A pcr detection kit for aeromonas salmonicida subsp. salmonicida and a method of using the same
By designing a PCR detection kit for Aeromonas salmonicidae subsp. salmonicidae, and utilizing specific primers and an optimized PCR reaction procedure, the problem of rapid and accurate identification of Aeromonas salmonicidae subsp. salmonicidae was solved, achieving high sensitivity and specificity detection and avoiding misuse of drugs and economic losses.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-05-31
- Publication Date
- 2026-03-27
AI Technical Summary
Existing technologies make it difficult to quickly, easily, and accurately identify the salmon-killing subspecies of Aeromonas salmonidae, leading to misuse of drugs and delays in treatment, resulting in economic losses for aquaculture.
A PCR detection kit for Aeromonas salmonicida subsp. salmonicida is provided, including specific PCR detection primers A. salmononicida F1/R1, buffer, Taq DNA polymerase, dNTPs, etc. Through optimized PCR reaction procedures and systems, specific detection of Aeromonas salmonicida subsp. salmonicida can be achieved.
It achieves a sensitivity of 17.6 pg at the DNA level and 12.8 ± 1.8 cfu/reaction at the cellular level, exhibits high specificity, does not cross-react with other aquatic pathogens, shortens detection time, and saves economic costs.
Smart Images

Figure CN115651989B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of molecular biology detection, and relates to an Aeromonas salmonicida subsp. salmonicida PCR detection kit and a use method thereof. BACKGROUND
[0002] Aeromonas salmonicida belongs to Aeromonadaceae and Aeromonas, and is a facultative aerobic or aerobic gram-negative bacteria. Aeromonas salmonicida is mainly divided into five subspecies: Aeromonas salmonicida subsp. salmonicida, Aeromonas salmonicida subsp. smithia, Aeromonas salmonicida subsp. achromogenes, Aeromonas salmonicida subsp. masoucida and Aeromonas salmonicida subsp. pectinolytica. Aeromonas salmonicida is the pathogen of furuncle disease of various fish. Traditional pathogen identification can be based on physiological and biochemical characteristics, strain morphology and culture characteristics. However, these methods are tedious and time-consuming, and are prone to cross-reaction with other pathogenic bacteria. In addition, immunological techniques, loop-mediated isothermal amplification (LAMP), multiplex PCR, fluorescent quantitative PCR and conventional PCR have also been used to detect Aeromonas salmonicida. Most of them are based on the amplification of 16S rRNA gene, but these methods can only identify the genus and cannot identify the subspecies, and cannot distinguish the strains with high sequence similarity.
[0003] Aeromonas salmonicida is a common fish pathogenic bacteria. With the expansion of the scale of aquaculture and the increase of the density of aquaculture, the outbreak of Aeromonas salmonicida is becoming more and more frequent. However, the prevention and treatment of Aeromonas salmonicida is not optimistic, which brings difficulties to clinical treatment. Therefore, early diagnosis of Aeromonas salmonicida is of great significance. For bacterial pathogens, traditional detection methods first isolate and purify the pathogen, and then combine the culture characteristics, morphology, physiological and biochemical characteristics of the pathogen to make a judgment, which is time-consuming and not conducive to controlling the disease.
[0004] Aeromonas salmonicida is an important pathogen of various aquatic fish, and A. salmonicida subsp. is the most pathogenic subspecies. However, when detecting fish furuncle disease, the conventional detection method cannot determine the subspecies, and the drug cannot be used in time, resulting in the use of wrong drugs, the missed best treatment time, and the death of a large number of farmed fish, and the heavy blow of the farming economy. Moreover, the vaccine of Aeromonas salmonicida lacks cross-immune protection effect among different subspecies, and the vaccine immunity first needs to determine the subspecies of the infection. At present, only experienced biologists can diagnose Aeromonas salmonicida subsp. by laboratory operation and sequencing verification, and the diagnosis method is complex, and some original detection methods of Aeromonas salmonicida subsp. will react with other subspecies, and there is a lack of simple, rapid and accurate detection method. SUMMARY
[0005] The present application aims to first propose an Aeromonas salmonicida subsp. PCR detection kit and a use method thereof.
