A mutant human telomerase RNA gene and its use in the prevention and treatment of pan-cancers

Abstract

The present application discloses a mutant human telomerase RNA gene (hTERC), a nucleic acid construct and an expression vector comprising the mutant human telomerase RNA gene, and a mutant human telomerase RNA. The present application also relates to a pharmaceutical composition of the mutant human telomerase RNA gene, the nucleic acid construct, the expression vector and / or the mutant human telomerase RNA, and the use thereof in preventing or treating a tumor or delaying the progression of a tumor in a subject in need thereof.

Description

[0001] Cross-reference of related applications

[0002] This application cites the invention entitled "A Pan-Cancer Ultra-Early Screening Method" filed by the applicant on the same filing date, the entire contents of which are incorporated herein by reference. Technical Field

[0003] This invention relates to a mutated human telomerase RNA gene (hTERC), a recombinant construct and / or expression vector comprising the mutated human telomerase gene, and the corresponding mutated human telomerase RNA, and its application in the prevention or treatment of pan-cancer diseases. Background of the Invention

[0004] Most cancers are age-related diseases, resulting from genetic mutations in a small number of senescent cells in the body, which allow them to escape programmed apoptosis and abnormally re-divide, leading to abnormal proliferative diseases. This abnormal proliferation or cell carcinogenesis may also be a way for human cells to evade aging and apoptosis. Studies have found that senescent cells are even more capable of this (Nishiguchi, MA et al. 2018, Cell Reports, 24, 3383-3392), which can be attributed to a genetic and adaptive process in genomic evolution. Research has shown that as people age, the body gradually ages, which is reflected in the continuous shortening of telomere length at the ends of genomic DNA, exhibiting the role of a "biological clock" (Greider, CW, 1996, Annu Rev Biochem 65, 337-365; Muezzinler, A. et al., 2013, Ageing Res Rev 12: 509-519).

[0005] In-depth research has revealed that in aging organisms, only a portion of telomeres shorten, while the length of another portion remains relatively constant. Furthermore, this gradually shortening portion of telomeres is closely related to cellular senescence (Muezzinler, A. et al., 2013, AgeingRes Rev 12:509-519). Some non-aging normal cells in the body, such as germ cells and embryonic cells like stem cells, can extend telomeres through the catalytic action of telomerase, maintaining normal telomere length and enabling continuous cell division. However, somatic cells generally have almost no telomerase activity.

[0006] A large number of research data show that telomerase activity is abnormally increased in more than 90% of cancer cells, but the telomeres are significantly shorter than normal embryonic cells with telomerase activity, and even shorter than normal somatic cells without telomerase activity (Blasco, M. A., 2005, Nat. Rev. Genet. 6:611-622; Barthel, F. P. et al., 2017, Nat Genet 49:349-357), which may be due to the rapid reduction of telomere length caused by the malignant division of cancer cells. When the telomere of the cancer cell shortens to a certain key node and does not continue to shorten, it remains relatively constant, which is presumably because the efficiency of telomerase catalyzing telomere extension and the shortening rate accompanying malignant division have reached a balance point. However, this inference is not entirely reasonable, because the efficiency of telomerase catalyzing telomere extension is several times higher than the rate of cell division shortening. It has been reported that telomeres can regulate telomerase activity through telomere-binding proteins Pot1 and Tin2 (Lim, C. J. et al. 2017, Nat Commun 8:1075); during telomere damage and cell aging signaling, positive feedback signal regulation occurs between TRF2 and P53 (Fujita, K. et al. 2010, Nat Cell Biol, 12, 1205-1212); when the protein gene Pot1 and P53 are mutated, the cell will become cancerous (Pinzaru, A. M. et al 2016, Cell Rep, 15, 2170-2184). Another study also reveals that telomeres and telomerase work together to regulate cell division by strengthening and stabilizing the activity of P53 (Akbay, E. A., et al., 2013, Oncogene 32:2211-2219); in addition to catalyzing the extension of telomeres, telomerase also has a previously unknown non-canonical function, i.e., promoting the formation of a telomere protection complex containing hsp70-1 and apollo, which is essential for the continuous proliferation of telomerase-positive cancer cells (Perera, O. N. et al 2019, Sci. Adv. 5:eaav4409). These scientific arguments clearly illustrate the extremely close internal relationship between cell aging, carcinogenesis, and telomeres and telomerase, and in 2009, the Nobel Prize in Medicine or Physiology was awarded to three discoverers of telomeres and telomerase.

[0007] Based on the findings of extreme shortening of telomeres in cancer cells and abnormal elevation of telomerase, the inventors speculate that there may be a key contradictory unity between telomeres and telomerase in cancer cells. Once this contradictory unity is determined, and a new method and technology for breaking this contradictory unity are found, unprecedented innovative anticancer drugs will be developed, making it possible to prevent, treat, and even cure most cancers.

[0008] In the present application, the inventors surprisingly found that the telomere 3' end tail repeat sequence in cancer cells has undergone significant variation, leading to its malignant division. By using the corresponding mutant human telomerase RNA gene (hTERC) to "repair" the telomere at the 3' end of the telomere which has undergone significant defects, the growth of cancer cells can be effectively weakened, the development process of cancer cells can be delayed, and even the abnormally dividing cancer cells can be induced to undergo programmed cell apoptosis.

[0009] The present application thus provides compositions and methods that can be used to effectively inhibit the division of cancer cells, treat and cure and / or prevent cancer diseases, and delay the development process of cancer cells. SUMMARY

[0010] In one aspect, the present application relates to a mutant human telomerase RNA gene, wherein the base "A" (underlined) at position -54 in the template domain CR1 (5' -46 CTAACCCT A AC -56 3' of the wild-type human telomerase RNA gene (SEQ ID NO. 1) is mutated to "G" or to "C".

[0011] In another aspect, the present application relates to a nucleic acid recombination construct comprising the mutant human telomerase RNA gene, and eukaryotic gene expression elements operably linked thereto, including promoters, enhancers, terminators and / or insulators. The promoter can be a constitutive promoter, or a promoter with tissue or cell specificity, or an inducible promoter, including the human TK gene promoter, the human HPRT gene promoter, the human TERT gene promoter (hTERT promoter), or can be a cancer cell-specific promoter. Preferably, the promoter is the human TERT gene promoter.

[0012] In yet another aspect, the present application relates to an expression vector comprising the mutant human telomerase RNA gene in the vector backbone, and a promoter operably linked thereto. The selection of the promoter is as described above for the recombination construct. The vector can be a viral expression vector, such as a Retrovirus, an Adenovirus, an Adeno- associated virus (AAV), a Herpesvirus, etc., preferably a replication-defective viral vector, such as a novel chimpanzee replication-defective adenovirus vector with low human seroprevalence (Chimpanzee Adenovirus) or an Ad5 replication-defective adenovirus vector.

[0013] In yet another aspect, the present application relates to a mutated human telomerase RNA having the same ribonucleic acid sequence as the mutated human telomerase RNA gene is transcribed.

[0014] In a further aspect, the present application relates to a composition comprising the mutated human telomerase RNA gene, the nucleic acid construct, the expression vector and / or the mutated human telomerase RNA, and optionally a carrier.

[0015] The present application additionally relates to a pharmaceutical composition comprising the mutated human telomerase RNA gene, the nucleic acid construct and / or the expression vector, the mutated human telomerase RNA, and a pharmaceutically acceptable carrier and / or excipient.

[0016] The present application additionally relates to a method for preventing and / or treating, and / or delaying progression of a tumor in a subject in need thereof, comprising administering to said subject an effective amount of the mutated human telomerase RNA gene, the nucleic acid construct, the expression vector, the mutated human telomerase RNA and / or the pharmaceutical composition according to the present application.

[0017] The present application also relates to the use of the mutated human telomerase RNA gene, the nucleic acid construct, the expression vector, the mutated human telomerase RNA and / or the composition according to the present application for the manufacture of a medicament for preventing and / or treating, and / or delaying progression of a tumor.

[0018] Without being bound to a particular theory, it is postulated that the recombinant mutated human telomerase RNA gene, the nucleic acid construct or the expression vector according to the present application, upon being introduced into cancer cells having aberrant telomerase activity and cells having normal telomerase activity, will transcribe a mutated hTERC component, or that the mutated human telomerase RNA according to the present application, synthesized in vitro, upon being delivered into a cell, will bind to the hTERT protein in the cell to form a catalytically active telomerase, thereby repairing the genetic defective telomeres having the two bases TC and / or TG at the 3' end of the corresponding human chromosome telomere to a TT end, which in turn will be effectively elongated by the endogenous telomerase, reducing the aberrant expression of the telomerase via the Potl and Tin2 signaling pathways, and inducing PCD apoptosis in senescent cells, potentially cancerous cells or cancerous cells having shortened telomeres to the genetic defective region, reducing or eliminating the escape of cancerous cells. For embryonic cells and tissues that normally divide and proliferate in vivo, the above process has no effect on them, as the telomeres in them do not have genetic defects.

[0019] The mutant hTERC gene, nucleic acid construct, expression vector and / or mutant human telomerase RNA of the present application can be effectively used for preventing and treating pan-cancer, and has a plurality of unique advantages. They repair the genetic defect telomere of cancer cells, guide the cancer cells to start programmed apoptosis, and realize the apoptosis effect of "self-destruction" of cancer cells. The method of the present application completely abandons the drug research and development concept of "killing" cancer cells, greatly reduces the genetic variability escape of cancer cells under the action of existing drugs, and has no toxicity to embryonic cells and no side effects to tissues and organs, effectively breaking the bottleneck problems of drug resistance, easy recurrence, strong toxicity and large side effects of existing anti-cancer drugs. The recombinant mutant hTERC gene, nucleic acid construct and / or expression vector of the present application, or the in vitro synthesized mutant telomerase RNA has a dual effect of prevention and treatment, and is suitable for tumor patients with abnormal increase of telomerase, and can cover about 90% of cancer types. The mutant of human telomerase RNA gene, nucleic acid construct, expression vector, or in vitro synthesized human telomerase RNA, and composition of the present application can develop a pioneering targeted gene drug with the functions of preventing aging, preventing carcinogenesis, treating cancer and related hyperplastic diseases, and without toxicity and side effects. BRIEF DESCRIPTION OF DRAWINGS

[0020] Figures 1A-1F The test results of telomere 3' end terminal repeat sequences of cancer tissues, paracancer tissues and normal tissues of six different cancer patients of breast cancer, rectal cancer, colon cancer, liver cancer, lung cancer and gastric cancer respectively show that the proportion of 5' AGGGTT 3' of the telomere 3' end terminal repeat sequence of the cancer tissues is significantly lower than that of the paracancer tissues and normal tissues.

