Glycosyltransferase, gene, vector, host cell and glycosylation method

Abstract

The present invention discloses a glycosyltransferase, a gene, a vector, a host cell, and a glycosylation method. The amino acid sequence of the glycosyltransferase is as shown in SEQ ID NO:1, or an amino acid sequence having the same function formed by substituting, deleting, or adding 1 to 20 amino acids to this sequence. The glycosyltransferase of the present invention has catalytic site specificity and promiscuity for catalytic substrates and glycosyl donors.

Description

Technical Field

[0001] This invention relates to a glycosyltransferase and its encoding gene, vector and host cell, and also to a method for glycosylation of aromatic alcohols. Background Technology

[0002] Aromatic compounds possess a wide range of pharmacological activities, including antioxidant, lipid-lowering, anti-osteoporosis, anti-tumor, antiviral, and antibacterial effects, and play an important role in natural drug research. Simple aromatic compounds, such as monocyclic or polycyclic aromatic alcohols, are not only pharmaceutically active themselves but also frequently serve as important structural modification precursors or chemical synthesis intermediates in the synthesis of structurally diverse aromatic compounds, playing a crucial role in the discovery and structural modification of drug lead compounds. For example, the monocyclic aromatic alcohol tyrosol, in addition to its anti-inflammatory properties and ability to improve cardiovascular and cerebrovascular diseases, is also a precursor in the synthesis of the active compound rhodioloside.

[0003] Glycosylation is an important type of structural modification of natural products. The introduction of glycosylation groups can increase the structural and functional diversity of natural products, improve the water solubility of poorly soluble compounds, and thus enhance their bioavailability and drug-likeness.

[0004] Glycosylation modification of aromatic alcohols mainly involves chemical and biological methods. Chemical methods are relatively complex, inevitably involving issues such as the introduction site, number, and linkage mode of sugar chains, as well as protection and deprotection. The reaction conditions are harsh, and the costs are high, making them unsuitable for mass production. Biological methods, on the other hand, offer advantages such as high reaction selectivity, high catalytic efficiency, mild reaction conditions, fewer byproducts, environmental friendliness, and simple post-processing, making them an ideal method for glycosylation modification of aromatic alcohols.

[0005] CN104774815A discloses a glycosyltransferase for catalyzing the synthesis of gastrodin or rhodioloside. However, this glycosyltransferase, in addition to glycosylation of the side-chain hydroxyl groups of aromatic alcohols, can also catalyze the glucosylation of the same substrate at the phenolic hydroxyl groups on the aromatic ring to generate gastrodin. Therefore, the catalytic site specificity of this glycosyltransferase is generally limited, byproducts are generated in the catalytic reaction, and it does not exhibit significant substrate and glycosyl donor selectivity. Summary of the Invention

[0006] In view of the above, one object of the present invention is to provide a glycosyltransferase with a specific catalytic site, the catalytic site of which specifically occurs on the side chain hydroxyl group of aromatic alcohols, and exhibits heterogeneity in the selection of catalytic substrates and glycosyl donors. Another object of the present invention is to provide a nucleotide sequence encoding the above-mentioned glycosyltransferase. A further object of the present invention is to provide a recombinant expression vector containing the above-mentioned nucleotide sequence. Yet another object of the present invention is to provide a recombinant host cell containing the nucleotide sequence or the recombinant expression vector. Still another object of the present invention is to provide a method for glycosylation of aromatic alcohols, which has high catalytic site specificity and a wide applicability of catalytic substrates.

[0007] The present invention achieves the above objectives using the following technical solutions.

[0008] On the one hand, the present invention provides a glycosyltransferase, the amino acid sequence of which is shown in SEQ ID NO:1, or an amino acid sequence with equivalent function formed by replacing, deleting or adding 1 to 20 amino acids.

[0009] The present invention also provides a glycosyltransferase, the amino acid sequence of which is shown in SEQ ID NO:4 or SEQ ID NO:5.

[0010] On the other hand, the present invention provides a nucleotide sequence encoding the above-mentioned glycosyltransferase.

[0011] According to the nucleotide sequence of the present invention, preferably, the amino acid sequence is as shown in SEQ ID NO:1, and the nucleotide sequence is as shown in SEQ ID NO:2 or SEQ ID NO:3.

[0012] In another aspect, the present invention provides a recombinant expression vector containing the above-mentioned nucleotide sequence.

[0013] According to the recombinant expression vector of the present invention, preferably, the expression vector used is pET-28a.

[0014] In another aspect, the present invention provides a recombinant host cell containing the above-mentioned nucleotide sequence or the above-mentioned recombinant expression vector.

[0015] According to the recombinant host cell of the present invention, preferably, the recombinant host cell is a recombinant Escherichia coli cell.

[0016] In another aspect, the present invention provides a method for glycosylation of aromatic alcohols, comprising subjecting a reaction system containing the above-mentioned glycosyltransferase, aromatic alcohol glycosyl acceptor and glycosyl donor to a glycosylation reaction.

[0017] According to the glycosylation method of the present invention, preferably, the glycosyl donor is a nucleoside diphosphorylated glycosyl compound; the aromatic ring of the aromatic alcohol glycosyl acceptor is selected from one of benzene, biphenyl, benzylbenzene, 1,2,3,4-tetrahydronaphthalene, benzocyclopentane, acenaphthene, fluorene, anthracene, and pyrene.

[0018] This invention cloned a glycosyltransferase (SEQ ID NO:1) from *Cistanche tubulosa*. This glycosyltransferase specifically catalyzes the glycosylation of the side-chain hydroxyl groups of monocyclic aromatic alcohols and can catalyze glycosylation reactions of different substrates and glycosyl acceptors. A glycosyltransferase (SEQ ID NO:4) formed by truncating the N-terminus of the above glycosyltransferase by 12 amino acids exhibits higher catalytic efficiency. This invention also discovered that by mutating the tyrosine residue at position 159 to valine in a sequence formed by truncating the N-terminus by 12 amino acids, a glycosyltransferase (SEQ ID NO:5) was formed, further broadening the catalytic substrate scope. It can catalyze not only monocyclic aromatic alcohols but also polycyclic and fused-ring aromatic alcohols. This invention also discloses an optimized nucleotide sequence (SEQ ID NO:3), which significantly increases protein expression. Attached Figure Description

[0019] Figure 1 Agarose gel electrophoresis image of total RNA from Cistanche tubulosa.

[0020] Figure 2 This is an agarose gel electrophoresis image of the coding region of the glycosyltransferase CtGT-B gene.