[0006] The present application is realized by the following technical scheme:
[0007] In order to achieve the above-mentioned purpose, the present application provides an Aeromonas salmonicida subsp. PCR detection kit, which comprises a buffer, Taq DNA polymerase, dNTPs, Aeromonas salmonicida subsp. specific PCR detection primers, a positive control and a negative control. The positive control is Aeromonas salmonicida subsp. ATCC33658 genomic DNA, and the negative control is sterilized double distilled water. The Aeromonas salmonicida subsp. PCR detection primers are shown as A. salmonicida F1 / R1.
[0008] Preferably, the components of the above-mentioned PCR detection system are as follows: 10x PCR buffer: 2.5uL, 2mm dNTPs: 2uL, 25mM MgSO4: 1.5uL, 1u / μL enzyme: 0.5uL, 10μmol / L primers each 1.5uL, ddH2O: 15.5uL, template: 1uL.
[0009] Preferably, the reaction program is as follows: 94℃ pre-denaturation for 5min, 98℃ denaturation for 10s, 55℃ annealing for 30s, 68℃ extension for 10s, 35 cycles, and 68℃ sufficient extension for 10min.
[0010] Preferably, the above-mentioned 10x PCR buffer contains 100mM KCl, 80mM(NH4)SO4, 100mM Tris-HCl with pH 9.0, 15mM MgCl2 and 0.5% Tergitol-type NP-40.
[0011] Preferably, the dNTPs include dGTP, dCTP, dATP, dTTP, each at a concentration of 2.5 mM.
[0012] The application also provides a method for non-diagnostic detection of the PCR detection kit for Aeromonas salmonicida subsp salmonicida, comprising the following steps:
[0013] S1: using a boiling method or a commercial kit to extract bacterial genomic DNA to obtain a detection template;
[0014] S2: PCR amplification, adding 10x PCR buffer, dNTPs, Taq DNA polymerase, detection primers and DNA template into a sterilized PCR reaction tube, adding sterilized double distilled water to a total volume of 25 μl, setting positive and negative controls at the same time, and using a PCR instrument for amplification reaction; 2% agarose gel electrophoresis is used for electrophoretic detection of the amplification product and analysis of the results;
[0015] S3: if a bright band appears in the electrophoresis result, it indicates that the sample is positive, otherwise it is negative.
[0016] Compared with the prior art, the application has the beneficial effects that:
[0017] (1) the detection sensitivity reaches 17.6 pg at the DNA level;
[0018] (2) it reaches 12.8±1.8 cfu / reaction at the cell level;
[0019] (3) the test has carried out specific detection on 23 common pathogenic bacteria, and the results show that only the specific band is detected in Aeromonas salmonicida subsp salmonicida, and no reaction occurs with other various aquatic pathogenic bacteria, indicating that the detection method has high specificity;
[0020] (4) the detection time is further shortened, the economic cost is saved, and support is provided for rapid detection of pathogens. BRIEF DESCRIPTION OF DRAWINGS
[0021] Figure 1 to optimize the PCR system of the application; (a): optimization of 2 mM dNTPs 1-4: 1, 2, 3, 4 uL; (b): optimization of 25 mM MgSO4 1-5: 1, 1.5, 2, 2.5, 3 uL; (c): optimization of 10 μmol / L primers 1-4: 1.5, 1, 0.75, 0.5 uL; (d): optimization of 1 u / μL enzyme 1-4: 0.25, 0.5, 0.75, 1 uL, M: DL 2000 marker.
[0022] Figure 2To optimize the PCR sensitivity of the present application; (a) 1-7: 1.28 ± 0.18) x 10 5 cfu, (1.28 ± 0.18) x 10 4 cfu, (1.28 ± 0.18) x 10 3 cfu, (1.28 ± 0.18) x 10 2 cfu, (0.256 ± 0.36) x 10 1 cfu, (1.28 ± 0.18) x 10 1 cfu, and (1.28 ± 0.18) x 10 0 boiled bacteria ATCC33658 as a template for PCR reaction, 8: blank control; (b) 1-4: primer A. salmonicida F1 / R1, 1.76 x 10 3 pg, 1.76 x 10 2 pg, 1.76 x 10 1 pg, 1.76 x 10 0 pg of ATCC33658 genomic DNA as a template for PCR amplification, 5: blank control.