[0021] Figure 2 The figure shows the characteristics of the catalytic extension of the telomerase of HELA cells to the telomere. (The upper figure shows the changes of the 3' end repeat sequence after the catalytic extension of the 3' end two base differences of the leading oligonucleotide of the telomerase; the lower table shows the preference of the catalytically extended telomere repeat sequence, AGGGTT reaches 176.8, followed by TAGGGT 110.2, and TTAGGG 89.7. At the same time, it also shows that the preference of the 3' end two base binding site of the telomerase is TT>GT>GG.

[0022] Figure 3 The figure shows that the level of TC genetic defect telomere in the cells of a plurality of cancer patients and cancer cell strains is significantly higher than that of normal subjects (the upper figure shows the electrophoresis results of the PCR amplification products, and the lower figure shows the statistical results of the TC genetic defect telomere).

[0023] Figure 4 The figure shows a schematic diagram of the construction of the hTERC eukaryotic expression vector.

[0024] Figure 5Figure 1 shows a schematic diagram of the construction of the hTERC adenoviral shuttle vector carrying the hTERT promoter.

[0025] Figure 6 Figure 2 shows the expression of the hTERC wild-type eukaryotic expression recombinant in HeLa cells.

[0026] Figure 7 Figure 3 shows the effect of the mutated hTERC gene on the growth of the cancer cell line, HeLa cell line.

[0027] Figure 8 Figure 4 shows the apoptotic characteristics of HeLa cells observed by Hoechst 33342 staining.

[0028] Figure 9 Figure 5 shows the inhibitory effect of the mutated hTERC gene on the growth of human breast cancer solid tumors.

[0029] Figure 10 Figure 6 shows the inhibitory effect of the mutated hTERC gene on the telomerase in human breast cancer cells.

[0030] Figure 11 Figure 7 shows the apoptotic effect of the single base mutation of the hTERC gene on human breast cancer solid tumor cells observed by sectioning.

[0031] Figure 12 Figure 8 shows the programed apoptotic effect of the mutated hTERC gene on human breast cancer cells. DETAILED DESCRIPTION

[0032] Telomere structure and telomerase catalysis

[0033] Telomeres are DNA / protein complexes located at the ends of human chromosomes. The DNA portion is composed of (TTAGGG)n, where n is an integer from 1 to 10,000. nA simple repeat sequence of six bases, its 3' end forms an overhang hanging single strand. This 3' single strand end back inserts into the telomere double strand region, forming "T-loop" and "D-loop" structures, and binds to two types of telomere proteins respectively, including double-stranded binding proteins (TRF1, TRF2, RAP1) and single-stranded binding proteins (Tin2, TPP1, Pot1, Pot1b) (Griffith, J. D., et al., 1999, Cell 97: 503-514; Tian X. P. et al, 2010, Appl Biochem Biotechnol, 160: 1460-1472). This end structure can effectively prevent the degradation of the telomere end by endogenous nucleases, prevent the fusion between chromosomes, and maintain the genetic stability of chromosomes. It can be seen that the formation of "T-loop" and "D-loop" structures at the telomere end is very important. The key to the formation of this loop structure depends on the effectiveness and stability of the back insertion of the telomere 3' end single strand, in which the telomere 3' end repeat sequence composition plays a very important role. In theory, the telomere 3' end can form six different ending repeat sequences, i.e. 1) 5' TTAGGG 3'; 2) 5' GTTAGG 3'; 3) 5' GGTTAG 3'; 4) 5' GGGTTA 3'; 5) 5' AGGGTT 3'; 6) 5' TAGGGT 3', and different ending repeat sequences may have different effects on the formation and stability of the loop.

[0034] The telomere 3' end repeat sequence also plays a crucial role in the catalytic process of telomerase. Telomerase is composed of two parts, human telomerase protein subunit (hTERT) and telomerase RNA subunit (hTERC), and has a function similar to reverse transcriptase. When telomerase catalyzes the synthesis of telomeres, telomerase needs to pair and bind the template domain CR1 (5' CTAACCCTAAC 3', SEQ ID NO. 2) carried by hTERC itself with the 3' end repeat sequence of the telomere, and then continuously translocate, synthesize and extend the telomere. The telomere 3' end repeat sequence is not only the substrate (binding site) of telomerase, but also the product (telomere repeat sequence) of telomerase. The inventors believe that this not only shows that telomerase is a special reverse transcriptase, and the substrate and product of the catalytic reaction are completely consistent, and the binding site of CR1 and the telomere also determines the translocation efficiency of telomere synthesis, thereby affecting the extension efficiency (Xiaodong Qi et al., 2012, EMBO Journal, 31: 150-161). Further, the difference of the telomere 3' end repeat sequence may also imply that the extension rate and length of the telomere are not completely dependent on the telomerase itself, but also on the telomere 3' end repeat sequence.

[0035] The inventors used a method for detecting 3' telomere repeat sequences to examine 15 telomeres in the whole blood genomes of 17 normal individuals of different ages. The results showed a significant preference for 3' telomere repeat sequences, with 5'AGGGTT3' endings accounting for 26±7.7%, and gradually decreasing with age. Nucleic acid kinetic analysis also showed that the 5'AGGGTT3' ending repeat sequence was significantly superior to the other five ending sequences, further supporting the existence of a preference for 3' telomere repeat sequences in vivo. Although textbooks typically write human telomere repeat sequences as (TTAGGG). n However, a more accurate description would be (AGGGTT). n The inventors further conducted a simultaneous detection study on cancerous tissue, adjacent tissue, and normal tissue from patients with six different types of cancer—breast cancer, rectal cancer, colon cancer, liver cancer, lung cancer, and stomach cancer—under the same genetic background. The results showed... Figures 1A-1F The results show that the proportion of 5'AGGGTT3' in cancerous tissue is significantly lower than that in adjacent and normal tissues, less than 19.0% in early pathological stages and less than 15.4% in late stages, which is below the theoretical average of 16.7% for the six telomere endings. This decrease in cancerous tissue exhibits a clear linear relationship with pathological progression and is independent of cancer type, indicating that the decrease in the 5'AGGGTT3' telomere 3' terminal repeat sequence is a common phenomenon in cancer. This suggests that the 3' terminal repeat sequence of telomeres may be directly related to cellular carcinogenesis and warrants close attention.

[0036] The inventors combined the Trap method with the 3' terminal repeat sequence detection method to conduct an in-depth study on the efficiency and characteristics of telomerase in HELA cells catalyzing telomere synthesis in vitro, using six oligonucleotides differing by two bases at the end of the 3' terminal as leader sequences. Unexpectedly, they discovered that telomerase pairs with the two bases at the end of the 3' terminal of the telomere to form an effective binding site, synthesizing 6 bases per translocation. Different binding sites directly determine the translocation and synthesis efficiency of telomerase, thus affecting telomere elongation. The binding site efficiency, from highest to lowest, is TT > GT > GG. The catalyzed AGGGTT, TAGGGT, and TTAGGG repeat sequences reached 177, 110, and 89.7 relative units, respectively, significantly higher than other repeat sequences. Detailed results are shown in […]. Figure 2Meanwhile, the 5' AGGGTT 3' ending also preferred by the telomerase in vitro extension of the telomeres of HELA cells, accounting for 35.29%, which shows that the preference characteristics of cancer cell telomerase catalysis have not changed. According to the report of 10,000 cases of cancer patient big data research, there is no difference or mutation in the structural gene coding of cancer cell telomerase, and the mutation of cancer cell telomerase gene mainly occurs in the upstream promoter region of hTERT structural gene, and the promoter region presents irregular variation (Zehir, A., et al., 2017, Nat. Med. 23, 703-713). These all prove that the decrease of the proportion of 5' AGGGTT 3' at the 3' end of the telomere of the cancer cell is not related to the catalytic characteristics of the telomerase itself. Obviously, the reason for the decrease of the proportion of 5' AGGGTT 3' at the 3' end of the telomere of the cancer cell is likely to be the problem of the telomere 3' end repeat sequence itself, especially the last 2 bases. Because the last 2 bases at the 3' end not only relate to the formation and stability of the Loop, but also affect the normal catalysis of the telomerase, and are closely related to cell carcinogenesis, it is undoubtedly crucial.

[0037] According to the information of human whole genome database provided by NCBI (https: / / www.ncbi.nlm.nih.gov / ), the inventors analyzed the 27 telomeres that have been located in detail, including the X chromosome and the 8th chromosome whose whole chromosome structure has been completed (Miga, K. H., et al., 2020, Nature, 585: 79-84; Logsdon, G. A., et al., 2021, Nature, DOI 10.1038 / s41586-021-03420-7;). The inventors surprisingly found that among them, 18 telomeres exist (5' AGGGTC 3')n, (5' GGGTTC 3')n, (5' AGGGTG 3')n and / or (5' GGGTTG 3')n abnormal repeat sequences of n times in the region about 100-1000 bp away from the chromosome, which are accompanied by human genome inheritance. The genetic defective repeat sequences on each chromosome telomere are summarized in Table 1 below:

[0038] Table 1

[0039]

[0040] The inventors speculate that due to the DNA semi-conservative replication defect of cell division, the telomere DNA repeat sequence will be shortened by about 60-180 bp per cell division. After the cell has undergone several tens of divisions, the telomere(s) will be shortened to the region of the genetic defect, i.e., the telomere region containing (5' AGGGTC 3')n, (5' GGGTTG 3')n, (5' AGGGTG 3')n and / or (5' GGGTTG 3')n, and the telomere will end with the 2 bases TC or TG at the 3' end. In the present invention, the inventors define this type of telomere as TC or TG genetically defective telomere. Once this type of TC or TG genetically defective telomere occurs or exists, it will undoubtedly cause telomerase abnormality and a series of serious problems in the tissue or cell.

[0041] To further verify the existence of TC and TG genetically defective telomeres in cancer cells, the inventors detected TC genetically defective telomeres in the genomic DNA of peripheral blood from 16 cancer patients (including lung cancer, colorectal cancer, cervical cancer, ovarian cancer, gum cancer and cardia cancer) and 4 cancer cell lines (colon cancer, lung cancer, liver cancer and cervical cancer), and the results showed that all cancer patients and cancer cell lines had different amounts of TC genetically defective telomeres, while the controls (5 non-cancer patients and 1 normal liver cell line) had almost none. The results are shown in Figure 3 This result is completely consistent with expectations, and the inventors speculate that it occurs and exists universally in many cancer cells. Obviously, this important discovery clearly clarifies the extremely close internal relationship between cell aging, carcinogenesis and telomeres, telomerase, and the key issues that cancer cells always have abnormally high expression of telomerase and short telomeres.

