expression vector.

[0017] The insect-resistant fusion gene M1CryAb-VIP3A Application in the breeding of insect-resistant plant varieties (such as monocotyledonous plants like corn).

[0018] Application of the protein M1CryAb-VIP3A encoded by the insect-resistant fusion gene in the preparation of insect-resistant biological agents.

[0019] Compared with the prior art, the main beneficial technical effects of the present invention are as follows:

[0020] 1. This invention further fuses and links the modified insect-resistant gene to obtain a novel insect-resistant fusion gene. M1CryAb-VIP3A This fusion gene can be expressed efficiently and does not contain allergen sequences, thus balancing biosafety and insecticidal effects. The insecticidal and anti-insect effects of its expression product are greatly enhanced, and the insecticidal spectrum is expanded (highly resistant to Asian corn borer and fall armyworm).

[0021] 2. The insect-resistant fusion gene of this invention M1CryAb-VIP3A After being introduced into corn, a stable genetically derived transformant can be obtained, resulting in new crop varieties that are resistant not only to corn borers but also to other lepidopteran or coleopteran pests (fall armyworm). In addition, this insect-resistant fusion gene can also be used to transform cotton, rice, vegetables, and other crops, giving them corresponding insect-resistant activities, thereby reducing the amount of pesticides used and reducing environmental pollution. It has significant economic value and broad application prospects.

[0022] 3. The protein M1CryAb-VIP3A encoded by the insecticidal fusion gene of this invention has excellent insecticidal effect and can be used in the preparation of insecticidal agents. It is green, environmentally friendly and pollution-free. Attached Figure Description

[0023] Figure 1 This is a schematic diagram of the pCAMBIA3300+35S-M1CryAb-VIP3A carrier architecture.

[0024] Figure 2 For the transfer M1CryAb-VIP3A Genetically modified maize plants were obtained. The left image shows embryo infection, the middle image shows callus screening, and the right image shows regeneration.

[0025] Figure 3 Target gene for T0 generation transformants M1CryAb-VIP3A PCR detection; where M: DL2000 plus; 1: positive control [pCAMBIA3300-M1CryAb-VIP3A]; 2: negative control (non-transgenic maize); 3: blank control (double-distilled water); 4-23: 20 superior transgenic lines LM01-20.

[0026] Figure 4 PCR detection diagram of the marker gene Bar for selecting T0 generation transformants; where M: DL2000 plus; 1: positive control (plasmid pCAMBIA3300-M1CryAb-VIP3A); 2: negative control (non-transgenic maize); 3: blank control (double-distilled water); 4-23: 20 superior transgenic lines LM01-20.

[0027] Figure 5 For T0 conversion M1CryAb-VIP3A Immunological detection of Vip3A, the target protein in the partial gene transformant.

[0028] Figure 6 Immunological detection of the target protein CryAb in the partial transformants of the T0 generation M1CryAb-VIP3A gene.

[0029] Figure 7 For T0 conversion M1CryAb-VIP3A Immunological detection of the target protein screening marker protein bar in partial gene transformants.

[0030] Figure 8 For the transfer M1CryAb-VIP3A Comparison of indoor bioassays of insect-resistant gene-bearing maize seedlings against Asian corn borer resistance.

[0031] Figure 9 For the transfer M1CryAb-VIP3A Comparative indoor bioassay of fall armyworm resistance in maize seedling leaves with insect-resistant genes. Detailed Implementation

[0032] The specific embodiments of the present invention will be described below with reference to the accompanying drawings and examples. However, the following examples are only used to illustrate the present invention in detail and do not limit the scope of the present invention in any way.

[0033] Unless otherwise specified, the instruments and equipment involved in the following embodiments are all conventional instruments and equipment; unless otherwise specified, the reagents or products involved are all commercially available conventional reagents or products; unless otherwise specified, the test methods involved are all conventional methods.