[0021] Figure 3 This is an SDS-PAGE electrophoresis image of the heterologously expressed glycosyltransferase CtGT-B. Gradient elutions were performed with imidazole at concentrations of 20 mM, 30 mM, 70 mM, 110 mM, 160 mM, 250 mM, and 300 mM, with one fraction added for every two column volumes. Each gradient was used for 10 column volumes. In the equation "ab", 'a' represents the imidazole concentration, and 'b' represents the fraction eluted at that concentration. A 'b' of 1 indicates the fraction added after eluting the first two column volumes at the imidazole concentration of 'a'; a 'b' of 2 indicates the fraction added after eluting the third and fourth column volumes at the imidazole concentration of 'a', and so on. For example, 30-3 indicates the fraction added after eluting the fifth and sixth column volumes at a 30 mM imidazole concentration.

[0022] Figure 4 SDS-PAGE electrophoresis images of glycosyltransferases CtGT-Bopt-12aa and CtGT-Bopt-12aa-Y159V.

[0023] Figure 5AThe figure shows the HPLC analysis of the reaction of tyrosol and UDP-glucose catalyzed by the glycosyltransferase CtGT-B. The smaller figure shows the DAD characteristic UV absorption spectrum of rhodioloside.

[0024] Figure 5B This is the molecular ion mass spectrum of the product obtained from the glycosyltransferase CtGT-B-catalyzed reaction of tyrosol and UDP-glucose.

[0025] Figure 5C The product obtained from the glycosyltransferase CtGT-B-catalyzed reaction of tyrosol and UDP-glucose glycosylation. 1 H NMR spectrum.

[0026] Figure 6A This is an HPLC chromatogram of the reaction of tyrosol and UDP-glucose catalyzed by the glycosyltransferase CtGT-Bopt.

[0027] Figure 6B This is an HPLC chromatogram of the reaction of tyrosol and UDP-glucose catalyzed by the glycosyltransferase CtGT-Bopt-12aa.

[0028] Figure 7 Figure 1 shows the HPLC-MS analysis of the glycosylation reaction of 1-naphthylethanol catalyzed by the glycosyltransferase CtGT-Bopt-12aa-Y159V with different glycosyl donors; Figures a, b, and c are HPLC-MS analysis chromatograms, where the glycosyl donor in Figure a is UDP-glucose, the glycosyl donor in Figure b is UDP-N-acetylglucosamine, the glycosyl donor in Figure c is UDP-galactose, and Figure d shows the structural formula and HPLC analysis chromatogram of 1-naphthylethanol.

[0029] Figure 8 shows the NMR spectra of the glucosylation products of 2-methylphenylethanol catalyzed by the glycosyltransferase CtGT-Bopt (Table 2, serial numbers 7-2); among them, Figure 8A The glycosylation product uses 2-methylphenylethanol as the acceptor and UDP-glucose as the donor. 1 H NMR spectrum Figure 8B The glycosylation product uses 2-methylphenylethanol as the acceptor and UDP-glucose as the donor. 13 C NMR spectrum.

[0030] Figure 9 shows the NMR spectra of the glycosyltransferase CtGT-Bopt-12aa-Y159V with 1-(2-naphthyl)ethanol as the glucosylated product (Table 2, serial numbers 7-22); Figure 9A The glycosylation product uses 1-(2-naphthyl)ethanol as the acceptor and UDP-glucose as the donor. 1 H NMR spectrum Figure 9B The glycosylation product uses 1-(2-naphthyl)ethanol as the acceptor and UDP-glucose as the donor. 13CNMR spectrum. Detailed Implementation

[0031] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto.

[0032] <Glycosyltransferases and nucleotide sequences>

[0033] This invention is the first to clone an enzyme with glycosyltransferase catalytic function from Cistanche tubulosa, and further screened, identified and optimized it to obtain the glycosyltransferase of this invention and the nucleotide sequence encoding the glycosyltransferase of this invention.

[0034] This invention is the first to screen and identify a glycosyltransferase from the plant *Cistanche tubulosa* (Schenk.) Wight. The glycosyltransferase of this invention can be a natural protease or an enzyme containing mutations that still possesses catalytic glycosyltransfer activity. Preferably, the glycosyltransferase of this invention comprises the amino acid sequence shown in SEQ ID NO:1, or an amino acid sequence with equivalent function formed by substitution, deletion, or addition of one or more amino acids. In some embodiments, the amino acid sequence of the glycosyltransferase has more than 90%, preferably more than 92%, more preferably more than 95%, further preferably more than 98%, and even more preferably more than 99% homology with the sequence shown in SEQ ID NO:1 and originates from the same species, *Cistanche tubulosa*. In this application, "homology" refers to the similarity between two sequences, which can be determined by any algorithm known in the art. For example, the degree of identity between two amino acid sequences can be determined using the Needleman-Wunsch algorithm. Preferably, the molecular weight of the glycosyltransferase of this invention is 53.89 kDa. The theoretical isoelectric point is 5.39, indicating that it is an acidic protein. The instability index is 45.73, indicating that the protein may be unstable. The grand average of hydrophobicity (GRAVY) is -0.145, indicating that it is a hydrophilic protein composed of 482 amino acids. The amino acid sequence SEQ ID NO:1 is sometimes abbreviated as "CtGT-B" or "CtGT-Bopt".

[0035] According to a preferred embodiment of the present invention, the N-terminus is truncated by 12 amino acids to obtain the amino acid sequence SEQ ID NO:4 (hereinafter sometimes referred to as "CtGT-Bopt-12aa"). The glycosyltransferase encoded by the amino acid sequence SEQ ID NO:4 has higher catalytic efficiency.

[0036] According to another preferred embodiment of the present invention, the tyrosine at position 159 of the amino acid sequence SEQ ID NO:4 is mutated to valine to obtain the amino acid sequence SEQ ID NO:5 (hereinafter sometimes referred to as "CtGT-Bopt-12aa-Y159V"). The glycosyltransferase encoded by the amino acid sequence SEQ ID NO:5 further expands the range of catalytic substrates, and it can catalyze various glycosylation reactions of monocyclic, polycyclic, and fused-ring aromatic alcohols.

[0037] A nucleotide sequence encoding the aforementioned glycosyltransferase. The amino acid sequence of the glycosyltransferase may be as shown in SEQ ID NO:1. The nucleotide sequence may be as shown in SEQ ID NO:2 or SEQ ID NO:3. The nucleotide sequence SEQ ID NO:3 is a nucleotide sequence obtained by codon preference optimization based on the nucleotide sequence SEQ ID NO:2, and its protein expression level is significantly increased compared to SEQ ID NO:2. The amino acid sequences encoded by nucleotide sequences SEQ ID NO:3 and SEQ ID NO:2 are identical. The glycosyltransferase obtained from the nucleotide sequence encoded by SEQ ID NO:2 is sometimes abbreviated as "CtGT-B". The glycosyltransferase obtained from the nucleotide sequence encoded by SEQ ID NO:3 is sometimes abbreviated as "CtGT-Bopt".