[0042] Without being bound to a particular theory, the inventors speculate that with the increase of age, the telomeres of a portion of cells (e.g., epithelial cells) gradually shorten, the telomeres of certain key chromosomes shorten into the TC and TG genetic defect region, and TC or TG genetic defect telomeres appear. Due to the presence of such defective telomeres, the CR1 template of the telomere hTERC gene cannot normally pair with the two bases at the 3' end of such genetic defect telomeres, severely affecting the normal catalysis and catalytic efficiency of the telomerase. On the one hand, it disrupts the translocation control of the telomerase in the main mode of 5' AGGGTT 3', leading to disorder of the 3' end of the extended telomere, and interfering with the formation of the loop. On the other hand, due to the severe reduction of the catalytic efficiency of the telomerase, the length of the 3' overhang single strand of the synthesized telomere is limited, and a "telomerase deficiency" error signal is transmitted through the Pot1 and Tin2 proteins, triggering the restart of the telomerase gene and overexpression (Loayza, et al., 2003, Nature 423, 1013-1018). As a result of this abnormally high expression of telomerase, it not only achieves the limited extension of the telomere length to meet the minimum length requirement for continuous cell division, but also promotes the formation of the telomere protection complex containing hsp70-1 and apollo, driving the continuous division of cells, presenting the typical "contradictory" unified characteristics of cancer cells, which is the key to the contradiction and unity of the TC and TG genetic defect telomeres appearing and existing at the 3' end of the telomere. Therefore, the TC and TG genetic defect telomeres are the initial driving factor for the canceration of most cells and an important biomarker for the initial canceration of cells. As long as the methods, technologies and drugs that can repair or break the TC and TG genetic defect telomeres at the 3' end of the telomere can be found, the purpose of preventing, treating, and even curing most cancers can be achieved.

[0043] Mutated human telomerase RNA gene

[0044] The present application thus provides a mutated human telomerase RNA gene having a base mutation in the template domain CR1 (SEQ ID NO. 2) compared to the sequence of the corresponding wild-type human telomerase RNA component (hTERC) gene, so as to form a complementary sequence with the two bases at the 3' end of the genetic defect telomere of a cancer cell and repair the genetic defect telomere into a normal TT end. In one embodiment, the base "A" at position -54 in the mutated human telomerase RNA gene is mutated to "G" (SEQ ID NO. 15) or to "C" (SEQ ID NO. 16). Preferably, the polynucleotide has a single base mutation compared to the corresponding wild-type human telomerase RNA gene, referred to as a "single base mutant".

[0045] In the context of the present application, the wild-type hTERC gene refers to the gene encoding the RNA component of the telomerase in the human genome. The coding gene of the human telomerase RNA component (hTERC) can be easily cloned from the genomic DNA of the corresponding human blood or other tissue cells, for example by PCR cloning method, or genomic library screening method. The nucleotide sequence of the human telomerase RNA component gene has also been disclosed in the prior art, which is registered in the NCBI database as Gene ID: 7012, which is located in the human third chromosome NC_000003.12 (169764610bp~169765060bp), the full length of the hTERC gene is 451 bp without intron, and the nucleotide sequence is shown as SEQ ID NO. 1.

[0046] Therefore, in one embodiment, the present application relates to a mutated hTERC gene, which has a nucleotide sequence of SEQ ID NO. 1 corresponding to the wild-type hTERC gene, and the base "A" at position -54 (underlined) in the template domain CR1 (5'-CTAACCCTAAC-3') thereof is mutated to "G" or to "C". In yet another embodiment, the present application relates to a mutated hTERC gene, which has a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 99.5% sequence identity to the nucleotide sequence of SEQ ID NO. 1 corresponding to the wild-type hTERC gene, and the base "A" at position -54 (underlined) in the template domain CR1 (5'-CTAACCCTAAC-3') thereof is mutated to "G" or to "C". 46 CTAACCCT A AC -56 3') thereof is mutated to "G" or to "C". In yet another embodiment, the present application relates to a mutated hTERC gene, which has a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 99.5% sequence identity to the nucleotide sequence of SEQ ID NO. 1 corresponding to the wild-type hTERC gene, and the base "A" at position -54 (underlined) in the template domain CR1 (5'-CTAACCCTAAC-3') thereof is mutated to "G" or to "C". 46 CTAACCCTAAC -56 3') thereof is mutated to "G" or to "C". In yet another embodiment, the present application relates to a mutated hTERC gene, which has a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 99.5% sequence identity to the nucleotide sequence of SEQ ID NO. 1 corresponding to the wild-type hTERC gene, and the base "A" at position -54 (underlined) in the template domain CR1 (5'-CTAACCCTAAC-3') thereof is mutated to "G" or to "C".

[0047] Those skilled in the art know how to calculate the sequence identity between two nucleic acids. For example, the nucleotide sequences of the two nucleic acids can be aligned to obtain the maximum pairing, and the percentage of sequence identity between the two nucleic acids can be obtained by dividing the number of positions identical between the aligned sequences by the total number of positions and multiplying by 100%.

[0048] In the present application, sequence alignment, determination of the percentage of sequence identity and corresponding sequence positions can be performed according to some software known in the art, such as the BLAST program, CLUSTALW (http: / / www.ebi.ac.uk / clustalw / ), MULTALIN (http: / / prodes.toulouse.inra.fr / multalin / cgi-bin / multalin.pl) or MUSCLE (Multiple Sequence Alignment), with the default parameters indicated in these websites, to explore (e.g. align) the obtained sequences. As used herein, the term "identity", "homology" or "percentage of identity" when used in reference to a particular pair of aligned nucleotide sequences, refers to the percentage of nucleotide sequence identity obtained by counting the number of identical matches in the alignment, and dividing such number of identical matches by the length of the aligned sequences.

[0049] In the present application, the mutated hTERC gene can be amplified by a nucleic acid vector, recombined. Alternatively, the mutated hTERC gene of the present application can be amplified in vitro by PCR, site-directed single base mutation. In yet another embodiment, the mutated hTERC gene of the present application can be obtained by chemical synthesis.

[0050] Nucleic acid construct

[0051] The present application also relates to a nucleic acid construct comprising the mutated hTERC gene of the present application. In one embodiment, the mutated hTERC gene is operably linked to a promoter. In the present application, "operably" means that the components of the nucleic acid construct are linked in such a way that they are able to perform their respective biological functions, for example the promoter initiates transcription of the linked nucleic acid sequence. The promoter can be constitutive, or can be cell, tissue or organ specific. In another embodiment, the promoter can be inducible, initiating transcription of the linked nucleic acid sequence in response to an appropriate stimulus. Preferably, the nucleic acid construct further comprises other expression control elements such as enhancers, terminators and / or insulators. Various expression control elements suitable for use in the present application are well known to the person skilled in the art. By selecting the appropriate expression control elements, the expression, in particular the transcription, of the polynucleotide of the present application can be precisely regulated. Suitable for controlling the transcription / expression of the mutated human telomerase RNA gene of the present application in eukaryotic cells, for example mammalian cells, in particular human cells. Such inducible expression systems include, for example, regulation by ecdysone, estrogen, progesterone, tetracycline, dimerizing chemical inducers and isopropyl-β-D-thiogalactopyranoside (IPTG). The person skilled in the art will be able to select the appropriate regulatory element / promoter sequence as required.

[0052] Expression vector

[0053] The present application also relates to an expression vector, which in the present application can be a plasmid vector or a viral vector. Expression vectors compatible with eukaryotic cells, preferably those compatible with vertebrate cells, can be used to produce recombinant constructs for expressing the mutated hTERC gene as described herein. Eukaryotic cell expression vectors are well known in the art and are available from many commercial sources.

[0054] In one embodiment, the expression vector is a viral expression vector system. Preferably, the viral expression vector is selected from the group consisting of: (a) adenoviral vectors; (b) retroviral vectors, including but not limited to lentiviral vectors, Moloney murine leukemia virus, and the like; (c) adeno-associated viral vectors; (d) herpes simplex viral vectors; (e) SV40 vectors; (f) polyoma viral vectors; (g) papilloma viral vectors; (h) picornaviral vectors; (i) poxviral vectors, such as orthopoxviruses, e.g., vaccinia virus vectors, or avipox viruses, e.g., canarypox or fowlpox viruses; and (j) helper-dependent adenoviruses or gutless adenoviruses. The viral expression vector can also be a replication-defective virus. Those skilled in the art are aware of the structure, preparation, introduction, and expression of various expression vectors. The viral vectors can also be modified by pseudotyping with envelope proteins or other surface antigens from other viruses, or by substituting different viral capsid proteins, as appropriate, to modify the tropism of the virus. For example, lentiviral vectors can be pseudotyped with surface proteins from vesicular stomatitis virus (VSV), rabies virus, Ebola virus, Mokola, and the like. The vectors can be engineered to express different capsid protein serotypes, allowing the vectors to target different cells.

[0055] In the present application, the expression vector of the present application can be introduced into the target cell by a variety of methods, including, for example, infection, transfection, microinjection, microparticle bombardment, and the like. Once introduced into the cell, the expression vector of the present application can or can not integrate into the genome of the cell. Transcription of the polynucleotide of the present application in the target cell can be ensured by appropriate regulatory elements, such as promoters, enhancers, and the like.

[0056] Mutated human telomerase RNA

[0057] This invention also relates to a mutant human telomerase RNA having a nucleic acid sequence corresponding to the mutant hTERC gene of this invention described above. More specifically, the mutant human telomerase RNA of this invention has essentially the same ribonucleic acid as the transcription product of the mutant human telomerase RNA gene. The mutant human telomerase RNA of this invention can be obtained by in vitro transcription or direct chemical synthesis. Therefore, the mutant human telomerase RNA of this invention can be an RNA sequence “transcribed” from the mutant hTERC gene.

