SNP Molecular Marker for Watermelon Fruit Size Gene and Its Application

Abstract

The present invention discloses a SNP molecular marker for watermelon fruit size genes and its application, aiming to solve the technical problem of lacking recognition and identification methods for the major genes controlling watermelon fruit size. The present invention provides a SNP locus of a watermelon fruit size gene (the base at position 27,105,097 of chromosome 8 of the watermelon 97103 reference genome version 2 is mutated from T to C), and designed CAPS molecular marker primers v2ft36 based on the enzyme digestion information of the SNP locus. Applying this marker for molecular marker-assisted selection breeding can more quickly and accurately conduct directional genetic improvement of watermelon fruit size; the fruit size of watermelon can be quickly identified through simple experimental operations and analyses, providing a rapid, simple, scientific and practical detection and identification technology for the detection of watermelon fruit size traits.

Description

Technical Field

[0001] The present invention relates to the technical field of watermelon molecular marker-assisted breeding, and specifically relates to a SNP molecular marker for watermelon fruit size gene and its application. Background Art

[0002] Watermelon ( Citrullus lanatus ) belongs to the genus Citrullus of the Cucurbitaceae family and is one of the top ten fruits in the world. China is the largest watermelon producer and consumer in the world, and both the cultivation area and output of watermelon rank first in the world. Watermelon fruit size is an extremely important trait. However, people know very little about the genetic basis of fruit size variation in watermelon cultivated varieties. Therefore, studying and exploring the genetic traits of watermelon fruit size can provide a new direction for watermelon molecular breeding and genetic improvement.

[0003] Currently, with the rapid development of third-generation sequencing technology, cost reduction, and the development of related bioinformatics technologies, a large number of molecular marker loci can be identified in both model species and non-model species. Molecular markers such as Indel and SNP can be widely used in the construction of genetic maps of horticultural crops, QTL analysis, molecular marker-assisted selection breeding, etc. Therefore, there is an urgent need to develop a molecular marker that is closely linked to watermelon fruit size, easy to operate, has high identification efficiency, and low cost, in order to provide an efficient technical means for the fine mapping and molecular identification of watermelon fruit size genes.

[0004] The information disclosed in this background art section is only used to deepen the understanding of the background art of the present disclosure, and should not be regarded as an admission or any form of implication that this information constitutes the prior art known to those skilled in the art. Summary of the Invention

[0005] In view of at least one of the above technical problems, the present disclosure provides a SNP locus of watermelon fruit size gene (based on the watermelon 97103 reference genome sequence version 2, the base at position 27105097bp on chromosome 8 of the watermelon genome mutates from T to C), and designed the CAPS molecular marker primer v2ft36 based on the digestion information of the SNP locus.

[0006] According to one aspect of the present disclosure, a SNP molecular marker for watermelon fruit size gene is provided, based on the watermelon 97103 reference genome version 2, the base at position 27105097bp on chromosome 8 mutates from T of medium fruit trait to C of small fruit trait.

[0007] According to another aspect of the present disclosure, a detection kit is provided, including MaeII restriction endonuclease and the following primer v2ft36:

[0008] Forward primer v2ft36F: 5’- AACACGAATGGGCATCAATA -3’;

[0009] Reverse primer v2ft36R: 5’- CACCAAACGCCAAACTCTTA -3’.

[0010] According to another aspect of the present disclosure, the SNP molecular marker or the detection kit is applied to the breeding of watermelon fruit size varieties / lines.

[0011] According to another aspect of the present disclosure, a method for identifying the genotype of watermelon fruit size is provided, including the following steps:

[0012] (1) After extracting the total DNA of the watermelon to be identified, perform PCR amplification with the primer v2ft36 described in claim 2:

[0013] (2) Digest the PCR product obtained in the previous step with MaeII restriction endonuclease;

[0014] (3) Analyze the electrophoresis pattern of the obtained digested product, and determine the genotype to which it belongs based on the band size and positional relationship of the amplification product. Among them, the appearance of two bands of 142bp and 211bp represents the small fruit genotype, and the appearance of a 353bp band represents the medium fruit genotype.