[0038] <Recombinant Expression Vectors and Recombinant Host Cells>

[0039] The nucleotide sequence encoding the aforementioned glycosyltransferase was cloned into an expression vector to construct a recombinant expression vector. The expression vector used could be pET-28a.

[0040] The nucleotide sequence encoding the aforementioned glycosyltransferase or the aforementioned recombinant expression vector is used for expression in host cells to form recombinant host cells. The host cells used can be *Escherichia coli*.

[0041] <Glycosylation Methods>

[0042] A method for glycosylation of aromatic alcohols includes glycosylation of a reaction system comprising the aforementioned glycosyltransferase, aromatic alcohol glycosyl acceptor, and glycosyl donor. The reaction system of this invention may further include a buffer solution.

[0043] The glycosyl donor can be a glycosyl compound diphosphated with nucleoside; preferably, the glycosyl donor is selected from one or more of UDP-glucose, UDP-N-acetylglucosamine or UDP-galactose; more preferably, the glycosyl donor is UDP-glucose.

[0044] When the amino acid sequence of the glycosyltransferase is SEQ ID NO:1 (i.e., "CtGT-B" or "CtGT-Bopt") or SEQ ID NO:4 (i.e., "CtGT-Bopt-12aa"), the aromatic ring of the aromatic alcohol glycosyl acceptor is a benzene ring. The benzene ring is substituted with an aliphatic hydroxyalkyl group or an aliphatic hydroxyalkenyl group to form an aromatic alcohol. The aliphatic hydroxyalkyl group can be a straight-chain aliphatic hydroxyalkyl group or a branched aliphatic hydroxyalkyl group. The aliphatic hydroxyalkyl group can have 1 to 10 carbon atoms, preferably 1 to 6 carbon atoms, more preferably 1 to 3 carbon atoms. The aliphatic hydroxyalkenyl group is preferably a straight-chain aliphatic hydroxyalkenyl group. The aliphatic hydroxyalkenyl group can have 3 to 10 carbon atoms, preferably 3 to 6 carbon atoms, more preferably 3 to 4 carbon atoms. In addition to the hydroxyalkyl or hydroxyalkenyl group, the benzene ring may also have one or more substituents. The substituents can be located at the 2, 3, or 4 positions of the benzene ring. The substituents on the benzene ring can be selected from hydroxyl, C1-C3 alkyl, halogen, C1-C3 alkoxy, nitro, and amino. Examples of C1-C3 alkyl groups include, but are not limited to, methyl, ethyl, and propyl. Examples of C1-C3 alkoxy groups include, but are not limited to, methoxy, ethoxy, and propoxy. Examples of halogens include, but are not limited to, fluorine, chlorine, and bromine.

[0045] In some embodiments, the aromatic alcohol glycosyl acceptor is selected from one of compounds having the following structure:

[0046] (A)

[0047] Wherein, R is selected from hydroxyl, methoxy, methyl, nitro, amino, fluorine, chlorine, bromine, and hydrogen, and n is selected from an integer from 1 to 10, preferably an integer from 1 to 6, and more preferably an integer from 1 to 3;

[0048] (B)

[0049]

[0050] According to one embodiment of the present invention, the aromatic alcohol glycosyl acceptor is selected from one of the following compounds:

[0051]

[0052] When the amino acid sequence of the glycosyltransferase is SEQ ID NO:5 (i.e., "CtGT-Bopt-12aa-Y159V"), the aromatic alcohol glycosyl acceptor can be a polycyclic or fused-ring aromatic alcohol compound, in addition to the monocyclic aromatic alcohol compounds mentioned above. The aromatic ring of the polycyclic and fused-ring aromatic alcohol compounds can be selected from one of biphenyl, benzylbenzene, 1,2,3,4-tetrahydronaphthalene, benzocyclopentane, acenaphthene, fluorene, anthracene, and pyrene.

[0053] According to one embodiment of the present invention, polycyclic and fused-ring aromatic alcohols have one of the following structures:

[0054]

[0055] In some embodiments, the reaction system of the present invention may further include a buffer solution. The buffer solution contains 30–70 mM Tris-HCl, 0.5–3 mM DTT, 0.5–3 vol% glycerol, and 70–120 mM NaCl. According to one embodiment of the present invention, the buffer solution consists of 50 mM Tris-HCl, 1 mM DTT, 1.5 vol% glycerol, and 100 mM NaCl. The amounts of each substance in the buffer solution can be scaled up or down according to the above proportions.

[0056] In some embodiments, the reaction system, in 150 μL, contains 0.01–0.15 μM aromatic alcohols, 3–50 μg glycosyltransferase and 0.05–0.20 μM glycosyl donor, with buffer added to 150 μL, and the reaction system scaled up proportionally.

[0057] According to a preferred embodiment of the present invention, the reaction system, in 150 μL, contains 0.04 μM aromatic alcohol compound, 10 μg glycosyltransferase and 0.08 μM glycosyl donor, buffer is added to 150 μL, and the reaction system is scaled up proportionally.

[0058] According to another preferred embodiment of the present invention, the reaction system, in 150 μL, contains 0.04 μM aromatic alcohol compound, 20 μg glycosyltransferase and 0.08 μM glycosyl donor, buffer is added to 150 μL, and the reaction system is scaled up proportionally.

[0059] In some embodiments, the reaction system, in 75 mL, contains 0.01–0.15 mM aromatic alcohols, 3–50 mg glycosyltransferase, and 0.05–0.20 mM glycosyl donor, with buffer added to 75 mL, and the reaction system scaled up proportionally.

[0060] According to a preferred embodiment of the present invention, the reaction system, in 75 mL, contains 0.06 mM aromatic alcohol compound, 30 mg glycosyltransferase and 0.08 mM glycosyl donor, buffer is added to 75 mL, and the reaction system is scaled up proportionally.

[0061] This invention is carried out under conditions that enable the glycosylation reaction of aromatic alcohols, glycosyltransferases, and glycosyl donors. The reaction temperature can be 20–40°C, preferably 25–35°C, and more preferably 30°C. The reaction time can be 10–50 hours, preferably 11–48 hours, and more preferably 12 hours.

[0062] Unless otherwise mentioned, the buffer solutions used in the following examples consist of 50 mM Tris-HCl, 1 mM DTT, 1.5 vol% glycerol, and 100 mM NaCl.

[0063] Example 1: Obtaining the gene encoding the glycosyltransferase CtGT-B

[0064] Fresh fleshy stems of *Cistanche tubulosa* were selected, and total RNA was extracted using a liquid nitrogen quick-freezing and grinding method and an Omega plant RNA extraction kit. 5′-RACE-cDNA, 3′-RACE-cDNA, and total cDNA were obtained by reverse transcription using a ClonTechSMARTer RACE 5′ / 3′ Kit.