[0058] In one embodiment, the mutant human telomerase RNA has the ribonucleotide sequence shown in SEQ ID NO.23 or SEQ ID NO.24. To improve RNA activity and / or enhance its stability, the 5' end of the RNA is preferably modified, for example, by a "capping" modification. In one embodiment, a guanine (…) can be added to the first 5' end… -1 Methylation at position 7 of G) and addition of three triplet phosphate groups {m} at the N position of the nucleotide sugar. 7 G(5'), pppN(5')}. Alternatively, it can be replaced with N. 2 N 2 7-Trimethylguanine (m 2,2,7 G), or further, having three phosphate groups at the N site, namely {m 2,2,7 G(5'), pppN(5')}. In another embodiment, when the RNA is synthesized in vitro (including chemical synthesis and in vitro transcription), it preferably has a recognition marker for entering the cell nucleus at its 5' end. For example, the in vitro synthesized RNA of the present invention has {m} at its 5' end. 2,2,7 G(5'), pppN(5')} modifies.

[0059] In yet another embodiment, the mutant human telomerase RNA of the present invention may be conjugated with a suitable polymer, such as PEG, PVP, etc. Preferably, the mutant human telomerase RNA of the present invention is conjugated with a suitable polymer at its 5' end. Methods for improving RNA stability are well understood by those skilled in the art and are also included within the scope of this invention.

[0060] Pharmaceutical Composition

[0061] The present invention also includes a pharmaceutical composition comprising a therapeutically or preventively effective amount of the mutant human telomerase RNA gene of the present invention, a recombinant construct, an expression vector, mutant human telomerase RNA and / or a composition thereof, and a pharmaceutically acceptable vector / excipient.

[0062] As used herein, "therapeutically effective amount" means an amount of a recombinant, in vitro synthesized human telomerase RNA composition and / or pharmaceutical composition of the present application that is sufficient, when administered to a subject for the treatment of a pan-cancer, to effect treatment (e.g., by diminishing, ameliorating or maintaining the existing disease or one or more symptoms of the disease) of the pan-cancer. The "therapeutically effective amount" will vary depending on the nature of the mutant human telomerase RNA gene, the recombinant construct, the expression vector, the mutant human telomerase RNA itself, the mode of administration, the type of disease being treated and its severity, and the history, age, weight, family history, genetic makeup, stage of disease, type of prior or concomitant treatments (if any), and other individual characteristics of the patient to be treated.

[0063] As used herein, "prophylactically effective amount" means an amount of a recombinant, in vitro synthesized human telomerase RNA, composition and / or pharmaceutical composition of the present application that is sufficient, when administered to a subject at risk of developing a cancer, to decrease the risk of developing a cancer or to ameliorate one or more symptoms following development of a cancer. Amelioration includes slowing the progression of a cancer or reducing the severity of the resulting disease. The "prophylactically effective amount" will vary depending on the nature of the recombinant, in vitro synthesized human telomerase RNA, composition and / or pharmaceutical composition itself, the mode of administration, the type of disease being treated and its severity, and the history, age, weight, family history, genetic makeup, stage of disease, type of prior or concomitant treatments (if any), and other individual characteristics of the patient to be treated.

[0064] As used herein, the term "pan-cancer" refers to the class of cancers in which cellular telomerase is abnormally elevated, which class comprises more than about 90% of human cancer types, most of which arise from the transformation of cells in epithelial tissue, as well as sarcomas, blastomas, etc.

[0065] A "carrier" or "excipient" is a pharmaceutically acceptable solvent, suspending agent or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal. The excipient can be a liquid or solid and is selected with respect to a particular pharmaceutical composition to be combined with the nucleic acid and other components of the pharmaceutical composition, to provide for example, the desired bulk, consistency, etc., when combined with the nucleic acid and other components of the particular pharmaceutical composition, with respect to the intended mode of administration. Typical carriers include, but are not limited to, binding agents (e.g., corn starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylate, or dicalcium phosphate, etc.); lubricants (e.g., magnesium stearate, talc, silicon dioxide, colloidal silicon dioxide, stearic acid, metallic stearates, hydrogenated vegetable oil, corn starch, polyethylene glycol, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, etc.); and wetting agents (e.g., sodium lauryl sulfate).

[0066] Pharmaceutically acceptable organic or inorganic excipients that are suitable for parenteral administration, that do not cause toxic reactions with the nucleic acids, can also be used to formulate the compositions of the present application. Suitable pharmaceutically acceptable carriers include but are not limited to water, saline, alcohol, polyethylene glycol, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone, etc.

[0067] Formulations for topical administration of nucleic acids can include sterile or non-sterile aqueous solutions, non-aqueous solutions, or nucleic acid solutions in liquid or solid oil bases. These solutions also can include buffers, diluents, and other suitable additives. Pharmaceutically acceptable organic or inorganic excipients that are suitable for parenteral administration, that do not cause toxic reactions with the nucleic acids, can be used.

[0068] Suitable pharmaceutically acceptable excipients include but are not limited to water, saline, alcohol, polyethylene glycol, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone, etc.

[0069] Suitable carriers / vehicles are routinely determinable by those of ordinary skill in the art and are described, for example, in Remington's Pharmaceuticals.

[0070] The pharmaceutical compositions of the present application can be in the form of aqueous or non-aqueous solutions, suspensions, liposome formulations, micelle formulations, emulsions, crystalline compositions, etc.

[0071] In one embodiment, the pharmaceutical compositions of the present application can be formulated in an aqueous buffered solution, such as acetate, citrate, albumin, carbonate, or phosphate, or any combination thereof. Preferably, the buffered solution is phosphate buffered saline (PBS). In some embodiments, the buffered solution further comprises one or more agents for controlling the osmolality of the solution, such that the osmolality is maintained at a desired value, such as the physiological value in human plasma. Solutes that can be added to the buffered solution to control the osmolality include but are not limited to proteins, peptides, amino acids, non-metabolizable polymers, vitamins, ions, sugars, metabolites, organic acids, lipids, or salts. In some embodiments, the agent for controlling the osmolality of the solution is a salt, preferably sodium chloride and / or potassium chloride.

[0072] In another embodiment, the pharmaceutical compositions of the present application are formulated as transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids, and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like can be useful. Suitable topical formulations include those in which the pharmaceutically active ingredients in the present application are in admixture with a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants. Suitable lipids and liposomes include neutral (e.g. dioleoylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidylcholine DMPC, distearoylphosphatidylcholine), negative (e.g. dimyristoylphosphatidylglycerol DMPG) and cationic lipids and liposomes (e.g. dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidylethanolamine DOTMA). The pharmaceutical compositions characterized in the present application can be encapsulated within liposomes or can form complexes with cationic liposomes, especially with cationic liposomes. Alternatively, the nucleic acids of the present application can be complexed with lipids, in particular with cationic lipids. Suitable fatty acids and esters include, but are not limited to, arachidonic acid, oleic acid, arachidic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprylate, tricaprylate, glycerol monooleate, glycerol dilaurate, 1-monocaprate glycerol or a pharmaceutically acceptable salt thereof. Topical formulations are described in detail in U.S. Patent No. 6,747,014, which is incorporated herein by reference.

[0073] The pharmaceutical compositions of the present application can additionally contain other compatible components, such as adjuvants, in the amounts commonly used in the art of pharmaceutical formulation. Additional, compatible pharmaceutical agents, such as astringents, local anesthetics, or anti-infective agents, etc., can be included in the pharmaceutical compositions of the present application, or other agents useful in the formulation of the various dosage forms of the pharmaceutical compositions of the present application, such as dyes, flavoring agents, preservatives, antioxidants, opaquing agents, thickening agents, and / or stabilizing agents can be included. However, such agents should not be included to the extent that they stall interfere with the biological activity of the compositions of the present application. These formulations can be sterilized and, if desired, mixed with auxiliary agents such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, aromatizers and / or fragrants and the like which do not interfere with the effectiveness of the formulations. For oral suspensions, the agents can include those which increase the viscosity of the suspension, such as sodium carboxymethylcellulose, sorbitol, dextran, and the like. The suspension can also contain stabilizers.

[0074] When the mutant human telomerase RNA of the application is administered to a cell or a subject in the form of a chemical synthesis or in vitro transcription, the RNA is preferably formulated to preserve its activity and / or to improve its stability. Thus, in one embodiment, the application provides a pharmaceutical composition comprising a mutant human telomerase RNA of the application and a suitable delivery vehicle. Preferably, the delivery vehicle is a protamine vehicle, a nanoparticle lipoplex vehicle, a polyplex vehicle. The mutant human telomerase RNA can be mixed directly, associated or chemically coupled to the delivery vehicle. For example, the RNA of the application can be coupled to GalNAc (N-acetylgalactosamine). These delivery vehicles also protect the RNA from degradation. Alternatively or additionally, the mutant human telomerase RNA of the application can be administered in the form of a nanoparticle. In one embodiment, a cholesterol molecule is also comprised in the nanoparticle to increase the mobility of the nanoparticle and / or to increase the membrane crossing ability of the nanoparticle. In another embodiment, PEG is comprised in the pharmaceutical composition as an adjuvant to evade the host immune system, to make it more water soluble and to slow down its degradation.

[0075] The pharmaceutical composition of the application can be administered to a subject in need thereof, such as a human, in a dose sufficient to treat and / or prevent a pan-cancer disease type. The dose to be administered is routinely determined by a physician in accordance with general knowledge in the art by experimentation. For example, the dose to be administered is about 1 pg / kg body weight to 500 mg / kg body weight per day, such as 10 pg / kg, 50 pg / kg, 100 pg / kg, 500 pg / kg body weight to 1 mg / kg, 5 mg / kg, 10 mg / kg, 50 mg / kg, 100 mg / kg or 500 mg / kg body weight. Any intermediate range within these ranges is also encompassed by the application.

[0076] The pharmaceutical composition of the application can be administered at a suitable administration frequency. The suitable administration frequency is routinely determined by a person skilled in the art by routine methods. For example, it can be given once a day, or it can be given twice, three times or more sub-doses at appropriate intervals throughout the day, or even continuously by a controlled release formulation using a continuous infusion or delivery. Alternatively, the composition of the application can be administered once every other day, every three days, every week, every half month, every month, every two months, every quarter, every half year or every year. The pharmaceutical composition of the application can also be formulated as a conventional sustained release formulation. Sustained release formulations are well known in the art and are particularly useful for delivering an agent at a specific site.