[0023] Figure 3 To specifically detect the results of the present application; A. salmonicida subsp. masoucida, 5-7: A. salmonicida subsp. salmonicida, 8: A. salmonicida subsp. achromogenes, 9: A. salmonicida subsp. smithia, 10: Escherichia coli, 11: Aeromonas hydrophila, 12: Vibrio anguillarum, 13: Vibrio harveyi, 14: Vibrio harveyi, 15: Aeromonas encheleia, 16: Photobacterium damselae, 17: Photobacterium damselae, 18: Vibrio salmonicida, 19: Streptococcus iniae, 20: Streptococcus parauberis, 21: Streptococcus dysgalactiae, 22: Edwardsiella piscicida, 23: Bacillus, 24: blank control, M: DL 2000 marker.
[0024] Figure 4The PCR reaction was carried out using the tissue liquid as a template; 1: healthy fish tissue liquid, 2: dead fish tissue liquid, 3: positive control, 4: blank control, M: DL 2000 marker DETAILED DESCRIPTION
[0025] The present application will be described in more detail with reference to the following examples. It should be understood that the embodiments of the present application are not limited to the following examples, and any form of variation or change made to the present application falls within the scope of the present application; and the methods in the following examples are conventional methods in the art, unless otherwise specified.
[0026] Example 1
[0027] Strains and culture conditions
[0028] The strains used in the experiment are shown in Table 1, in which Aeromonas salmonicida, Aeromonas veronii were cultured at 20°C in TSA medium, Edwardsiella tarda, Escherichia coli were cultured at 37°C in LB medium, and other strains such as Aeromonas hydrophila, Photobacterium damsel, Vibrio anguillarum, Vibrio harveyi, Aeromonas veronii, Streptococcus parauberis, Vibrio salmonicida, Streptococcus iniae, Streptococcus dysgalactiae, Bacillus subtilis were cultured at 28°C in TSA medium.
[0029] Table 1 Strains used in the experiment
[0030]
[0031] Extraction of bacterial genomic DNA, design of specific primers and screening of reaction conditions
[0032] The bacterial genomic DNA extraction kit (TIANGEN, China) was used to extract the genomic DNA of Aeromonas salmonicida subsp. salmonicida ATCC33658.
[0033] Based on the phoB sequence of *Aeromonas salmonicida* subsp. *salmonicida* gene in GenBank, specific primers (*A. salmonicida* F1 / R1) were designed, using genomic DNA of *A. salmonicida* subsp. *salmonicida* ATCC33658 as a template. The 25 μL PCR reaction system consisted of: 12.5 μL of 2×Taq Plus PCR Master Mix, 9.5 μL of ddH2O, 1 μL each of 10 μmol / L forward and reverse primers, and 1 μL of DNA template. ddH2O was used as a blank control in the PCR system. The PCR reaction program for primer pair *A. salmonicida* F1 / R1 was: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s, annealing at 51℃, 53℃, 55℃, 57℃, 59℃ and 61℃ for 30 s, extension at 72℃ for 30 s, 35 cycles, and a final extension at 72℃ for 7 min. All amplification products were detected by 1.5% agarose gel electrophoresis and then sequenced for verification.
[0034] Optimization of PCR reaction system conditions
[0035] To optimize PCR amplification conditions, the concentrations of dNTPs, primers, Mg2+, and enzymes in the reaction system were optimized. The optimized conditions are shown in Table 3. The PCR products were subjected to 1.5% agarose gel electrophoresis, and the brightness of the PCR products was compared.