[0065] The 5′ and 3′ sequences of the CtGT-B gene were cloned using Clontech SMARTer. TM The RACE cDNA Amplification Kit uses 5′ / 3′-RACE-cDNA obtained by RACE reverse transcription as a template. The 3′-RACE amplification primers use the adenine (A) at position 13 of SEQ ID NO:6 to deamino the sequence formed by hypoxanthine (I). The 5′-RACE amplification primers use SEQ ID NO:7.

[0066] The PCR reaction program was as follows: pre-denaturation at 94℃ for 2 min, followed by denaturation at 94℃ for 15 s; initial annealing at 65℃ for 30 s, decreasing by 0.5℃ per cycle, extension at 68℃ for 50 s, for a total of 30 cycles; followed by denaturation at 94℃ for 15 s, annealing at 54℃ for 30 s, extension at 68℃ for 50 s, for a total of 25 cycles; and finally extension at 72℃ for 1 min.

[0067] The 5′RACE and 3′RACE sequences obtained from sequencing were spliced ​​to obtain the full-length cDNA sequence. The open reading frames (ORFs) of the gene were analyzed using NCBI Open Reading Frame (ORF) Finder, and a pair of specific primers with restriction enzyme sites were designed, as shown in SEQ ID NO:8 and SEQ ID NO:9. SEQ ID NO:8 introduced the BamHI restriction site through primer design, and SEQ ID NO:9 introduced the NotI restriction site through primer design. The full-length coding region of approximately 1449 bp was amplified using the specific primers SEQ ID NO:8 and SEQ ID NO:9, as shown in SEQ ID NO:2. The encoding amino acid sequence is shown in SEQ ID NO:1. Agarose gel electrophoresis is shown in the attached image. Figure 2 As shown.

[0068] SEQ ID NO:1 was analyzed using Expasy to predict the physicochemical properties of the protein. The results showed that its molecular weight was 53.89 kDa; its theoretical isoelectric point was 5.39, indicating that it is an acidic protein; its instability index was 45.73, indicating that the protein may be unstable; and its Grand average of hydrophobicity (GRAVY) was -0.145, indicating that it is a hydrophilic protein composed of 482 amino acids.

[0069] Example 2: Construction and prokaryotic expression of the CtGT-B glycosyltransferase gene prokaryotic expression vector

[0070] The gene fragment amplified in Example 1 was recovered via gel extraction. The gel extraction product was double-digested with BamHI and NotI, and then digested with Takara restriction endonuclease at 37°C for 2–3 h. The digested fragment was then recovered via gel extraction and ligated to the pET-28a expression vector, which had been double-digested using the same method, via T4 ligation. The target gene was ligated into pET28a using NEB T4 DNA Ligase. The ligation product was transformed into competent cells, and E. coli BL21(DE3) was selected as the expression strain. Positive clones were screened by colony PCR. The correctly sequenced strains were inoculated into LB liquid medium containing 50 μg / mL Kana and 50 μg / mL Chl and cultured at 37°C and 200 rpm in a constant temperature shaker until the OD600 value of the bacterial culture reached 0.6. IPTG was added to a final concentration of 0.15 mM and cultured at 23°C and 180 rpm for 20 h to induce the expression of the target protein.

[0071] CtGT-B protein expression was purified using a nickel ion affinity chromatography column (Ni Sepharose 6Fast Flow, GE Healthcare). The purification results are as follows: Figure 3 As shown, the target protein size is 50–55 kDa, consistent with its theoretical size of 53.89 kDa. A large amount of the target protein was eluted at a concentration of 160–250 mM imidazole to obtain a single band. The target protein fractions were combined and concentrated in the PD-10 column. The protein expression level was determined using the Bradford method with the Transgene Easy Protein Quantitative Kit. The protein expression level was 6.0 mg / L of bacterial cells.

[0072] Example 3: Optimized codon sequence CtGT-Bopt and truncated sequence CtGT-Bopt- of glycosyltransferase CtGT-B 12aa prokaryotic expression

[0073] The CtGT-Bopt gene sequence (SEQ ID NO:3) is an optimized sequence based on the CtGT-B nucleotide sequence using E. coli codon preference. Its encoded amino acid sequence is identical to that of the CtGT-B protein. The construction of the expression vector and the prokaryotic expression procedure are the same as in Example 2. Protein expression levels were determined using the Bradford method with the Transgene Easy Protein Quantitative Kit. The protein expression level was 10.0 mg / L of bacterial cells.

[0074] The amplification of the truncated sequence CtGT-Bopt-12aa was performed using the CtGT-Bopt gene as a template. The construction of the truncated mutant CtGT-Bopt-12aa-Y159V was carried out using the Transgene Mutagenesis Kit, with primer sequences as shown in SEQ ID NO:10,11.

[0075] The results of protein expression and purification of the truncated mutant CtGT-Bopt-12aa-Y159V are attached. Figure 4 As shown, its protein size is 52.6 kDa, and its protein expression level is significantly higher than that of CtGT-B protein, reaching 13 mg / L of bacterial cells. Protein concentration was determined using the Bradford method with the Transgene Easy Protein Quantitative Kit.

[0076] Example 4: Glycosyltransferase CtGT-B catalyzes the side-chain alcohol hydroxyl groups using tyrosol as the acceptor and UDP-glucose as the donor. Glycosylation reaction generates rhodioloside

[0077] Enzymatic reactions were performed on CtGT-B protein purified by nickel ion affinity chromatography. The reaction system consisted of 10 μg CtGT-B protein, 0.08 μM UDP-glucose, and 0.04 μM tyrosol; buffer was added to a final volume of 150 μL. The mixture was gently stirred and incubated in a 30°C water bath for 12 h. The reaction was terminated by adding 300 μL of methanol. The precipitate was removed by centrifugation at 12000 × g, and the supernatant was evaporated to dryness under reduced pressure. The residue was dissolved in 150 μL of methanol, filtered through a 0.2 μm filter, and then analyzed by HPLC-HR-MS.