[0015] In some embodiments of the present disclosure, in the step (1), use the plant genomic DNA extraction kit TIANGEN to extract the total DNA of the leaves of the watermelon to be identified.

[0016] In some embodiments of the present disclosure, in the step (1), the PCR amplification system is: 1 μL of total DNA of watermelon leaves, 1 μL of the forward primer v2ft36F, 1 μL of the reverse primer v2ft36R, 12.5 μL of 2× Power Taq PCRMasterMix, 9.5 μL of ddH2O; the amplification program is: 94°C for 5 min, 35 cycles of 94°C for 30 s, 52°C for 1 min, 72°C for 30 s, 72°C for 10 min.

[0017] In some embodiments of the present disclosure, in the step (2), the enzyme digestion reaction system is: 5 μl of PCR product, 0.5 μl of MaeII restriction endonuclease, 1.5 μl of 10× buffer, 8 μl of ddH2O; the reaction program is: constant temperature treatment at 37°C for 10 hours, inactivation at 65°C for 10 minutes.

[0018] One or more technical solutions provided in the embodiments of the present application have at least any one of the following technical effects or advantages:

[0019] 1. A molecular marker co-segregating with the watermelon fruit size gene was designed. Applying this marker for molecular marker-assisted selection breeding can more rapidly and accurately conduct directional genetic improvement of watermelon fruit size.

[0020] 2. It was applied in watermelon populations with different fruit sizes, and its genotype accuracy rate was 100%. It can provide a new means for identifying watermelon fruit size and improve the accuracy and selection efficiency of breeding.

[0021] 3. The watermelon fruit size can be rapidly identified through simple experimental operations and analysis, providing a rapid, simple, scientific and practical detection and identification technology for the detection of watermelon fruit size traits. Description of the Drawings

[0022] Figure 1 This is the QTL mapping result of the watermelon fruit size trait in an embodiment of this application.

[0023] Figure 2 This is the PCR digestion result diagram of the primer of the molecular marker v2ft36 on chromosome 8 of watermelon in an embodiment of this application in watermelon B166 (male parent), S16 (female parent), S17 (F1) and part of the random S18 population; among them, A: male parent genotype, B: female parent genotype, H: F1 heterozygous genotype, M: marker. Detailed Embodiments

[0024] To better understand the technical solution of this application, the above technical solution will be described in detail below in combination with the drawings in the specification and specific embodiments.

[0025] In the following embodiments, the instrument equipment involved is all conventional instrument equipment unless otherwise specified; the reagents involved are all commercially available conventional reagents unless otherwise specified; the test methods involved are all conventional methods unless otherwise specified.

[0026] Example 1: Determination of the watermelon fruit size gene and development of molecular markers

[0027] Simplified genome sequencing was performed on different types of watermelon materials. Combining the differences in population polymorphisms to determine the selected regions between populations, obtaining the chromosomal intervals related to watermelon fruit size types. SNP sites within the target chromosomal intervals were screened using deep resequencing of small-fruit watermelon materials and medium-fruit watermelon materials, and CAPS / dCAPS molecular marker primers were designed. Then, PCR amplification was performed using the CAPS / dCAPS molecular marker primers and watermelon genomic DNA, and finally, the amplified products were digested and verified by electrophoresis. Each of the test materials is an innovative germplasm material preserved in the Medium-term Repository of Chinese Watermelon and Melon, Zhengzhou Fruit Research Institute, Chinese Academy of Agricultural Sciences.

[0028] The specific steps are as follows:

[0029] (1)Preliminary mapping of the major QTL interval for watermelon fruit size trait

[0030] Hybridize the large-fruited female parent B38 (accession number ZXG03282 in the China National Mid-term Genebank of Watermelon and Melon, Zhengzhou Fruit Research Institute, Chinese Academy of Agricultural Sciences) with the small-fruited male parent B166 (accession number ZXG02728 in the China National Mid-term Genebank of Watermelon and Melon, Zhengzhou Fruit Research Institute, Chinese Academy of Agricultural Sciences) to obtain F1, and then backcross F1 with B166 to obtain a BC1 population. Construct a high-density genetic linkage map, and visually identify the fruit size of 83 single fruits from the parental lines, F1, and BC1 population; combine the genetic linkage map and the phenotypic identification results of the BC1 population, and use the R / qtl-CIM method for preliminary QTL mapping to identify the major QTL for fruit size. This QTL is located on chromosome 8 (see Figure 1 ), with an LOD peak value of 8.03, explaining 41.37% of the phenotypic variation, and the confidence interval is 25760764bp - 28051220bp.