[0036] Table 3 Optimization of PCR reaction system
[0037]
[0038] like Figure 1 As shown in Figure 1, to obtain the highest sensitivity detection results, the 25 μL reaction system was optimized. The results showed that in the PCR reaction system using A. salmonicida F1 / R1 as primers, the optimal addition amounts of 2 mM dNTPs were 2, 3, and 4 μL, the optimal addition amount of 10 μmol / L primers was 1.5 μL, the optimal addition amounts of 25 mM MgSO4 were 1.5, 2, and 2.5 μL, and the optimal addition amounts of 1 u / μL enzyme were 0.5 and 0.75 μL (Figure 1). To save on usage, the reaction system used for the later stage primer A. salmonicida F1 / R1 was as follows: 10×PCR buffer: 2.5 μL, 2 mM dNTPs: 2 μL, 25 mM MgSO4: 1.5 μL, 1 u / μL enzyme: 0.5 μL, 10 μmol / L primers: 1.5 μL each, ddH2O: 15.5 μL, template: 1 μL. The reaction program was as follows: 94℃ pre-denaturation for 5 min, 98℃ denaturation for 10 s, 55℃ annealing for 30 s, 68℃ extension for 10 s, 35 cycles, and 68℃ full extension for 10 min.
[0039] PCR sensitivity detection
[0040] The number of colonies of Aeromonas salmonidae subsp. salmonidae ATCC33658 in liquid culture was determined by plate count method. The ATCC33658 bacterial suspension was diluted to (1.28±0.18)×10⁻⁶ with ddH₂O. 5 cfu / μL, (1.28 ± 0.18) × 10 4 cfu / μL, (1.28±0.18)×10 3 cfu / μL, (1.28±0.18)×10 2 cfu / μL, (0.256 ± 0.036) × 10 2 cfu / μL, (1.28±0.18)×10 1 cfu / μL, (1.28±0.18)×10 0 cfu / μL. Take 1 μL of the diluted bacterial culture for PCR amplification and detect it by 1.5% agarose gel electrophoresis.
[0041] The concentration of genomic DNA of Aeromonas salmonidae subsp. salmonidae ATCC33658 was determined by spectrophotometry and serially diluted 10-fold with ddH2O, yielding a concentration of 1.76 × 10⁻⁶ genomic DNA for ATCC33658. 3 -1.76×10 0 pg / μL. Take 1 μL of DNA solution from each dilution gradient for PCR amplification and perform 1.5% agarose gel electrophoresis for detection.
[0042] like Figure 2 As shown, when using serially diluted ATCC33658 bacterial suspensions as templates, the target band was amplified at bacterial suspension concentrations of (1.28±0.18)×10⁵–(1.28±0.18)×10¹ cfu / μL. However, the target band was not amplified at a bacterial suspension concentration of (1.28±0.18)×10⁰ cfu / μL. Therefore, the lowest sensitivity of the bacterial suspension concentration for the PCR detection method of Aeromonas salmonidida F1 / R1 established in this experiment is 12.8±1.8 cfu / reaction. Figure 2 a). Using DNA as a template, no target band was amplified at a DNA template concentration of 1.76 pg, while bands were detectable at other concentrations. Therefore, the detection limit for the PCR detection method using primers A. salmonicida F1 / R1 is 17.6 pg / reaction. Figure 2 b).
[0043] PCR specific detection
[0044] The bacteria used in the experiment are shown in Table 1. Single colonies were added to 20 μL ddH2O and heated at 95°C for 5 min. 1 μL was used as a template. The genomic DNA of 23 strains of bacteria was subjected to PCR amplification using ddH2O as a negative control and primers A. salmonicida F1 / R1. The PCR products were subjected to 1.5% agarose gel electrophoresis to identify the specificity of the PCR detection method.
[0045] As shown in Figure 3 , primers A. salmonicida F1 / R1 specifically detected 23 strains of bacteria in Table 1, including 4 strains of A. salmonicida salmonis, 3 strains of A. salmonicida salmonicida, and 16 strains of other bacterial genera. In the PCR reaction using A. salmonicida F1 / R1 as primers, only A. salmonicida salmonicida amplified specific bands, and no expected DNA bands were amplified from the DNA of other bacteria. Figure 3 Therefore, the primers A. salmonicida F1 / R1 designed based on the phoB gene can specifically detect A. salmonicida salmonicida.
[0046] Detection of pathogens in fish
[0047] The scophthalmus maximus used in the experiment was purchased from a certain breeding farm in Laizhang, with a body weight of 50-60 g. Before the experiment, they were cultured in 100 L circulating seawater culture systems with a water temperature of 18°C. Before the infection experiment, 5 fish were randomly selected for dissection, and the liver, spleen, and kidney were homogenized and spread on TSA medium to determine that the test fish did not carry pathogens. The test fish were randomly divided into 2 groups, 10 fish each, and cultured in 50 L conditioning tanks. The concentration of the cultured A. salmonicida salmonicida ASS20200608XZ11L bacterial solution was adjusted to 1 × 10 6 cfu / mL using PBS buffer. The dorsal muscle injection method was used to inject 0.1 mL of bacterial solution into each scophthalmus maximus, and the control group was injected with 0.1 mL of PBS buffer and raised under the same conditions.