[0078] The Agilent 1260 liquid chromatography detection conditions were as follows: column: SHESHIDO CAPCELLPAK MG-III COLUMN (4.6 mm l.D. × 250 mm, 5 μm), flow rate: 1.0 mL / min, DAD detector for full wavelength scanning, and mobile phase: acetonitrile-0.1% formic acid aqueous gradient elution: 0–10 min, 5%–20% acetonitrile; 10–15 min, 20%–25% acetonitrile; 15–25 min, 25%–35% acetonitrile; 25–30 min, 35%–95% acetonitrile; 30–35 min, 100% acetonitrile. Mass spectrometry conditions were as follows: LCMS-IT-TOF (Shimadzu, Japan) detection, positive and negative ion modes; nebulizing gas: N2, flow rate: 1.5 mL / min; drying gas: N2, pressure: 100 MPa; detector voltage: 1.40 kV; curve desolvation tube (CDL) pressure: normal mode; CDL temperature: 200 °C; block heater temperature: 200 °C; interface voltage: 1.40 kV; ion trap vacuum: 1.9 × 10⁻⁶. - 2 High-purity argon was used as both the cooling gas and the collision gas for collision-induced dissociation (CID). The mass spectrometer was set to automatic multi-stage MS. 1 MS 2 MS 3 Full scan mode; ion accumulation time set to 100 ms; CID collision energy set to 50%; data processing used LC solution Version 1.1 software (Shimadzu). HPLC-HR-MS detection data are attached. Figure 5A As shown.

[0079] Example 5: Comparison of catalytic efficiency between glycosyltransferases CtGT-Bopt and CtGT-Bopt-12aa

[0080] Enzymatic reaction experiments were conducted on CtGT-Bopt protein purified by nickel ion affinity chromatography and CtGT-Bopt-12aa protein with 12 amino acids truncated at the N-terminus.

[0081] The CtGT-Bopt protease reaction system consisted of 20 μg CtGT-Bopt protein, 0.08 μM UDP-glucose, and 0.04 μM tyrosol; buffer was added to a final volume of 150 μL. The reaction was incubated at 30°C for 12 h, and then 300 μL of methanol was added to terminate the reaction. The precipitate was removed by centrifugation at 12000 × g, and the supernatant was evaporated under reduced pressure. The residue was dissolved in 150 μL of methanol, filtered through a 0.2 μm filter, and then used for HPLC-HR-MS analysis. The HPLC-HR-MS analysis conditions were the same as in Example 4. The HPLC-HR-MS detection data are attached. Figure 6A As shown, the conversion rate of rhodioloside was 62.85%.

[0082] The CtGT-Bopt-12aa protease reaction system consisted of 20 μg CtGT-Bopt-12aa protein, 0.08 μM UDP-glucose, and 0.04 μM tyrosol; buffer was added to a final volume of 150 μL. The reaction was incubated at 30°C for 12 h, and then 300 μL of methanol was added to terminate the reaction. The precipitate was removed by centrifugation at 12000 × g, and the supernatant was evaporated under reduced pressure. The residue was dissolved in 150 μL of methanol, filtered through a 0.2 μm filter, and then used for HPLC-HR-MS analysis. The HPLC-HR-MS analysis conditions were the same as in Example 4. The HPLC-HR-MS detection data are attached. Figure 6B As shown, the conversion rate of rhodioloside was 89.19%.

[0083] The above results indicate that the catalytic activity and catalytic reaction type of the CtGT-Bopt-12aa protein are the same as those of the CtGT-Bopt protein, but the catalytic efficiency is significantly improved compared to the CtGT-Bopt protein.

[0084] Example 6a-6c CtGT-Bopt-12aa-Y159V protein accepts different glycosyl donors to catalyze 1-naphthylethanol

[0085] The enzyme reaction system consisted of 20 μg protein, 0.08 μM glycosyl donor, and 0.04 μM 1-naphthylethanol; buffer was added to a final volume of 150 μL. The reaction was carried out in a 30°C water bath for 12 h, and then 300 μL of methanol was added to terminate the reaction. The precipitate was removed by centrifugation at 12000 × g, and the supernatant was evaporated under reduced pressure. The residue was dissolved in 150 μL of methanol, filtered through a 0.2 μm filter, and analyzed by HPLC-HR-MS. The HPLC-HR-MS analysis conditions were the same as in Example 4. The protein and glycosyl donors in Examples 6a-6c are shown in Table 1. The HPLC-HR-MS analysis results are shown in Figure 7.

[0086] Table 1

[0087] Serial Number protein Glycosyl donor 6a CtGT-Bopt-12aa-Y159V UDP-glucose 6b CtGT-Bopt-12aa-Y159V UDP-N-acetylglucosamine 6c CtGT-Bopt-12aa-Y159V UDP-galactose

[0088] Example 7: Different catalytic effects of glycosyltransferases CtGT-B / CtGT-Bopt and the mutant CtGT-Bopt-12aa-Y159V Structural aromatic alcohol glycosyl receptors

[0089] The reaction system consisted of 0.06 mM glycosyl acceptor (dissolved in DMSO), 0.08 mM UDP-glucose, and 30 mg protein; reaction buffer (50 mM Tris-HCl, 1 mM DTT, 1.5% glycerol, 100 mM NaCl) was added to a final volume of 75 mL. The reaction was carried out at 30 °C for 12 hours. The reaction solution was filtered through a 0.45 μm filter membrane, and the filtrate was loaded onto an MCI GELCHP series resin (1 cm × 15 cm) at a flow rate of <1 mL / min. Impurities were eluted with 20 column volumes of water, followed by a gradient elution with 10 column volumes of 20%, 40%, 60%, and 80% methanol-water solutions. Finally, the column was flushed with 100% methanol. Samples of each fraction were analyzed by HPLC. The target product fractions were combined, the solvent was evaporated under reduced pressure, and the residue was dissolved in methanol and filtered through a 0.45 μm filter membrane. The product was further purified and enriched using a Shimadzu preparative liquid chromatography (HPLC) system. A preparative column, YMC-PackODS-AHPLC column (10 mm l.D. × 250 mm, S-5 μm, 12 nm), was used. The elution system employed an acetonitrile-water gradient elution: 0–5 min, 5%–15% acetonitrile; 5–10 min, 15% acetonitrile; 10–15 min, 15%–18% acetonitrile; 15–30 min, 18%–20% acetonitrile; 30–35 min, 20%–75% acetonitrile; 35–40 min, 90%–100% acetonitrile. Manual injection was used at a flow rate of 3 mL / min. The prepared product was structurally identified using a Varian 500 nuclear magnetic resonance (NMR) system. Figures 8A-9B Glycosyl receptors and proteins are shown in Table 2.