[0034] Example 1: Insect-resistant fusion gene M1CryAb-VIP3A Acquisition

[0035] First Cry1Ab Based on the original 3468 bp DNA sequence of the Cry1Ab gene (GenBank: AY847289.1), the functional domains and core regions (protein active regions) of the original Cry1Ab gene sequence were analyzed and studied, preserving... Cry1AbThe original sequence contained the N-terminal 1845bp functional domain and core region, and the C-terminal 1620bp base sequence was removed; based on long-term practical experience, the retained... Cry1Ab The core region nucleotide sequence underwent targeted modification in various aspects, including structural optimization and codon optimization. For example, multiple AT-rich regions such as AATGAA and ATTTA in the original insect-resistant gene DNA sequence and inverted repeat sequences present in the gene sequence were eliminated. Sequences of introns in unclear eukaryotic DNA sequences and sequences that may cause premature termination of transcription or instability of mRNA were reduced. Some commonly used restriction endonuclease recognition sites were also removed. XbaI, SacI The stop codon at the 3' end was modified to GCC, ultimately resulting in a targeted insect-resistant gene. mCry1Ab (As shown in SEQ ID NO.1), etc. After multiple modifications and optimizations, the A content of the retained N-terminal 1845bp core region decreased from 31.92% to 19.62%, the T content decreased from 30.73% to 16.64%, the G content increased from 19.67% to 28.51%, and the C content increased from 17.67% to 35.23%.

[0036] Again vip-s Based on the original DNA sequence of the gene (2630 bp in length, GenBank: Y17158.1), analysis and research were conducted. vip-s The original gene sequence functional domains and core regions (protein active regions) are preserved. vip-s The original gene sequence contained 2367 bp functional domains and core regions; the N-terminal 258 bp sequence was removed. Multiple techniques were used to preserve the remaining sequences. vip-s The nucleotide sequence of the core gene region underwent targeted modification in multiple aspects, including structural optimization and codon optimization. For example, the three amino acids M (methionine), N (aspartic acid), and K (lysine) at the N-terminus of the core segment were retained and optimized to G (glycine), K (lysine), and G (glycine), respectively. AT-rich sequences (such as ATTTA and AATGA) and commonly used restriction enzyme sites that cause transcriptional instability in plants were eliminated from the DNA sequence. HindIII, SacI Then, the codons were replaced to correct and eliminate the defects; ultimately, a codon-optimized insect-resistant gene was obtained. mVIP3A(a) (As shown in SEQ ID NO.2). After modification and optimization, the 2367 core segment retained has a different starting amino acid composition, with the A+T content decreasing from 69.13% to 51.06% and the C+G content increasing from 30.87% to 48.94%.

[0037] Then optimize mCry1AbThe gene is linked to a designed and modified [structure] via a 23-amino acid linker peptide (as shown in SEQ ID NO.3). VIP3A Genes connect to form fusion genes. mCry1Ab After the gene stop codon is optimized to GCC, its reading frame can be continuously expressed up to the optimized gene. VIP3A By adding a stop codon TAA to the 3' end of the designed and modified fusion gene, and then synthesizing the whole gene, a new insect-resistant fusion gene was obtained, named M1CryAb-VIP3A The nucleotide sequence of the linker sequence L is shown in SEQ ID NO.4; the nucleotide sequence of the insect-resistant fusion gene is shown in SEQ ID NO.5, and the amino acid sequence it encodes is shown in SEQ ID NO.6.

[0038] Example 2: Insect-resistant fusion gene M1CryAb-VIP3A Construction of prokaryotic expression vectors

[0039] For testing M1CryAb-VIP3A In vitro gene protein expression and insecticidal activity against pests such as corn borer and fall armyworm were investigated. M1CryAb-VIP3A Prokaryotic expression vector for fusion genes.

[0040] Based on cloning fusion genes M1CryAb-VIP3A Yes, add a primer to the 5' end of the primer sequence. Nde The CATATG endonuclease recognition site sequence is added at the 3' end. Hind III endonuclease recognition site sequence AAGCTT.