[0048] As shown in Figure 4 , the scophthalmus maximus injected with A. salmonicida salmonicida strain ASS20200608XZ11L died within 7 days. 50 mg of tissue was added to ddH2O and ground into a tissue solution, which was heated at 95°C for 10 min. 1 uL was used as a template, and the DNA of ASS20200608XZ11L was used as a positive control. The PCR reaction was performed according to the reaction system and procedure of 2.2. The detection results showed that primers A. salmonicida F1 / R1 could detect A. salmonicida salmonicida in the tissues of sick fish, but no expected bands were amplified in the tissues of healthy fish. Figure 4), indicating that the primer A. salmonicida F1 / R1 can detect the A. salmonicida subsp. salmonicida pathogen from the diseased fish.
[0049]
[0050] SEQUENCE LISTING <110> Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences <120> A PCR detection kit for Aeromonas salmonicida subsp. salmonicida and a method of using the same <130> 22.05.2022 <160> 2 <170> PatentIn version 3.5 <210> 1 <211> 20 <212> DNA <213> Aeromonas salmonicida <400> 1 cggtcatcgc gttaaacgat 20 <210> 2 <211> 21 <212> DNA <213> Aeromonas salmonicida <400> 2 aggcaaccga tcaaatcact g 21
Claims
1. A PCR detection kit for Aeromonas salmonidae subsp. salmonidae, characterized in that: The PCR detection kit for A. salmonicida subsp. salmonicida comprises a buffer, Taq DNA polymerase, dNTPs, A. salmonicida subsp. salmonicida specific PCR detection primers, a positive control which is A. salmonicida subsp. salmonicida ATCC33658 genomic DNA, and a negative control which is sterilized double distilled water; the A. salmonicida subsp. salmonicida PCR detection primers are: A. salmonicida F1: cggtcatcgcgttaaacgat; A. salmonicida R1: aggcaaccgatcaaatcactg.
2. The Aeromonas salmonicida subsp. salmonicida PCR detection kit according to claim 1, characterized in that, The components of the PCR detection system are as follows: 10 × PCR buffer: 2.5 μL, 2 mMdNTPs: 2 μL, 25 mM MgSO4: 1.5µL, 1 u / µL enzyme: 0.5 µL, 10 µmol / L primers each 1.5 uL, ddH2O: 15.5 µL, template: 1 µL.
3. The Aeromonas salmonicida subsp. salmonicida PCR detection kit according to claim 1, characterized in that, The reaction procedure is as follows: 94 °C pre-denaturation for 5 min, 98 °C denaturation for 10 s, 55 °C annealing for 30 s, 68 °C elongation for 10 s, 35 cycles, and 68 °C full elongation for 10 min.
4. The Aeromonas salmonicida subsp. salmonicida PCR detection kit according to claim 2, characterized in that: The 10 × PCR buffer contains 100 mM KCl, 80 mM (NH4)2SO4, 100 mM Tris-HCl with a pH of 9.0, 15 mM MgCl2, and 0.5% Tergitol-type NP-40.
5. A method for non-diagnostic detection using the A. salmonicida subsp. salmonicida PCR detection kit according to claim 1, comprising the following steps: S1: extracting bacterial genomic DNA using a boiling method or a commercial kit to obtain a detection template; S2: PCR amplification, adding 10 × PCR buffer, dNTPs, Taq DNA polymerase, detection primers, and DNA template into a sterilized PCR reaction tube, adding sterilized double distilled water to a total volume of 25 μl, setting positive and negative controls at the same time, and using a PCR instrument for amplification reaction; Using 2% agarose gel electrophoresis to detect the amplification product by electrophoresis and analyze the results; S3: if there is a clear bright band in the electrophoresis results, it indicates that the sample is positive, otherwise it is negative.