[0031] (2)Fine mapping of the major QTL interval for watermelon fruit size trait

[0032] A. Select the small-fruited watermelon B166 as the male parent, the medium-fruited watermelon S16 (accession number ZXG00453 in the China National Mid-term Genebank of Watermelon and Melon, Zhengzhou Fruit Research Institute, Chinese Academy of Agricultural Sciences) as the female parent, the medium-fruited watermelon S17 after their hybridization as F1, and the backcross population S18 of S17 with the male parent. Use a plant genomic DNA extraction kit (TIANGEN) to extract the total DNA of watermelon leaves. The specific steps are as follows:

[0033] ① Take 100 mg of fresh plant tissue or 20 mg of dry weight tissue, add liquid nitrogen and grind thoroughly. Add 400 μl of buffer FGA and 6 μl of RNase A (10 mg / ml), vortex for 1 min, and place at room temperature for 10 min.

[0034] ② Add 130 μl of buffer LP2, mix well, and vortex for 1 min.

[0035] ③ Centrifuge at 12,000 rpm (~13,400×g) for 5 min, and transfer the supernatant to a new centrifuge tube.

[0036] ④ Add 1.5 volumes of buffer LP3 (for example, 500 μl of filtrate plus 750 μl of buffer LP3) (please check whether absolute ethanol has been added before use), immediately shake well for 15 sec, and flocculent precipitates may appear at this time.

[0037] ⑤ Add both the solution and the flocculent precipitate obtained in the previous step to an adsorption column CB3 (the adsorption column is placed in a collection tube), centrifuge at 12,000 rpm (~13,400×g) for 30 sec, discard the waste liquid, and place the adsorption column CB3 in the collection tube.

[0038] ⑥ Add 600 μl of wash buffer PW to the adsorption column CB3 (please check whether absolute ethanol has been added before use), centrifuge at 12,000 rpm (~13,400×g) for 30 sec, discard the waste liquid, and place the adsorption column CB3 in the collection tube.

[0039] ⑦ Repeat operation step ⑥.

[0040] ⑧ Place the adsorption column CB3 back into the collection tube, centrifuge at 12,000 rpm (~13,400×g) for 2 min, and discard the waste liquid. Place the adsorption column CB3 at room temperature for several minutes to thoroughly dry the residual wash buffer in the adsorption material.

[0041] ⑨ Transfer the adsorption column CB3 into a clean centrifuge tube, suspend and add 200 μl of elution buffer TB to the middle part of the adsorption membrane, let it stand at room temperature for 2 - 5 min, centrifuge at 12,000 rpm (~13,400×g) for 2 min, and collect the solution into the centrifuge tube.

[0042] ⑩ Measure the concentration of DNA using a UV - visible spectrophotometer and store it for future use in a - 20℃ refrigerator.

[0043] B. Design of CAPS Marker Primers for Identifying Watermelon Fruit Size Traits

[0044] Use the deep re - sequencing of the male and female watermelon materials to screen for SNP mutation sites existing in the target chromosomal region. This site is located at 27,105,097 bp on chromosome 8 of the watermelon genome (version 2 of the watermelon 97103 reference genome sequence), and its base changes from T to C, (T and C represent the medium - fruit genotype and small - fruit genotype respectively).

[0045] Analyze the enzyme digestion information of the SNP site to obtain the sequence with CAPS / dCAPS mutations. Name the specific CAPS molecular marker for this watermelon fruit size type as v2ft36, and design CAPS molecular marker primers:

[0046] The nucleotide sequence of the forward primer is v2ft36F: AACACGAATGGGCATCAATA;

[0047] The nucleotide sequence of the reverse primer is v2ft36R: CACCAAACGCCAAACTCTTA;

[0048] The restriction endonuclease used is MaeII.