[0041] Insect-resistant fusion gene M1CryAb-VIP3A Synthesized by Sangon Biotech (Shanghai) Co., Ltd., it contains insect-resistant genes. mCryAb and mVIP3A and M1CryAb-VIP3A Cloned into expression vector pET28b+ restriction endonuclease NdeI and HindIII In the process, pET-mCryAb, pET-mVIP3A, and pET-M1CryAb-VIP3A prokaryotic expression vectors were obtained and identified by enzyme digestion and sequencing.

[0042] Example 3: Preparation of insecticidal protein M1CryAb-VIP3A

[0043] The vector pET- containing the insect-resistant gene M1CryAb-VIP3AThe corresponding controls pET-mCryAb, pET-mVIP3A, and pET28b+ empty vectors were introduced into the BL21(DE3) cell line (Escherichia coli). The cells were cultured overnight at 37°C on LB solid medium containing kanamycin (50 mg / L). Positive single clones were screened and transferred to 100 ml (using a 250 ml Erlenmeyer flask) of LB resistant medium, cultured overnight at 37°C until just saturated, and then transferred at a 2% inoculum. The cells were cultured until OD... 600 The value was approximately 0.5–0.6. After IPTG induction, the culture medium was centrifuged, the supernatant was discarded, and the precipitate was collected. The precipitate was then subjected to ultrasonic disruption with 20 mM Tris-HCl, and the disrupted mixture was collected for insecticidal activity determination. Under the same conditions, cultures containing the insecticidal activity described in Example 1 were cultured. mCryAb Recombinant pET28b vector of gene sequence E. coli BL21(DE3) and those modified according to Example 1 VIP3A(a) Recombinant pET28b vector of gene sequence E. coli BL21(DE3) was subjected to ultrasonic disruption, and the disrupted mixture was collected as a control group; water was used as a blank group.

[0044] Example 4: Insecticidal activity assay of insecticidal protein expressed by prokaryotic expression vector

[0045] Equal amounts of the ultrasonically disrupted liquid obtained in Example 3 were added to the prepared corn borer feed as experimental feed, and corn borers were raised for insect experiments: one feed was placed in each test tube, and 10 newly hatched first-instar larvae (corn borer, fall armyworm, beet armyworm, and Bt-resistant bollworm) were introduced into each tube; 10 test tubes were connected for each treatment; and the tubes were placed in an environment with a temperature of 26-28℃ and a relative humidity of about 70% for 8 days. The average mortality rate and the weight of a single live insect were measured. The specific results are shown in Table 1.

[0046] Table 1. Artificially Modified Synthetic M1CryAb-VIP3A Toxicity identification of prokaryotic gene expression products

[0047] Process (three duplicates) Corn borer (%) Fall armyworm (%) Beet armyworm (%) Bt-resistant bollworm (%) Blank group 0 0 0 0 Modification Team 90.15 68.62 60.17 90.02 Modification Team 78.76 90.18 90.01 67.86 Group 95.12 92.56 91.83 90.06

[0048] As shown in Table 1, the protein expressed by the modified mCryAb prokaryotic expression vector has a good insecticidal effect on corn borer, with a mortality rate of 90.15%. It also has a certain insecticidal effect on fall armyworm and beet armyworm, with a mortality rate of 68.62% for fall armyworm and 60.17% for beet armyworm, but almost no insecticidal effect on cotton bollworm. The protein expressed by the modified VIP3A(a) prokaryotic expression vector has a good insecticidal effect on fall armyworm and beet armyworm, with mortality rates of 90.18% and 90.01%, respectively. It also has a certain insecticidal effect on corn borer and Bt-resistant cotton bollworm, with a mortality rate of 78.76% for corn borer and 67.86% for cotton bollworm. The insecticidal fusion protein mCryAb-L-VIP3A(a) is a fusion protein that effectively links two independent proteins, mCryAb and VIP3A(a), into a single protein using a linker peptide, so that the fusion protein has the functions of both proteins.