[0077] The skilled artisan will appreciate that certain factors can influence the dosage and timing required to effectively treat a subject, including but not limited to the severity of the disease or disorder, previous treatments, the general health and / or age of the subject, and other existing diseases. In addition, treatment of a subject with a therapeutically effective dose of a composition can include a single treatment or a series of treatments. As described elsewhere herein, the effective dose and in vivo half-life of the mutant human telomerase RNA genes, nucleic acid constructs, expression vectors, mutant human telomerase RNAs, compositions, and / or pharmaceutical compositions encompassed by the present application can be assessed using routine methods or based on in vivo testing using appropriate animal models.

[0078] Routes of administration

[0079] The mutant human telomerase RNA genes, nucleic acid constructs, expression vectors, mutant human telomerase RNAs of the present application, after being prepared by chemical synthesis, in vitro transcription, or recombinant methods, can be administered in an effective amount to a subject in need thereof, or into a cell, particularly into a targeted organ, tissue, or cell, by a suitable mode of administration. Such administration techniques include, for example, intravenous, subcutaneous, intraperitoneal, transdermal, transdermic, oral, and the like. Alternatively, the mutant human telomerase RNA genes of the present application can be administered by gene gun, lipofection, liposome, gene injection, and the like. Alternatively, the nucleic acid constructs or expression vectors described above can also be delivered into a subject in need thereof.

[0080] Accordingly, the pharmaceutical compositions of the present application can be administered to a subject in need thereof by a variety of suitable routes of administration, depending on the region to be treated and the effect desired to be obtained. For example, the pharmaceutical compositions of the present application can be administered topically, for example, by a transdermal patch; can be administered to the lungs by inhalation or insufflation of a powder or aerosol, including by nebulizer; or can be administered in ointments or creams by intradermal, epidermal, transdermal, transcutaneous, oral, or parenteral routes, and the like. Parenteral administration includes subcutaneous, intravenous, intraperitoneal, or intramuscular injection or infusion; subcutaneous, for example, by an implantation device; or intracranial, for example, by intraparenchymal or intrathecal routes, and the like.

[0081] Methods of disease treatment and prevention

[0082] The present application also relates to a method of treating or preventing a pan-cancer, which comprises administering to a subject in need thereof a therapeutically or prophylactically effective amount of a pharmaceutical composition of the present application. The meaning of "therapeutically effective amount" and "prophylactically effective amount", the mode of administration to a subject, the frequency of administration, the form of the pharmaceutical composition are as described above with respect to the pharmaceutical composition.

[0083] The mutant human telomerase RNA (SEQ ID NO. 23 or SEQ ID NO. 24) obtained by directly synthesizing the RNA form, in vitro transcription of the mutant human telomerase RNA gene of the present application, enters the cell through liposomes or other nano means, or the mutant human hTERC gene I or the mutant human hTERC gene II enters the cell through an expression vector, and the transcribed RNA binds with the hTERT component to form a telomerase carrying the hTERC mutation, which corrects the genetic defective telomere of the target cell. The telomerase carrying the hTERC mutation can significantly inhibit the growth of HELA cells and human breast cancer solid tumors, significantly reduce the abnormal telomerase activity of cancer tissues, and effectively guide cancer cells into PCD natural apoptosis. Since normal embryonic cells are meristematic cells, non-senescent cells, and telomeres have a longer length, there are no TC and TG genetic defect telomeres that need to be repaired, so the recombinant does not affect normal dividing embryonic cells. Cancer cells are senescent cells that divide rapidly, and telomeres are abnormally shortened, with different numbers of TC and TG genetic defect telomeres. The mutant hTERC component introduced directly or expressed in the cell can effectively bind to these TC or TG genetic defect telomeres, repair them into normal telomeres 5' AGGGTT 3', and continue to extend the telomeres with the help of endogenous hTERC, guide them into programmed cell death, thereby achieving the purpose of preventing and treating cancer and delaying aging. The recombinant targets cancer cells with abnormally elevated telomerase, so it is suitable for more than 90% of cancer types and has the characteristics of treating and preventing pan-cancer.

[0084] Kit

[0085] The present application also provides a kit comprising one or more of the mutant human telomerase RNA gene, nucleic acid construct, expression vector, mutant human telomerase RNA, and / or composition of the present application, and / or instructions for carrying out the methods of the present application. The kit can optionally comprise a means (e.g., a syringe) for contacting a target cell with the mutant human telomerase RNA gene, nucleic acid construct, expression vector, mutant human telomerase RNA, and / or composition of the present application.

[0086] Preparation method

[0087] The mutant human hTERC gene of the present application can be recombined with various gene carriers as described above and packaged for preparation. The mutant human telomerase RNA of the present application can be directly chemically synthesized and / or obtained by in vitro transcription. These production and preparation methods are well known to those skilled in the art.

[0088] In one embodiment, the present application also provides a method for preparing the mutant human hTERC gene of the present application, which comprises inserting the mutant human telomerase RNA gene of the present application into a plasmid or viral vector. Preferably, in the vector, the mutant human telomerase RNA gene of the present application is operably linked to a promoter directing its transcription. For example, the hTERC gene mutant I (SEQ ID NO. 15) or the hTERC gene mutant II (SEQ ID NO. 16) can be inserted into an AD5 replication-defective adenovirus as a gene vector, and operably linked to the human telomerase promoter hTERTpro, thereby preparing Recombinant I and Recombinant II. The recombinants prepared by the method of the present application express the hTERC mutant gene in cells having telomerase activity, and repair the TC and TG genetically deficient telomeres, respectively. In the present application, the gene vector is not limited to the AD5 replication-defective adenovirus, and can be replaced by the aforementioned expression vector or similar gene expression vectors.

[0089] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice of the present application, the methods and materials are described herein as being most useful in the practice of the present application. All publications, patent applications, patents and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

[0090] The present application will be further described by the following examples. It will be obvious to those skilled in the art that these examples are in no way limiting and are merely illustrative of the present application. Various modifications can be made to the present application by those skilled in the art without departing from the spirit and scope of the present application. Such modifications are also within the scope of the present application. The scope of the present application is defined by the appended claims. Example

[0091] The following examples relate to the following aspects, respectively:

[0092] 1. Detection of TC genetically deficient telomeres in the genomic DNA of peripheral blood and cancer cell lines of cancer patients;

[0093] 2. Creation of single base mutants of the hTERC gene;

[0094] 3. Construction of recombinant eukaryotic expression vectors of hTERC gene mutants;

[0095] 4. Construction of human telomerase promoter transfer vectors;

[0096] 5. Constructing AD5 replication-defective adenovirus shuttle vector for hTERC gene mutant;

[0097] 6. Packaging AD5 replication-defective recombinant adenovirus with AdMAX system;

[0098] 7. Testing gene expression cassette of recombinant with hTERC wild-type eukaryotic expression;

[0099] 8. Testing growth effect of recombinant hTERC gene mutant on HeLa cell line;

[0100] 9. Testing growth effect of recombinant hTERC gene mutant on human breast cancer solid tumor;

[0101] 10. Testing inhibitory effect of recombinant hTERC gene mutant on human breast cancer telomerase;

[0102] 11. Observing structural changes of human breast cancer cells by recombinant hTERC gene mutant;

[0103] 12. Testing programmed apoptosis effect of human breast cancer cells by recombinant hTERC gene mutant;

[0104] Example 1 Detection of TC genetic defect telomere in cancer patient peripheral blood genomic DNA and cancer cell line genomic DNA

[0105] Obtain peripheral blood of 16 cancer patients (including lung cancer, colorectal cancer, cervical cancer, ovarian cancer, gum cancer and cardia cancer) and 4 cancer cell lines (colon cancer, lung cancer, liver cancer and cervical cancer) samples, and determine the presence of TC genetic defect telomere by the following method.

[0106] 1) Genomic DNA sample preparation:

[0107] Extract and prepare human blood genomic DNA samples according to the kit instructions provided by MiniBEST Whole Blood Genomic DNA Extraction Kit reagent kit provided by TAKARA (Dalian) Biotechnology Co., Ltd. Finally, replace the "Elution" eluent provided by the kit with lx TE, pH 7.6 buffer.

[0108] 2) Oligonucleotide synthesis and linker preparation:

[0109] a) Synthesize the oligonucleotides listed in the sequence table provided by Shanghai Bioengineering Company, and perform chemical modification as required.

[0110] b) Synthetic oligonucleotides were dissolved in double distilled water (ddH2O) to make 20mM solution, ready for use. 20ul sterilized double distilled water (ddH2O) and 5.0ul linker buffer [200mM Tris-HCl pH7.6, 600mM Kac, 20mM Mg(Ac)2] were added into PCR thin-walled tube, 12.5ul 20mM selection strand (SL1: 5’GCAGTCTACGAGACCCT 3’; SEQ ID NO:3) solution and 12.5ul 20mM ligation strand (LL: 5’TCGTAGACTGCGTACCGA 3’; SEQ ID NO:4) solution were added, mixed and centrifuged. The mixture was put into PCR instrument, and the following program was performed: 98°C / 1min, 97°C / 1min (-1°C / Cycle, 83 Cycles), 12°C stop. And labeled as: LK1.

[0111] 3) Endonuclease treatment of genomic DNA:

[0112] The prepared genomic DNA was diluted to 20ng / ul with lxTE pH7.6 buffer, and 25ul (500ng DNA) was mixed with 25ul enzyme digestion mixture [5ul 10x EcoR V buffer, 17ul ddH2O and 3.0ul 15U / ul EcoR V (Takara)] after mixing, and incubated at 37°C for 2 hours, and labeled as: M1.

[0113] 4) Purification of enzyme-digested samples:

[0114] 50ul ddH2O was added to each enzyme-digested sample, and 40ul magnetic bead mixture (Hieff NGS Smarter DNA Clean Beads kit) was added, and the sample was purified according to the requirements of the kit. Eluted with 28.0ul 0.1xTE, pH7.6, and 26.5ul DNA purified sample was taken, and labeled as: MC1.

[0115] 5) Purified enzyme-digested DNA fragments were ligated with linkers:

[0116] 12.0ul MC1 DNA fragments were taken, mixed with 15ul 2x T7 DNA Ligase Buffer, 1.5ul 5.0ul MLK1, 1.5ul T7 DNA Ligase (Biolab NEB), centrifuged, incubated at 25°C for 2 hours, and labeled as: MCL1.

[0117] 6) Purification of ligation samples:

[0118] Each MCL sample was supplemented with 70 ul of ddH2O, and then the sample was purified according to the method of Step 4, and eluted with 34 ul of 0.1 x TE pH 7.6, and 32.5 ul of the purified DNA sample was taken and labeled in order as: MCLC1.