[0090] Table 2

[0091]

[0092]

[0093]

[0094] This invention is not limited to the above-described embodiments. Any modifications, improvements, or substitutions that can be conceived by those skilled in the art without departing from the essential content of this invention fall within the scope of this invention. sequence list <110> Beijing University of Chinese Medicine <120> Glycosyltransferases, genes, vectors, host cells, and glycosylation methods <160> 11 <170> SIPOSequenceListing 1.0 <210> 1 <211> 482 <212> PRT <213> Cistanche tubulosa <400> 1 Met Gly Ser Leu Thr Lys Ile Ala Ala Thr Asn Glu Lys Pro His Ala 1 5 10 15 Val Cys Ile Pro Tyr Pro Ala Gln Gly His Ile Asn Pro Met Leu Lys 20 25 30 Leu Ala Lys Ile Leu His Ser Arg Gly Phe His Ile Thr Phe Val Asn 35 40 45 Thr Glu Tyr Asn His Asn Arg Leu Leu Arg Ser Arg Gly Pro Gly Ala 50 55 60 Leu Gln Gly Leu Pro Ser Phe Arg Phe Glu Thr Ile Thr Asp Gly Leu 65 70 75 80 Pro Pro Thr Asp Ala Asp Ala Thr Gln Ser Ile Pro Glu Leu Cys Arg 85 90 95 Ser Thr Glu Leu His Ser Leu Gly Pro Phe Arg Asp Leu Leu Arg Arg 100 105 110 Leu Asn Asp Ser Gly Val Val Pro Pro Val Ser Cys Ile Val Ser Asp 115 120 125 Ser Ala Met Phe Phe Thr Leu Asp Ala Ala Glu Glu Leu Gly Val Pro 130 135 140 Glu Val Leu Leu Trp Thr Ala Ser Ala Cys Gly Phe Leu Gly Tyr Thr 145 150 155 160 Gln Tyr Asp Gln Leu Val Glu Leu Gly Leu Thr Pro Phe Lys Asp Thr 165 170 175 Asn Phe Leu Thr Asn Gly Asp Leu Asp Lys Val Leu Asp Trp Val Pro 180 185 190 Ala Met Lys Gly Ile Arg Leu Arg Asp Ile Pro Ser Phe Ile Arg Thr 195 200 205 Thr Asp Pro Asp Glu Phe Met Val Lys Tyr Val Arg Arg Leu Val Tyr 210 215 220 Gln Ser Lys Arg Ala Ser Ala Ile Leu Phe Asn Thr Phe Asp Ala Leu 225 230 235 240 Glu Gly Asp Val Leu Gln Ser Leu Ser Ser Asn Phe Pro Arg Val Tyr 245 250 255 Ser Leu Gly Pro Leu Gln Leu Leu Leu Asp Pro Ile Asp Lys Glu Thr 260 265 270 Lys Ser Ile Gly Ser Asn Leu Trp Lys Glu Asp Gln His Cys Ile Asp 275 280 285 Trp Leu Asp Ser His Gly Pro Asn Ser Val Val Tyr Val Asn Phe Gly 290 295 300 Ser Ile Thr Val Met Ser Asn Asp Gln Leu Val Glu Phe Ala Trp Gly 305 310 315 320 Leu Ala Asn Ser Gly Arg Pro Phe Leu Trp Ile Ala Arg Pro Asp Leu 325 330 335 Val Ile Gly Asp Ser Ala Val Leu Pro Pro Glu Phe Leu Glu Glu Thr 340 345 350 Arg Ser Arg Gly Leu Ile Ala Ser Trp Cys Asp Gln Glu Arg Ile Leu 355 360 365 Ala His Pro Ala Ile Gly Gly Phe Leu Thr His Cys Gly Trp Asn Ser 370 375 380 Ile Val Glu Ser Ile Cys Asn Gly Val Pro Val Val Cys Trp Pro Phe 385 390 395 400 Phe Ala Glu Gln Gln Thr Asn Cys Trp Tyr Ser Cys Thr Lys Trp Gly 405 410 415 Ile Gly Met Glu Ile Asp Pro Asn Val Lys Arg Glu Val Val Glu Arg 420 425 430 Gln Val Arg Glu Leu Met Leu Gly Glu Glu Gly Lys Glu Met Lys Arg 435 440 445 Lys Ala Met Glu Trp Lys Ala Leu Ala Gln Glu Ala Thr Thr Ser Ser 450 455 460 His Gly Ser Ser Tyr Ser Asn Met Asp Asn Leu Met Thr Arg Val Leu 465 470 475 480 Ser Pro <210> 2 <211> 1449 <212> DNA / RNA <213> Cistanche tubulosa <400> 2 atgggttctt tgacaaagat agcagccaca aatgaaaaac cacatgcggt gtgtatccca 60 tacccagcac agggccacat aaaccccatg ctgaaactag ccaaaatcct ccattctcga 120 ggcttccata tcacctttgt aaacactgag tataatcaca accgtttgct gcggtctcgg 180 ggtcctggtg ctctccaagg cctccccagt ttccgtttcg agacgattac cgatggtctc 240 ccccctactg acgctgatgc cacccagagt atccctgagc tttgtcgctc caccgagctt 300 cactctctcg gtcccttccg tgacctcctt aggcgtctca atgacagcgg tgttgtgccc 360 cctgtgagct gcatcgtgtc cgattcggcc atgtttttca cccttgatgc tgctgaggag 420 cttggagtcc ctgaagtcct gctttggact gctagcgcct gtggtttctt gggttatact 480 cagatatgatc agcttgttga gttggggctt actcccttca aagatacaaa cttcctcaca 540 aacggtgatc tagacaaggt cttggattgg gttccggcta tgaagggcat ccggttgagg 600 gacatcccaa gcttcataag aaccactgac cctgacgagt ttatggttaa atatgttcga 660 cgactggttt accaatccaa gcgggcatcg gccatccttt tcaacacatt tgatgctttg 720 gagggcgacg ttctccaatc cctttcctcc aatttcccac gtgtctactc cctcggtcca 780 ctgcagttgc tgcttgaccc catcgacaag gagaccaaat caatcggatc gaatctttgg 840 aaagaggacc aacattgcat tgactggctt gattctcatg gccccaactc cgttgtgtat 900 gtcaatttcg ggagtattac agtcatgtct aatgatcagc tcgtggaatt tgcttgggga 960 ctcgctaata gcgggcgacc cttcctatgg atcgctcgac ctgatttggt gattggggat 1020 tctgcagtgc tcccacccga attcttggag gagaccagaa gcagaggact cattgctagc 1080 tggtgtgacc aggagcggat tttggcccac ccggcaatcg ggggattctt gacgcattgt 1140 gggtggaatt caatagtaga aagcatctgt aatggagtgc cagtggtatg ctggcctttc 1200 ttcgcggagc aacagaccaa ttgttggtat tcttgcacca agtgggggat tggtatggag 1260 attgatccca acgtgaagag ggaagtggtt gagaggcagg tgagggagct gatgttggga 1320 gaagaaggca aagagatgaa gagaaaggca atggagtgga aagccttggc tcaagaggcc 1380 accacttctt ctcatggctc ttcttactcc aacatggata atctcatgac cagagtactt 1440 agtccctaa 1497 <210> 3 <211> 1449 <212> DNA / RNA <213> Artificial sequence <400> 3 atgggtagcc tgaccaaaat tgcagcaacc aatgaaaaac cgcatgcagt ttgtattccg 60 tatccggcac agggtcatat taatccgatg ctgaaactgg caaaaattct gcatagccgt 120 ggttttcata tcacctttgt taacaccgag tataaccata atcgtctgct gcgtagtcgt 180 ggtccgggtg cactgcaggg tctgccgagc tttcgttttg aaaccattac cgatggtctg 240 cctccgaccg atgcagatgc aacccagagc attccggaac tgtgtcgtag caccgaactg 300 catagtctgg gtccgtttcg tgacctgctg cgtcgtctga atgatagcgg tgttgttccg 360 cctgttagct gtattgttag cgatagcgca atgtttttta ccctggatgc agccgaagaa 420 ctgggtgttc cggaagttct gctgtggacc gcaagcgcat gtggttttct gggttatacc 480 cagtatgatc agctggttga actgggtctg accccgttta aagataccaa ttttctgacc 540 aatggcgacc tggataaagt tctggattgg gttccggcaa tgaaaggtat tcgtctgcgt 600 gatattccga gctttattcg taccaccgat ccggatgaat ttatggttaa atatgttcgt 660 cgtctggtgt atcagagcaa acgtgcaagc gcaattctgt ttaatacctt tgatgcactg 720 gaaggtgatg ttctgcagag cctgagcagc aattttccgc gtgtttattc actgggtccg 780 ctgcagctgc tgctggaccc gattgataaa gaaaccaaaa gcattggtag caacctgtgg 840 aaagaagatc agcattgtat tgattggctg gatagtcatg gtccgaatag cgttgtttat 900 gtgaattttg gtagcatcac cgtgatgagc aatgatcaac tggtggaatt tgcatggggt 