[0049] Insecticidal test results show that the M1CryAb-L-VIP3A(a) insecticidal fusion protein has strong insecticidal activity, with a kill rate of over 90% against corn borer, fall armyworm, beet armyworm and Bt resistant bollworm, demonstrating a very significant insecticidal effect.

[0050] The insecticidal activity assay of the insect-resistant protein expressed in the prokaryotic expression vector showed that: M1CryAb-VIP3A The gene-encoded Bt insecticidal protein has a strong insecticidal effect, indicating that... M1CryAb-VIP3A Genetic modification can express insecticidal proteins with strong biological activity and broad spectrum.

[0051] Example 4: M1CryAb-VIP3A Construction of plant gene expression vectors

[0052] M1CryAb-VIP3A The gene was synthesized by Sangon Biotech (Shanghai) Co., Ltd. and constructed into a T-vector endonuclease. Xba I and Sac The enzyme was named T-M1CryAb-VIP3A between the I restriction sites; using T-M1CryAb-VIP3A as a template, amplification primers containing the same restriction sites were cloned. M1CryAb-VIP3A Gene fragment; double digestion followed by ligation into a pre-treated gene fragment. Xba I and Sac Genetically transformed plants were expressed on the double-enzyme-digested pCAMBIA3300 gene vector and obtained... M1CryAb-VIP3A Plant gene expression vectors (containing a single independent T-DNA region, containing...) M1CryAb-VIP3A and bar Two expression cassettes for the gene. Target gene. M1CryAb-VIP3A and barThe gene is driven by the P35S promoter), and the recombinant plasmid is named pCAMBIA3300-M1CryAb-VIP3A. The plasmid map is shown below. Figure 1 As shown. The recombinant plasmid pCAMBIA3300-M1CryAb-VIP3A was transformed into Agrobacterium EHA105, and positive strains were screened to obtain... M1CryAb-VIP3A Recombinant gene expression bacteria, preserved at low temperature.

[0053] Example 5: Obtaining Transgenic Maize

[0054] The recombinant plasmid pCAMBIA3300+35- was prepared by freeze-thaw method. Cry1Ab-t Genetic transformation of maize immature embryos was performed using the Agrobacterium EHA105 strain, following the method of Liu Yunjun. Transformed embryogenic callus was transferred to selection medium (D medium) containing 1.5 mg / L diammonium phosphate for the first round of selection. Then, the selected resistant callus was transferred to selection medium containing 3.0 mg / L diammonium phosphate for two rounds of selection. Finally, the callus was transferred to differentiation medium for plant differentiation and regeneration. When the regenerated seedlings reached 4–5 cm in height, they were transplanted to a greenhouse and examined. Positive plants were retained. Figure 2 As shown. When it reaches the stage of silking and pollination, it should be pollinated.

[0055] Example 6: mCryAb-VIP3A Validation of gene expression in maize plants

[0056] 1. PCR detection

[0057] When the transgenic plants obtained in Example 5 reached the 5-6 leaf stage, genomic DNA was extracted from the leaves using the CTAB method, and primers as shown in Table 2 were designed for PCR amplification. M1CryAb-VIP3A Gene and glufosinate resistance gene on plasmid pCAMBIA3300 bar Gene.

[0058] Table 2 M1CryAb-VIP3A Genes and bar PCR detection primer sequence designed from internal gene sequences

[0059] Target gene Upstream primer sequence Downstream primer sequence Fragment size (bp) CACGCAGATCCCGCTCACGAAG TCGCTCAACATAGAGGTGATC 885 ATGAGCCCAGAACGACGCCCG TCGGTGACGGGCAGGACCGG 545

[0060] The PCR reaction system consisted of: 2 μL DNA template, 2 μL 10×PCR Buffer, 2 μL dNTPs (10 mM each), 1 μL upstream primer (10 mM), 1 μL downstream primer (10 mM), 0.3 μL Tap enzyme, and sterile water to make up to 20 μL.

[0061] The PCR reaction procedure is shown in Table 3.