[0119] 7) PCR amplification of the purified sample:

[0120] 8 ul of MCLC1 was taken, 2 ul of ddH2O was added, and then 10 ul of PCR mix [4.5 ul of ddH2O, 2.0 ul of 10 x PCR Buffer, 1.6 ul of 2.5 mM dNTP, 0.5 ul of 25 uM FPrim (5'-gaatcctgcgcaccgagattctc-3', SEQ ID NO: 5), 0.5 ul of 25 uM RPrim1 (5' CGGTACGCAGTCTACGAGAC 3', SEQ ID NO: 6), 0.6 ul of 100% glycerol, and 0.3 ul of HS Taq (Takara)] was added, mixed, and centrifuged. A Touchdown PCR reaction program (Bio-Rad S1000™ Thermal Cycler) was performed: 94°C / 4 min; {94°C / 45 sec, 67°C / 60 sec (-1.0°C / cycle) x 6 cycles, 72°C / 60 sec}, (94°C / 35 sec, 60°C / 60 sec, 72°C / 60 sec) x 28 cycles, 72°C / 15 min, 4°C / Forever.

[0121] 8) Electrophoretic separation, staining, and imaging of the PCR product:

[0122] The PCR product sample and 60 ng (4 ul) of DNA marker (DL2000 DNA Marker, TAKARA) were separated on a 1.5% agarose gel, then standardized and stained with 0.1% ethidium bromide, and imaged using a GeneGenius Bio-imaging System (SYNGENE, Synoptics Ltd, Cambridge, UK).

[0123] 9) Quantitative analysis and results:

[0124] Using Genetool (SYNGENE, Synoptics Ltd, Cambridge, UK) image quantification tool. According to the DNA marker instruction, the DNA band molecular weight of lane M 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp were defined, wherein the 750bp band defined 60ng dsDNA. Then, the molecular weight and the amount of the amplified product of each target band of the PCR product were determined respectively. The results are summarized in Table 2 below:

[0125] Table 2 Detection results of 5' AGGGTC 3' telomere end in different cancer types

[0126]

[0127] The results clearly show that, whether it is lung cancer, colon cancer, rectal cancer, ovarian cancer, cervical cancer or less common gum cancer, different amounts of clear DNA target bands can be amplified in the whole blood genomic DNA of the subjects, significantly more than non-cancer subjects, and some non-cancer subjects have no genetic defect telomere detected. At the same time, the content of the DNA band of the cancer subjects is significantly higher. Different amounts of TC genetic defect telomeres were also detected in cancer cell lines, while there were almost none in the normal liver cell line as a control.

[0128] Example 2 Creation of hTERC gene single base mutant

[0129] Based on the full length of hTERC gene in NCBI database is 451bp, no intron, the human hTERC sequence is obtained directly from genomic DNA as wild type gene (WT), the sequence is shown as SEQ ID NO. 1. The deoxyadenosine nucleotide (A) at position -54 in hTERC sequence is mutated to deoxyguanosine nucleotide (G) by overlapping PCR method, defined as hTERC gene mutant I (TI). The deoxyadenosine nucleotide (A) at position -54 is mutated to deoxycytidine nucleotide (C), defined as hTERC gene mutant II (TII). And they are cloned into T-vector. The specific implementation is as follows:

[0130] A: Preparation of human whole genomic DNA. TaKaRa MiniBEST Whole Blood Genomic DNA Extraction Kit was used to prepare whole genomic DNA, which was stored at 4°C for later use.

[0131] B: Overlapping extension PCR method, the primers used for site-directed mutagenesis are:

[0132] 1) TF: 5'-TTCCATTTTTAAGGTAGTCGAGG-3' (SEQ ID NO. 7);

[0133] 2) TR: 5'-TAAAAGGCAACAAAAAGCGGAAG-3' (SEQ ID NO. 8);

[0134] 3) MF-I: 5'-GTCTAACCCTGACTGAGAAGG-3' (SEQ ID NO. 9);

[0135] 4) MR-I: 5'-CCTTCTCAGTCAGGGTTAGAC-3' (SEQ ID NO. 10).

[0136] First round PCR: reaction system 20ul (2.0ul 10x PCR Buffer with Mg2+, 1.6ul 10mM dNTP, 2.0ul 2.0uM Primer TF, 2.0ul 2.0uM Primer MR-I, 5.0ul 10ng / ul Genomic DNA, 0.2ul 5U / ul Pfu polymerase and 7.2ul ddH2O). Reaction program: 95℃ / 5min, (95℃ / 30sec, 58℃ / 30sec, 72℃ / 60sec) x 30 cycles, 72℃ / 10min, 8℃ stop. PCR products were electrophoresed on 1% agarose gel. Then, 376bp target fragment was recovered by Takara MiniBEST Agarose Gel DNA Extraction Kit and labeled as PD1, diluted and quantified as 10ng / ul. At the same time, Primer TR replaced Primer TF, Primer MF-I replaced Primer MR-I, and the rest was exactly the same, 639bp target fragment was recovered and labeled as PD2, diluted and quantified as 10ng / ul. Second round PCR: reaction system 20ul (2.0ul 10x Pfu Buffer with Mg2+, 1.6ul 10mM dNTP, 2.0ul 2.0uM Primer TF, 2.0ul 2.0uM Primer TR, 0.5ul 10ng / ul PD1, 0.5ul 10ng / ul PD2, 0.2ul 5U / ul Pfu polymerase and 11.2ul ddH2O). Reaction program: (95℃ / 30sec, 62℃ / 30sec, 72℃ / 60sec) x 30 cycles, 72℃ / 10min, 8℃ stop. PCR products were electrophoresed on 1% agarose gel. Then, 967bp target fragment was recovered by Takara MiniBEST Agarose Gel DNA Extraction Kit and labeled as TD-I. At the same time, 1.0ul 50ng / ul Genomic DNA replaced 0.5ul 10ng / ul PD1 and 0.5ul 10ng / ul PD2 to obtain wild type target gene fragment and labeled as WD. TD-I and WD were cloned by pMD18-T respectively. Target fragments

[0137] TD-I or WD was subjected to 3' end A reaction, reaction volume 10 ul (2.0 ul 10x PCR Buffer with Mg2+, 1.0 1 mM dATP, 7.8 ul TD-I or WD target fragment, 0.2 ul 5 U / ul rTaq), 72 °C incubation for 15 minutes. Then, according to the instructions of Takara pMDTM18-T Vector Cloning Kit, ligation, cloning was carried out, Takara MiniBEST Plasmid Purification Kit was used to extract DNA sample, and after sequencing confirmation, it was labeled as: pMD18 / +TD-I and pMD18 / +WD, respectively.

[0138] C: Construction of pMD18 / +hTERC(MT-I) transfer vector. The primers used are:

[0139] 1) EcoRTER:

[0140] 5'-GCGTGAATTCTCCCTTTATAAGCCGAC-3'(SEQ ID NO. 11);

[0141] 2) BamHNoSP:

[0142] 5'-CAGGATCCAAAAAAAAATGGGGGCTCACAAGCC-3'(SEQ ID NO. 12).

[0143] PCR reaction system 20ul (10ul 2x GC Buffer, 3.2ul 10mM dNTP, 2.0ul 2.0uM EcoRI, 2.0ul 2.0uM BamHI NoSP, 1ul DNA from pMD18 / TD-I, 0.2ul 5U / ul Pfu polymerase, 1.6ul ddH2O); PCR reaction program: 95℃ / 2min, (95℃ / 30sec, 60℃ / 30sec, 72℃ / 60sec) x 30 cycles, 72℃ / 10min, 8℃ stop. The PCR product was electrophoresed on 1% agarose gel, and the amplified fragment was recovered using Takara MiniBEST Agarose Gel DNA Extraction Kit. The recovered amplified fragment and pMDTM18-T Vector DNA were then double-digested with BamHI and EcoRI, respectively. The digestion reaction system was 25ul (2.5ul 10x Buffer T, 10ul 60ng / ul DNA, 0.6ul 5U / ul BamHI, 1.2ul 5U / ul EcoRI, 3.25ddH2O). The reaction conditions were 37℃ for 2 hours. Purification was performed using Takara MiniBEST DNA Fragment Purification Kit. Then, according to the instructions of Takara pMDTM18-T Vector Cloning Kit, ligation and cloning were performed, and DNA samples were extracted using Takara MiniBEST Plasmid Purification Kit and sequenced to confirm that the transfer vector of single base mutation I of the hTERC gene was obtained, labeled as: pMD18 / +hTERC(MT-I).

[0144] D: replace primer MF-I: 5'-GTCTAACCCTGACTGAGAAGG-3' (SEQ ID NO. 9) with primer MF-II: 5'-GTCTAACCCTCACTGAGAAGG-3' (SEQ ID NO. 13); replace primer MR-I, 5'-CCTTCTCAGTCAGGGTTAGAC-3' (SEQ ID NO. 10) with MR-II 5'-CCTTCTCAGTGAGGGTTAGAC-3' (SEQ ID NO. 14), and repeat steps B and C, to obtain the transfer vector of single base mutation II of the hTERC gene, and label it as: pMD18 / +hTERC(MT-II).

[0145] E: Replace pMD18 / +TD-I with pMD18 / +WD constructed in step B, repeat step C, and obtain the transfer vector of wild type hTERC gene, and mark it as: pMD18 / +hTERC(WT).

[0146] Example 3 Construction of Recombinant Eukaryotic Expression Vector of hTERC Gene Mutant

[0147] Using eukaryotic expression vector pcDNA3.1(-) and MT-I, MT-II and WT transfer vectors obtained in Example 2, hTERC target gene is inserted into pcDNA3.1(-) eukaryotic expression vector by double enzyme digestion of BamHI and EcoRI, and the implementation is as follows:

[0148] The plasmid DNA of pcDNA3.1(-) (Invitrogen, Life Technology) and pMD18 / +hTERC (MT-I) was prepared by Takara MiniBEST Plasmid Purification Kit. The double enzyme cutting pMD18 / +hTERC (MT-I) DNA reaction system was: (5ul 10x Buffer K, 12ul 180ng / ul pMD18 / +hTERC (MT-I) DNA, 2.5ul 5U / ul BamHI, 2.5ul 5U / ul EcoRI, 28ul ddH2O); after the reaction solution was incubated at 37℃ for 2 hours, the enzyme cutting product was electrophoresed by 1% agarose gel. Then, the hTERC (MT-I) target fragment (577bp) was recovered by Takara MiniBEST Agarose Gel DNA Extraction Kit. At the same time, the double enzyme cutting pcDNA3.1(-) DNA reaction system was: (5ul 10x Buffer K, 40ul 50ng / ul pcDNA3.1(-) DNA, 2.5ul 5U / ul BamHI, 2.5ul 5U / ul EcoRI); after the reaction solution was incubated at 37℃ for 2 hours, the enzyme cutting sample was directly purified by Takara MiniBEST DNA Fragment Purification Kit to obtain linear pcDNA3.1(-) DNA. Then, the hTERC (MT-I) target fragment and the linear pcDNA3.1(-) DNA sample were connected by T4 ligase. The connection system was 10ul (1ul 10x T4 Ligase buffer, 5ul 30ng / ul recovered linear pcDNA3.1(-) DNA fragment, 1ul 40ng / ul recovered hTERC (MT-I) target fragment, 1ul 5U / ul T4 DNA Ligase), which was incubated at 16℃ for 12 hours. Then, the transformation, screening, enzyme cutting identification and sequencing identification of the connected fragments were carried out according to the conventional method to obtain the eukaryotic expression vector carrying the target gene: pcDNA3.1(-) / +hTERC (MT-I), respectively.