960 ctggcaaata gcggtcgtcc gtttctgtgg attgcacgtc cggatctggt tattggtgat 1020 agcgcagttc tgccaccgga atttctggaa gaaacccgtt cacgtggtct gattgcaagc 1080 tggtgtgatc aagaacgtat tctggcacat ccggcaattg gtggctttct gacccattgt 1140 ggttggaata gcattgttga aagcatttgt aatggtgtgc cggttgtttg ttggccgttt 1200 tttgcagaac agcagaccaa ttgttggtat agctgcacca aatggggtat tggtatggaa 1260 attgatccga atgttaaacg cgaagttgtt gaacgtcagg ttcgtgaact gatgctgggt 1320 gaagagggta aagaaatgaa acgtaaagca atggaatgga aagcactggc acaagaagca 1380 accaccagtt cacatggtag cagctattca aatatggata atctgatgac ccgtgttctg 1440 agcccgtaa 1497 <210> 4 <211> 470 <212> PRT <213> Artificial sequence <400> 4 Lys Pro His Ala Val Cys Ile Pro Tyr Pro Ala Gln Gly His Ile Asn 1 5 10 15 Pro Met Leu Lys Leu Ala Lys Ile Leu His Ser Arg Gly Phe His Ile 20 25 30 Thr Phe Val Asn Thr Glu Tyr Asn His Asn Arg Leu Leu Arg Ser Arg 35 40 45 Gly Pro Gly Ala Leu Gln Gly Leu Pro Ser Phe Arg Phe Glu Thr Ile 50 55 60 Thr Asp Gly Leu Pro Pro Thr Asp Ala Asp Ala Thr Gln Ser Ile Pro 65 70 75 80 Glu Leu Cys Arg Ser Thr Glu Leu His Ser Leu Gly Pro Phe Arg Asp 85 90 95 Leu Leu Arg Arg Leu Asn Asp Ser Gly Val Val Pro Pro Val Ser Cys 100 105 110 Ile Val Ser Asp Ser Ala Met Phe Phe Thr Leu Asp Ala Ala Glu Glu 115 120 125 Leu Gly Val Pro Glu Val Leu Leu Trp Thr Ala Ser Ala Cys Gly Phe 130 135 140 Leu Gly Tyr Thr Gln Tyr Asp Gln Leu Val Glu Leu Gly Leu Thr Pro 145 150 155 160 Phe Lys Asp Thr Asn Phe Leu Thr Asn Gly Asp Leu Asp Lys Val Leu 165 170 175 Asp Trp Val Pro Ala Met Lys Gly Ile Arg Leu Arg Asp Ile Pro Ser 180 185 190 Phe Ile Arg Thr Thr Asp Pro Asp Glu Phe Met Val Lys Tyr Val Arg 195 200 205 Arg Leu Val Tyr Gln Ser Lys Arg Ala Ser Ala Ile Leu Phe Asn Thr 210 215 220 Phe Asp Ala Leu Glu Gly Asp Val Leu Gln Ser Leu Ser Ser Asn Phe 225 230 235 240 Pro Arg Val Tyr Ser Leu Gly Pro Leu Gln Leu Leu Leu Asp Pro Ile 245 250 255 Asp Lys Glu Thr Lys Ser Ile Gly Ser Asn Leu Trp Lys Glu Asp Gln 260 265 270 His Cys Ile Asp Trp Leu Asp Ser His Gly Pro Asn Ser Val Val Tyr 275 280 285 Val Asn Phe Gly Ser Ile Thr Val Met Ser Asn Asp Gln Leu Val Glu 290 295 300 Phe Ala Trp Gly Leu Ala Asn Ser Gly Arg Pro Phe Leu Trp Ile Ala 305 310 315 320 Arg Pro Asp Leu Val Ile Gly Asp Ser Ala Val Leu Pro Pro Glu Phe 325 330 335 Leu Glu Glu Thr Arg Ser Arg Gly Leu Ile Ala Ser Trp Cys Asp Gln 340 345 350 Glu Arg Ile Leu Ala His Pro Ala Ile Gly Gly Phe Leu Thr His Cys 355 360 365 Gly Trp Asn Ser Ile Val Glu Ser Ile Cys Asn Gly Val Pro Val Val 370 375 380 Cys Trp Pro Phe Phe Ala Glu Gln Gln Thr Asn Cys Trp Tyr Ser Cys 385 390 395 400 Thr Lys Trp Gly Ile Gly Met Glu Ile Asp Pro Asn Val Lys Arg Glu 405 410 415 Val Val Glu Arg Gln Val Arg Glu Leu Met Leu Gly Glu Glu Gly Lys 420 425 430 Glu Met Lys Arg Lys Ala Met Glu Trp Lys Ala Leu Ala Gln Glu Ala 435 440 445 Thr Thr Ser Ser His Gly Ser Ser Tyr Ser Asn Met Asp Asn Leu Met 450 455 460 Thr Arg Val Leu Ser Pro 465 470 <210> 5 <211> 470 <212> PRT <213> Artifical sequence <400> 5 Lys Pro His Ala Val Cys Ile Pro Tyr Pro Ala Gln Gly His Ile Asn 1 5 10 15 Pro Met Leu Lys Leu Ala Lys Ile Leu His Ser Arg Gly Phe His Ile 20 25 30 Thr Phe Val Asn Thr Glu Tyr Asn His Asn Arg Leu Leu Arg Ser Arg 35 40 45 Gly Pro Gly Ala Leu Gln Gly Leu Pro Ser Phe Arg Phe Glu Thr Ile 50 55 60 Thr Asp Gly Leu Pro Pro Thr Asp Ala Asp Ala Thr Gln Ser Ile Pro 65 70 75 80 Glu Leu Cys Arg Ser Thr Glu Leu His Ser Leu Gly Pro Phe Arg Asp 85 90 95 Leu Leu Arg Arg Leu Asn Asp Ser Gly Val Val Pro Pro Val Ser Cys 100 105 110 Ile Val Ser Asp Ser Ala Met Phe Phe Thr Leu Asp Ala Ala Glu Glu 115 120 125 Leu Gly Val Pro Glu Val Leu Leu Trp Thr Ala Ser Ala Cys Gly Phe 130 135 140 Leu Gly Val Thr Gln Tyr Asp Gln Leu Val Glu Leu Gly Leu Thr Pro 145 150 155 160 Phe Lys Asp Thr Asn Phe Leu Thr Asn Gly Asp Leu Asp Lys Val Leu 165 170 175 Asp Trp Val Pro Ala Met Lys Gly Ile Arg Leu Arg Asp Ile Pro Ser 180 185 190 Phe Ile Arg Thr Thr Asp Pro Asp Glu Phe Met Val Lys Tyr Val Arg 195 200 205 Arg Leu Val Tyr Gln Ser Lys Arg Ala Ser Ala Ile Leu Phe Asn Thr 210 215 220 Phe Asp Ala Leu Glu Gly Asp Val Leu Gln Ser Leu Ser Ser Asn Phe 225 230 235 240 Pro Arg Val Tyr Ser Leu Gly Pro Leu Gln Leu Leu Leu Asp Pro Ile 245 250 255 Asp Lys Glu Thr Lys Ser Ile Gly Ser Asn Leu Trp Lys Glu Asp Gln 260 265 270 His Cys Ile Asp Trp Leu Asp Ser His Gly Pro Asn Ser Val Val Tyr 275 280 285 Val Asn Phe Gly Ser Ile Thr Val Met Ser Asn Asp Gln Leu Val Glu 290 295 300 Phe Ala Trp Gly Leu Ala Asn Ser Gly Arg Pro Phe Leu Trp Ile Ala 305 310 315 320 Arg Pro Asp Leu Val Ile Gly Asp Ser Ala Val Leu Pro Pro Glu Phe 325 330 335 Leu Glu Glu Thr Arg Ser Arg Gly Leu Ile Ala Ser Trp Cys Asp Gln 340 345 350 Glu Arg Ile Leu Ala His Pro Ala Ile Gly Gly Phe Leu Thr His Cys 355 360 365 Gly Trp Asn Ser Ile Val Glu Ser Ile Cys Asn Gly Val Pro Val Val 370 375 380 Cys Trp Pro Phe Phe Ala Glu Gln Gln Thr Asn Cys Trp Tyr Ser Cys 385 390 395 400 Thr Lys Trp Gly Ile Gly Met Glu Ile Asp Pro Asn Val Lys Arg Glu 405 410 415 Val Val Glu Arg Gln Val Arg Glu Leu Met Leu Gly Glu Glu Gly Lys 420 425 430 Glu Met Lys Arg Lys Ala Met Glu Trp Lys Ala Leu Ala Gln Glu Ala 435 440 445 Thr Thr Ser Ser His Gly Ser Ser Tyr Ser Asn Met Asp Asn Leu Met 450 455 460 Thr Arg Val Leu Ser Pro 465 470 <210> 6 <211> 21 <212> DNA / RNA <213> Artificial sequence <400> 6 gacycattgy ggatggaayt c 21 <210> 7 <211> 28 <212> DNA / RNA <213> Artificial sequence <400> 7 ggagtaagaa gagccatgcg aagaagtg 28 <210> 8 <211> 29 <212> DNA / RNA <213> Artificial sequence <400> 8 ggatccatgg gttctttgac aaagatagc 29 <210> 9 <211> 30 <212> DNA / RNA <213> Artificial sequence <400> 9 gcggccgcgg gactaagtac tctggtcatg 30 <210> 10 <211> 36 <212> DNA / RNA <213> Artificial sequence <400> 10 gcatgtggttttctgggtgt tacccagtatgatcag 36 <210> 11 <211> 36 <212> DNA / RNA <213> Artificial sequence <400> 11 aacacccaga aaaccacatg cgcttgcggtccacag 36