[0049] C. PCR Reaction System and Procedure

[0050] Reaction System: 1 μL of 100 ng / μL total DNA of watermelon plants, 1 μL of CAPS molecular marker upstream primer v2ft36F, 1 μL of downstream primer v2ft36R, 12.5 μL of 2×Power Taq PCR MasterMix, 9.5 μL of ddH2O;

[0051] Reaction Procedure: 5 min at 94°C, 35 cycles of 30 s at 94°C, 1 min at 55°C, 30 s at 72°C, 10 min at 72°C;

[0052] D. Restriction Enzyme Digestion Reaction System and Procedure:

[0053] Reaction System: 5 μL of PCR product, 0.5 μL of MaeII restriction endonuclease, 1.5 μL of 10× buffer, 8 μL of ddH2O;

[0054] Reaction Procedure: Incubate at 37°C for 10 hours, inactivate at 65°C for 10 minutes;

[0055] E. Perform 8% polyacrylamide gel electrophoresis, developing, staining and band pattern interpretation on the restriction enzyme digestion products.

[0056] Reagent Preparation:

[0057] ① 5×TBE Electrophoresis Buffer: Weigh 26.95 g of Tris, 1.86 g of EDTA, 13.75 g of boric acid, and make up to 500 mL with deionized water;

[0058] ② 40% Polyacrylamide Solution: 77.34 g of polyacrylamide, 2.66 g of methylene bisacrylamide, and make up to 200 mL with deionized water;

[0059] ③ 8% Polyacrylamide Gel: 10 mL of 40% polyacrylamide solution; 5 mL of 5×TBE; 200 μL of 10% ammonium persulfate (APS); 80 μL of tetramethylethylenediamine (TEMED); 22 mL of distilled water;

[0060] ④ Silver Staining Solution: 1 g of silver nitrate; 5 mL of glacial acetic acid; 50 mL of absolute ethanol; make up to 500 mL with deionized water;

[0061] ⑤ Developing Solution: 15 g of sodium hydroxide; 2.5 mL of formaldehyde (37%); make up to 500 mL with deionized water.

[0062] F. Gel Plate Preparation

[0063] After washing the gel glass plate with distilled water and air-drying it, wipe it with absorbent cotton balls soaked in absolute ethanol and then air-dry it again. Stack the concave plate and the flat plate tightly, place them in the gel maker, press them firmly and fasten the clips on both sides. The concave glass faces inward. Prepare an 8% polyacrylamide gel solution in a wash bottle, mix it well and quickly inject it into the gap between the two plates, and pay attention to preventing the generation of air bubbles. After filling, quickly insert a toothed comb, and it is appropriate that the bottom of the comb just touches the gel surface. Wait for the solution to solidify completely.

[0064] G. Electrophoresis

[0065] Remove the gel maker bracket from the base and directly place it in the supporting electrophoresis tank. Pour an appropriate amount of 1× TBE buffer solution at the bottom of the electrophoresis tank and between the two glass plates on the bracket. Add 0.2 times the volume of 6× DNA Loading Buffer to the PCR product, mix well and take 0.8 μL and add it into the sample loading hole, and perform electrophoresis at 260 V for 35 min.

[0066] H. Staining and development:

[0067] After electrophoresis is completed, take out the glass plate from the electrophoresis tank, pry off the concave plate, and the gel will adhere to the flat plate. Place the flat plate with the gel surface facing up into the silver staining solution, place it on a shaker and gently shake for 15 min, and the gel will fall off automatically; after silver staining, take out the gel and wash it in deionized water for 10 s; after washing, transfer the gel into the developing solution, gently shake the shaker, take out the gel after the bands are clear, and place it on a film reader to observe and take pictures for preservation.

[0068] I. Band pattern interpretation

[0069] Place the glass plate that has been naturally dried after development on the film reading table, and observe the position differences of the bands of the male and female parents and the S18 population.