[0149] The pMD18 / +hTERC (MT-II) or pMD18 / +hTERC (WT) was replaced by pMD18 / +hTERC (MT-I), respectively, and the rest was exactly the same as above. The method was repeated to obtain the eukaryotic expression vector carrying the target gene: pcDNA3.1(-) / +hTERC (MT-II) and pcDNA3.1(-) / +hTERC (WT), respectively. Figure 4 )

[0150] Example 4 Construction of human telomerase promoter transfer vector

[0151] Primers used for cloning hTERTpro: 1) hTERTpro-F: 5'-ACATACGTACACGCACCTGTTCCCAG-3' (SEQ ID NO. 17); 2) hTERTpro-R: 5'-TCCTGAATTCGCGGGGGTGGCCGGGGCCA-3' (SEQ ID NO. 18); PCR reaction system 20ul (10ul 2x GC Buffer, 3.2ul 10mM dNTP, 2.0ul + 2.0uM + hTERTpro-F, 2.0ul + 2.0uM + hTERTpro-R, 0.5ul + 50ng / ul + genomic + DNA, 0.2ul + 5U / ul + rTaq + Polymerase, 5.7ul + ddH2O); reaction conditions: 95°C / 2min, (95°C / 30sec, 61°C / 30sec, 72°C / 60sec) x 30 cycles, 72°C / 10min, 8°C stop. The PCR product was electrophoresed on a 1% agarose gel, and the 505bp amplified fragment was recovered using Takara + MiniBEST + Agarose + Gel + DNA + Extraction + Kit. Then, according to the instructions of Takara + pMDTM18-T + Vector αCloning Kit, ligation, cloning, and sequencing were performed to confirm that there were no errors, and the human telomerase promoter (hTERTpro) transfer vector was labeled as: pMD18 / +hTERTpro.

[0152] Example 5 Construction of AD5 replication-deficient adenovirus shuttle vector for hTERC gene mutant

[0153] A: The DNA samples of the HCMV adenovirus vector pCA13 / -HCMV and the plasmid pMD18 / +hTERTpro were prepared by using Takara MiniBEST Plasmid Purification Kit, and the hTERTpro fragment was inserted into the pCA13 / -HCMV plasmid by HindIII and EcoRI double enzyme digestion method. Double enzyme digestion reaction system 1: (2.5ul 10x Buffer R, 8ul pMD18 / +hTERTpro DNA, 0.8ul 5U / ul HindIII, 1.25ul 5U / ul EcoRI, 12.45ul ddH2O); after the reaction solution was incubated at 37℃ for 2 hours, the enzyme digestion product was electrophoresed on a 1% agarose gel. Then, the 519bp target fragment was recovered by using Takara MiniBEST Agarose Gel DNA Extraction Kit. At the same time, double enzyme digestion reaction system 2: (2.5ul 10x Buffer R, 8ul pCA13 / -HCMV DNA, 0.8ul 5U / ul HindIII, 1.25ul 5U / ul EcoRI, 12.45ul ddH2O); after the reaction solution was incubated at 37℃ for 2 hours, the enzyme digestion sample was directly purified by using Takara MiniBEST DNA Fragment Purification Kit. Finally, the 519bp fragment and the double enzyme digestion and purified pCA13 / -HCMV DNA sample were connected by using T4 ligase. The connection system was 10ul (1ul 10x T4 Ligase buffer, 1.5ul recovered vector pCA13 / -HCMV fragment, 6.5ul recovered hTERTpro target fragment, 1ul 5U / ul T4 DNA ligase), and after incubation at 16℃ for 2 hours, the connected fragments were transformed, screened, enzyme-digested and sequenced according to the conventional method to obtain the target recombinant plasmid: pCA13 / +hTERTpro.

[0154] B: DNA of pCA13 / +hTERTpro and pMD18 / +hTERC(MT-I) plasmids was prepared with Takara MiniBEST Plasmid Purification Kit, and the hTERC(MT-I) fragment was transferred into pCA13 / +hTERTpro vector by double digestion with BamHI and EcoRI. Double digestion pMD18 / +hTERC(MT-I) DNA reaction system: (5ul 10x Buffer K, 12ul 180ng / ul pMD18 / +hTERC(MT-I) DNA, 2.5ul 5U / ul BamHI, 2.5ul 5U / ul EcoRI, 28ul ddH2O); after 37°C incubation for 2 hours, the digestion product was electrophoresed on 1% agarose gel. Then, the hTERC(MT-I) target fragment (577bp) was recovered with Takara MiniBEST Agarose Gel DNA Extraction Kit. At the same time, double digestion pCA13 / +hTERTpro DNA reaction system: (5ul 10x Buffer K, 40ul 50ng / ul pCA13 / +hTERTpro DNA, 2.5ul 5U / ul BamHI, 2.5ul 5U / ul EcoRI); after 37°C incubation for 2 hours, the digestion sample was directly purified with Takara MiniBEST DNA Fragment Purification Kit to obtain linear pCA13 / +hTERTpro DNA. Finally, the hTERC(MT-I) target fragment and the digested linear pCA13 / +hTERTpro DNA sample were ligated with T4 ligase. Ligation system 10ul (1ul 10x T4 Ligase buffer, 5ul 30ng / ul recovered linear pCA13 / +hTERTpro DNA fragment, 1ul 40ng / ul recovered hTERC(MT-I) target fragment, 1ul 5U / ul T4 DNA ligase), 16°C incubation for 2 hours, and then routine methods were used for ligation fragment transformation, screening, digestion and sequencing identification to obtain the target gene shuttle vector: pCA13 / +hTERTpro+hTERC(MT-I).

[0155] The above method was repeated with pMD18 / +hTERC(MT-II) or pMD18 / +hTERC(WT) instead of pMD18 / +hTERC(MT-I), and the rest was exactly the same. The target gene shuttle vectors: pCA13 / +hTERTpro+hTERC(MT-II) and pCA13 / +hTERTpro+hTERC(WT) were obtained, respectively.Figure 5

[0156] Example 6 Packaging of AD5 replication-defective recombinant adenovirus with AdMAX system

[0157] A: Co-transfect the target gene transfer vector pCA13 / +hTERTpro+hTERC (MT-I) and human adenovirus serotype 5 (E1 / E3 deletion) backbone vector pBHG11 into HEK293 cells by liposome mediation to obtain the target recombinant adenovirus. The specific method is as follows: one day before transfection, plate 7.5 x 105 human embryonic kidney 293 cells in a 60 mm dish, and culture in a 37°C, 5% CO2 cell incubator with 5% DMEM. 3-4 hours before transfection (cell doubling rate is best less than 70%), replace with fresh culture medium, and add 5 ml of serum-free medium to ensure rapid cell growth. Then, add the target gene transfer vector pCA13 / +hTERTpro+hTERC (MT-I), the virus backbone vector pBHG11 and the liposome Lipofectamine 2000 (purchased from Invitrogen Corporation) to the 293 cells (the specific operation is omitted), and co-culture for 7-14 days to obtain virus plaques. After 3 times of virus plaque purification, collect the cells, freeze-thaw repeatedly 3 times between -80°C and 37°C, then centrifuge at 4°C, 5000 rpm for 10 minutes to remove cell debris, and then store the packaged recombinant adenovirus particles at -80°C after dispensing.

[0158] B: Identification of recombinant adenovirus

[0159] Extract the recombinant adenovirus DNA using QIAGEN DNA Blood Mini Kit according to the product instructions.

[0160] ​The target gene expression cassette (hTERTpro + hTERC, 1002 bp) was amplified by PCR again, using the upstream primer Target-F: 5'-ATTACATACGTACACGCACCT-3' (SEQ ID NO. 19) and the downstream primer Target-R: 5'-AACGGGAAAGCGAACTGCAT-3' (SEQ ID NO. 20). The reaction conditions were 95°C / 3 min, (95°C / 30 sec, 60°C / 30 sec, 72°C / 60 sec) x 30 cycles, 72°C / 10 min, and 8°C stop. The amplified product was electrophoresed on a 1% agarose gel. The 1002 bp target fragment was recovered using the Takara MiniBEST Agarose Gel DNA Extraction Kit, and after routine T-cloning, it was sent to Shengong Bioengineering (Shanghai) Co., Ltd. for sequencing, and it was confirmed that the -54th site of the hTERC gene in the sequencing sequence was a guanine deoxyribonucleotide "G". The recombinant adenovirus was named AD5 + hTERC (MT-I).

[0161] pCA13 / +hTERTpro + hTERC (MT-II) was used to replace pCA13 / +hTERTpro + hTERC (MT-I), and the remaining steps A and B were repeated exactly as described above. It was confirmed that the -54th site of the hTERC gene in the sequencing sequence was a cytosine deoxyribonucleotide "C", and the recombinant adenovirus was named AD5 + hTERC (MT-II).

[0162] pCA13 / +hTERTpro + hTERC (WT) was used to replace pCA13 / +hTERTpro + hTERC (MT-I), and the remaining steps A and B were repeated exactly as described above. It was confirmed that the -54th site of the hTERC gene in the sequencing sequence was an adenine deoxyribonucleotide "A", and the recombinant adenovirus was named AD5 + hTERC (WT).