Claims

1. A glycosyltransferase, characterized in that, The amino acid sequence of the glycosyltransferase is as shown in SEQ ID NO:

1.

2. A glycosyltransferase, characterized in that, The amino acid sequence of the glycosyltransferase is as shown in SEQ ID NO: 4 or SEQ ID NO:

5.

3. A nucleotide sequence encoding the glycosyltransferase according to any one of claims 1 to 2.

4. The nucleotide sequence according to claim 3, wherein The amino acid sequence is as shown in SEQ ID NO: 1, and the nucleotide sequence is as shown in SEQ ID NO: 2 or SEQ ID NO:

3.

5. A recombinant expression vector, characterized in that, The recombinant expression vector contains the nucleotide sequence according to claim 3.

6. The recombinant expression vector according to claim 5, wherein, The expression vector used is pET-28a.

7. A recombinant host cell, characterized in that, The recombinant host cell contains the nucleotide sequence according to claim 3 or the recombinant expression vector according to claim 5.

8. The recombinant host cell according to claim 7, characterized in that, The recombinant host cell is a recombinant Escherichia coli cell.

9. A glycosylation method of an aromatic alcohol compound, characterized in that, It includes causing a glycosylation reaction to occur in a reaction system containing the glycosyltransferase according to any one of claims 1 to 2, an aromatic alcohol glycosyl acceptor, and a glycosyl donor; The glycosyl donor is selected from one or more of UDP-glucose, UDP-N-acetylglucosamine, or UDP-galactose; When the amino acid sequence of the glycosyltransferase is SEQ ID NO: 1 or SEQ ID NO: 4, the aromatic ring of the aromatic alcohol glycosyl acceptor is a benzene ring; When the amino acid sequence of the glycosyltransferase is SEQ ID NO: 5, the aromatic ring of the aromatic alcohol glycosyl acceptor is selected from one of benzene, biphenyl, benzylbenzene, 1,2,3,4-tetrahydronaphthalene, benzocyclopentane, acenaphthene, fluorene, anthracene, pyrene.

Images