[0070] The results of genotype identification of the v2ft36 molecular marker in the S18 population are as Figure 2 shown. After enzyme digestion, the sizes of the target fragments of the male parent are two bands of 142 bp and 211 bp, and the size of the target fragment of the female parent is 353 bp. The enzyme digestion product bands of 142 bp and 211 bp are of the small-fruited watermelon type, the enzyme digestion product band of 353 bp is of the medium-fruited watermelon type, and the product bands of 142 bp, 211 bp and 353 bp are of the medium-fruited watermelon type.

[0071] Example 2: Genotype analysis of the S18 population

[0072] After the genotype identification of the v2ft36 molecular marker in the BC1 population constructed by male parent B166 and female parent S16 through Example 1, the distribution of the two genotypes of the v2ft36 molecular marker in 96 BC1 populations was examined, and it was found that the v2ft36 genotype was completely co-segregated with the watermelon fruit size phenotype. The results are shown in Table 1, where A represents the male parent banding pattern, B represents the female parent banding pattern, and H represents the heterozygous genotype.

[0073] All 55 lines with the genotype A of the molecular marker v2ft36 were of the small fruit watermelon type (small watermelon), while all 41 lines with the genotype B were of the medium fruit watermelon type (medium), and the accuracy rate of its genotype identification was 100%.

[0074] Although some preferred embodiments of the present invention have been described, those skilled in the art can make additional changes and modifications to these embodiments once they know the basic creative concept. Therefore, the appended claims are intended to be interpreted to include the preferred embodiments as well as all changes and modifications falling within the scope of the present invention.

[0075] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of this application and their equivalent technologies, the present invention is also intended to include these modifications and variations.

[0076] Table 1 Identification and verification of v2ft36 in the S18 population

[0077] 。

Claims

1. Use of a detection kit in the breeding of watermelon fruit size and variety, characterized in that, The detection kit is used to detect the SNP molecular marker of the watermelon fruit size gene, and it includes MaeII restriction endonuclease and the following primer v2ft36: Forward primer v2ft36F: 5’- AACACGAATGGGCATCAATA -3’; Reverse primer v2ft36R: 5’- CACCAAACGCCAAACTCTTA -3’; The SNP molecular marker of the watermelon fruit size gene is: Based on the watermelon 97103 reference genome version V2, there is a C / T polymorphism at the base at position 27105097bp on chromosome 8.

2. A method for identifying watermelon fruit size genotypes, characterized in that, It includes the following steps: (1) After extracting the total DNA of the watermelon to be identified, perform PCR amplification with the primer v2ft36 described in claim 1: (2) Digest the PCR product obtained in the previous step with MaeII restriction endonuclease; (3) Analyze the electrophoresis pattern of the obtained digested product, and determine the genotype to which it belongs based on the band size and positional relationship of the amplification product. Among them, those with two bands of 142bp and 211bp are small fruit genotypes, and those with a single 353bp band or those with bands of 142bp, 211bp and 353bp simultaneously are medium fruit genotypes.

3. The method for identifying the genotype of watermelon fruit size according to claim 2, wherein In the step (1), use the plant genomic DNA extraction kit TIANGEN to extract the total DNA of the watermelon leaves to be identified.

4. The method for identifying watermelon fruit size genotypes according to claim 2, wherein In the step (1), the PCR amplification system is: 1μL of total watermelon leaf DNA, 1μL of the forward primer v2ft36F, 1μL of the reverse primer v2ft36R, 12.5μL of 2× Power Taq PCR MasterMix, 9.5μL of ddH2O; the amplification program is: 94℃ for 5min, 35 cycles of 94℃ for 30s, 52℃ for 1 min, 72℃ for 30 s, 72℃ for 10min.

5. The method for identifying the genotype of watermelon fruit size according to claim 2, characterized in that, In the step (2), the digestion reaction system is: 5μl of PCR product, 0.5μl of MaeII restriction endonuclease, 1.5μl of 10× buffer, 8μl of ddH2O; the reaction program is: incubate at 37℃ for 10 hours and inactivate at 65℃ for 10 minutes.

Images