[0062] Table 3 PCR reaction procedure

[0063] Temperature (°C) time stage Cycle number 94 5min Pre-variation 1 94 5min transsexual 33 58 30s annealing 33 72 50s extend 33 72 10min save 1

[0064] Test results as follows Figure 3 and Figure 4 As shown: Figure 3 The target gene of the T0 generation transformant was shown. M1CryAb-VIP3A PCR test results; Figure 4 The PCR results for the selection marker gene Bar in the T0 generation transformants are shown. This indicates that the exogenous gene... M1CryAb-VIP3A Genes and bar The gene has been integrated into the target maize genome.

[0065] 2. Test strip detection

[0066] Detection of the target protein M1CryAb-VIP3A (Bt-Cry1Ab / 1Ac immunological and VIP3A detection):

[0067] (1) Take about 1cm 2 Fresh, young leaves were placed in 1.5 ml Eppendorf tubes. The tubes containing the leaves of the transgenic plants cultured in Example 5 were then placed in an ice box to maintain freshness.

[0068] (2) Take liquid nitrogen, freeze the material quickly, grind the material into powder with a drill bit, and quickly add 500μL-1ml SEB4 sample extraction buffer into the tube.

[0069] (3) Remove the test strip (Beijing Handeweixin Technology Co., Ltd.) from the container, hold the top of the test strip, and mark it. Do not remove the protective film. Keep the test strip vertical and insert the marked end into the centrifuge tube or extraction bag. The insertion portion should not exceed 0.5 cm. Keep it inserted throughout the testing process.

[0070] (4) The control line appears within 3-5 minutes, with a maximum reaction time of 30 minutes. At this point, the test strip can be removed. The control line is used to ensure the accuracy of the test results. If the control line does not appear, the test is invalid. Due to differences in sample fluidity, the signal generation time also varies. If the sample is positive, the test line will appear. If the sample is negative, the test line will not appear. If you want to preserve the test results for a long time, you can cut off the sample pad and blot it dry with a paper towel. This will prevent residual liquid from interfering with the results. The depth of the test line reflects the content of the protein being tested.

[0071] The results are as follows Figures 5-7 As shown, insect-resistant genes M1CryAb-VIP3A The target proteins CryAb, VIP3A(a), and selection marker genes expressed were expressed. barEfficient expression in genetically modified maize.

[0072] Example 7: Identifying the insect resistance of transgenic maize plants

[0073] 1. Transfer M1CryAb-VIP3A Indoor bioassay for insect-resistant gene-based maize seedling leaves against Asian corn borer.

[0074] Take the greenhouse as a transfer point M1CryAb-VIP3A Leaves (unfurled young heart leaves) from genetically modified corn seedlings at the 5-8 leaf stage were cut into 2-3 cm pieces using sterilized scissors and placed in disposable petri dishes, with 10 newly hatched larvae in each dish. Leaves from ordinary corn plants served as the control group. M1CryAb-VIP3A The leaves of the genetically modified plants were used as the experimental group. After culturing for 3 days, the insect resistance effect of the transgenic corn was observed.

[0075] The results are as follows Figure 8 As shown, the leaves of non-GMO corn were completely eaten by the Asian corn borer, indicating hypersusceptibility, while those of GMO corn were completely devoured. mCryAb-VIP3A Genetically modified corn leaves are free from Asian corn borer pests, exhibiting strong resistance. M1CryAb-VIP3A Genetically modified insect-resistant corn exhibits high resistance to the Asian corn borer.

[0076] 2. Transfer M1CryAb-VIP3A Indoor bioassay for insect-resistant gene-based maize seedling leaves against fall armyworm resistance.

[0077] The tested population of fall armyworm was collected on January 22, 2020, from a fresh cornfield in Ruili, Yunnan Province. The samples were transferred through a greenhouse. M1CryAb-VIP3A Genetically modified corn seedlings, when grown to the 5-8 leaf stage, had their leaves (unfurled young heart leaves) cut into 2-3 cm pieces using sterilized scissors. Five fall armyworm adults were inoculated into each hole. Leaves from ordinary corn plants served as the control group. M1CryAb-VIP3A The leaves of the genetically modified plants were used as the experimental group. After culturing for 3 days, the insect resistance effect of the transgenic corn was observed.

[0078] The results are as follows Figure 9 As shown, the leaves of non-GMO corn were almost completely eaten by the fall armyworm, indicating susceptibility to the fall armyworm, while those of GMO corn were completely devoured. M1CryAb-VIP3A Genetically modified corn leaves are nearly intact, free from fall armyworm damage, and exhibit extremely strong resistance, indicating that the genetically modified corn... M1CryAb-VIP3A Genetically modified insect-resistant corn exhibits high resistance to fall armyworm.

[0079] In summary, M1CryAb-VIP3A Indoor bioassay results for insect-resistant gene resistance in maize seedling leaves against Asian corn borer and fall armyworm showed that: M1CryAb Genes and VIP3A(a)The modification and fusion of genes increases the insect resistance of individual genes. In addition, the modification and fusion of individual genes make the protein expressed by the fused gene highly resistant not only to Asian corn borer but also to fall armyworm. This not only enhances the insecticidal effect of crops but also expands the insecticidal spectrum, resulting in new crop varieties that are resistant to other lepidopteran pests or coleopteran pests (fall armyworm) in addition to corn borer.

[0080] Example 8: Safety Assessment

[0081] This invention fusion gene M1CryAb-VIP3A Through design modification, biological analysis, and verification of the biological effects of insect-resistant transgenic maize, based on achieving efficient expression of the fusion gene and good insect resistance, and in accordance with the Ministry of Agriculture Announcement No. 1485-18-2010 "Food Safety Testing of Transgenic Organisms and Their Products—Bioinformatics Analysis Method for Exogenous Protein Allergenicity," the following methods were used to analyze the transgenic maize. M1CryAb-VIP3A The amino acid sequence of the gene was compared and analyzed at two levels: 80 consecutive amino acids and 8 amino acids, respectively, in the Allergen Online Database and the Structural Database of Allergenic Proteins (SDAP).

[0082] The results showed that no suspected allergen sequences with greater than 35% homology were found in either the AllergenOnline Database or the Structural Database of Allergenic Proteins for 80 consecutive amino acid sequences of the two proteins; no homologous sequences at the level of 8 consecutive amino acids were also found in either database.

[0083] The present invention has been described in detail above with reference to the accompanying drawings and embodiments. However, those skilled in the art will understand that any changes, modifications, substitutions, combinations, or simplifications made without departing from the concept of the present invention should be equivalent substitutions, thereby forming multiple specific embodiments, all of which are common variations of the present invention, and will not be described in detail here.

Claims

1. An insect-resistant fusion gene M1CryAb-VIP3A Its characteristics are, It includes, in turn: by retaining Cry1Ab The modified gene was obtained by removing 1845 bp from the N-terminus and 1620 bp from the C-terminus. mCry1Ab Gene fragments, DNA sequences encoding 23-amino acid linker peptides, and by removing vip-s Modified gene obtained from the N-terminal 258 bp base sequence mVIP3A Gene fragment; its nucleotide sequence is shown in SEQ ID NO.

5.

2. A protein M1CryAb-VIP3A encoded by the insect-resistant fusion gene of claim 1, characterized in that, Its amino acid sequence is shown in SEQ ID NO.

6. The amino acid sequence of the protein was compared with a known allergen database. There were no sequences with greater than 35% homology in 80 consecutive amino acid units, and there were no homologous sequences of 8 consecutive amino acids.

3. A device containing the insect-resistant fusion gene of claim 1 M1CryAb-VIP3A The carrier of expression.

4. A recombinant bacterium constructed from the expression vector of claim 3.

5. The insect-resistant fusion gene according to claim 1 M1CryAb-VIP3A Application in the breeding of insect-resistant maize varieties.

6. The use of the protein M1CryAb-VIP3A encoded by the insect-resistant fusion gene of claim 2 in the preparation of insect-resistant biological agents.

Images