[0163] C: Amplification, purification, and titer determination of the recombinant adenovirus

[0164] HEK293 cells were seeded in 75 cm2flasks with 20 ml of 10% FBS DMEM and cultured to 80-90% confluence, then replaced with 15 ml of 2% FBS DMEM. 0.5 ul of virus stock, which was purified by virus plaque and identified correctly, was carefully added to the flask and slowly shaken horizontally in a cross shape for 3 times. After 48 hours of culture at 37°C in a 5% CO2 incubator, the cell precipitate was collected, suspended in 5 ml of 5% DMEM, and repeatedly frozen and thawed at -20°C to 37°C for 3 times. After centrifugation at 600 g for 20 minutes, the supernatant was collected. The above steps were repeated to obtain the desired amount of virus, which was purified by HPLC ion exchange column and the physical titer (vp / ml) and infectious titer (TCID50 / ml) of the purified sample were determined. Results: AD5+hTERC (MT-I) was 5.3 x 10 11 vp / ml and 1.58 x 10 10 TCID50 / mL; AD5+hTERC (MT-II) was 2.69 x 10 11 vp / ml and 7.94 x 10 9 TCID50 / mL; and AD5+hTERC (WT) was 2.3 x 10 11 vp / ml and 6.3 x 10 9 TCID50 / mL;

[0165] Example 7: Testing the gene expression cassette of the recombinant using the wild type hTERC eukaryotic expression vector

[0166] Based on the presence of telomere 3' end containing and genetically defective telomere in the genome DNA of HeLa cells, and the very high telomerase activity, the mutant recombinant vector has a serious interference on cell growth (see:

[0167] Example 8). Therefore, the wild type recombinant eukaryotic expression vector was selected for testing the gene expression cassette of the recombinant. The specific implementation is as follows:

[0168] A: Determination of the optimal G418 screening concentration. Take the well-grown HeLa cells, digest with 0.25% trypsin to prepare cell suspension, inoculate 1000 cells / ml in 24-well culture plates, culture for 6 hours, remove the culture medium, wash once with PBS, add different concentrations of screening medium (G418 is diluted with medium to make screening medium at the gradient concentrations of 100 ug / ml, 200 ug / ml, 300 ug / ml, 400 ug / ml, 500 ug / ml, 600 ug / ml, 700 ug / ml, 800 ug / ml, 900 ug / ml, 1000 ug / ml) to each well. Replace the screening medium every 3 days. Within 10-14 days, the concentration that kills all the cells is determined as the optimal screening concentration, i.e. 400 ug / ml G418.

[0169] B: Transfect HeLa cells with recombinant vector pcDNA3.1(-) / +hTERC(WT) to obtain stably transfected single cell lines. Select well-grown HeLa cells, inoculate six-well plates one day before transfection, and transfect when the cell confluence reaches 90%-95% (Effectene cell transfection according to the kit instructions). Digest the cells with trypsin 24 hours after transfection, and subculture at a ratio of 1:10. Start G418 screening 24 hours after adhesion, at a concentration of 400 ug / ml. Most cells die after 14 days, and only a few cells form clones. In a clean bench, discard the culture medium in the culture dish, digest the cells with trypsin, pick single clones with a 200 ul pipette gun, add them to a 24-well plate with pre-prepared medium, add G418 screening medium after the cells adhere, and continue to culture for 2-5 days. After the cells grow, digest them with 0.25% trypsin, transfer them to a 6-well plate, and continue to culture to obtain stably transfected HeLa cell lines.

[0170] C: Extract total RNA from stably transfected HeLa cell lines by Trizol method, detect the expression of target genes by RT-PCR method, and determine the correct expression of the recombinant gene. Figure 6 )

[0171] Example 8 Test the growth effect of the recombinant hTERC gene mutant on HeLa cell lines

[0172] A: MTT method for determining the growth of HeLa cells.

[0173] HeLa cells were transfected using the constructed recombinant eukaryotic expression vectors pcDNA3.1(-) / +hTERC(MT-I), pcDNA3.1(-) / +hTERC(MT-II), and pcDNA3.1(-) / +hTERC(WT), with an additional empty vector pcDNA3.1(-) / (empty) as a negative control. (The procedure was performed according to the Effectene kit instructions). First, HeLa cells in good growth condition were selected and plated into six-well plates one day before transfection. Transfection was performed when the cell confluence reached 90%-95% (Effectene cell transfection was performed according to the kit instructions). Twenty-four hours after transfection, cells were collected by trypsin digestion, and the single-cell suspension density was adjusted to 10T. 4 -10 5 Cells / mL. 200 μl / well (1 × 10⁻⁶) 4 Five cells were seeded into 96-well plates, with five wells per group. The plates were incubated at 37°C in a 5% CO2 incubator. Starting from the 24th hour, one 96-well plate was randomly removed every 24 hours, and 20 μL of 5 mg / mL MTT solution was added to each well. After 4 hours of incubation, the culture medium was aspirated, and 150 μL of DMSO was added to each well. The plates were then shaken on a microplate shaker for 10 minutes, and the OD value at 570 nm was measured using an ELISA reader. Results: The growth rate of HeLa cells with pcDNA3.1(-) / +hTERC(MT-I) and pcDNA3.1(-) / +hTERC(TII) plasmids was significantly slowed, while the positive control pcDNA3.1(-) / +hTERC(WT) and the negative control pcDNA3.1(-) showed faster growth.

[0174] ( Figure 7 )

[0175] B: Hoechst 33342 staining to observe apoptosis characteristics

[0176] Hoechst 33342 staining was used to observe cell morphology. Cells transfected with the mutant pcDNA3.1(-) / +hTERC(MT-I) and pcDNA3.1(-) / +hTERC(TII) showed some nuclear swelling, and some cells exhibited chromatin condensation. The high fluorescence state indicated apoptosis. However, the unmutated positive control pcDNA3.1(-) / +hTERC(WT) and the negative control pcDNA3.1(-) both showed normal cell states. Figure 8 ).

[0177] Example 9: Testing the inhibitory effect of recombinant hTERC gene mutant on the growth of human breast cancer solid tumors.

[0178] The human breast cancer Bcap-37 cell line was cultured and subcultured, centrifuged at 3000 rpm for 3 min, suspended in PBS to 3 x 10 6 / 0.1 ml / mouse, I.h. inoculated subcutaneously in the armpit of nude mice, 20 mice at a time. After 10 days, when the tumor grew to 3-4 mm, 15 mice with good tumor growth and relatively uniform tumor size were selected and randomly divided into 3 groups, and AD5+hTERC(MT-I); AD5+hTERC(MT-II) and AD5+hTERC(WT) were injected at a dose of 10 ul 1 x 10 6 TCID50 / mL; once a week for three times, and the nude mice were sacrificed on the 32nd day of administration, and the tumor tissue was peeled off and weighed. The results showed that the single base mutation of the hTERC gene significantly inhibited the growth of human breast cancer Bcap-37 solid tumors, with inhibition rates of 38% and 30.12% respectively. Figure 9 The tumor tissue after weighing was quickly frozen in liquid nitrogen and stored at -80°C.

[0179] Example 10: Test of the inhibitory effect of the recombinant hTERC gene mutant on human breast cancer telomerase

[0180] A: The solid tumor samples obtained in Example 9 were detected by the TRAP method. 100 mg of solid tumor was placed in a pre-cooled mortar and crushed with liquid nitrogen, and 200 ul of lysis buffer (10 mM Tris-HCl pH 7.5, 1 mM EGTA, 0.1 mM AEBSF, 5 mM β-mercaptoethanol, 1% NP-40, 0.25 mM NaDOC, 150 mM NaCl, 1 mM MgCl2, 10% glycerol) was added, and homogenized thoroughly; the homogenate was transferred to a 1.5 ml Ep tube and incubated in an ice bath for 25 min; then centrifuged at 12,000 g, 4°C for 20 min, and the supernatant was transferred to a 1.5 ml Ep tube, mixed thoroughly, and 5 μl was taken for protein concentration determination by the Bradford method, and the rest was evenly divided into 8 100 μl Ep tubes and stored at -80°C until use.

[0181] B: Telomerase reaction and PCR amplification. TS primer: 5'-GGATCCAATCCGTCGAGCAGAGTT-3' (SEQ ID NO. 21); CX primer: 5'-CCCTTACCCTTACCCTTACCCTTA-3' (SEQ ID NO. 22). Reaction system 50ul (20mM Tris-HCl pH8.5, 2.0mM MgCl2, 50mM KCl, 0.01% Triton X-100, ImM EGTA, ImM DTT, 5ng BSA, 50uM dNTPs, 2uM TS primer, 2.5ul 100ng total protein / ul telomerase extract, DEPC H2O to 50ul), 20°C constant temperature incubation for 20min, 80°C inactivation treatment for 10min. Then add 0.5ul 20mM CX primer and 0.5ul 5U / ul Taq DNA polymerase, perform PCR reaction: 95°C / 3min, (95°C / 30sec, 68°C / 45sec) x30 cycles, 72°C / 10min, 8°C stop.

[0182] C: Separation of PCR products by 10% polyacrylamide gel electrophoresis.

[0183] Prepare 20ml of 10% non-denaturing polyacrylamide gel (5.46ml, 37% Acr-Bis 36:1, 12.4ml ddH2O, 2ml 10xTBE, 125ul 10%APS, 15ul TEMED), use 0.5xTBE electrophoresis buffer, voltage 17.5V / cm, vertical electrophoresis pre-run for 1 hour, then take 15ul PCR product and 1.5ul 10x loading buffer for loading, continue electrophoresis for 1 hour. Silver staining: place the gel in 10% acetic acid for 30min, rinse with distilled water for 3 times, 5min each time; soak in 0.2g / L sodium thiosulfate for 1min, rinse with distilled water for 3 times, 30s each time; place the gel in 0.2% silver nitrate staining solution for 30min, rinse with distilled water for 15s; then, color in the color developing solution for about 10min, and place in 10% acetic acid for 10min. Use Genetool software for relative quantitative analysis. Results: The relative telomerase activity of hTERC gene single base mutation solid tumor samples was only 21.6% (MT-I) and 28.3% (MT-II) of wild type samples, showing a significant decrease. Figure 10 )

[0184] Example 11 Observation of structural changes of human breast cancer cells by recombinant hTERC gene mutants

[0185] The solid tumor tissue sample obtained in Example 9 was observed for changes in the nucleus, in particular, using the common tissue paraffin section and Schiff reagent staining method. The solid tumor tissue was cut into 4x4mm tissue and fixed in FAA fixative, dehydrated, impregnated with wax, embedded, cut into 2-3um thin sections, fixed on a glass slide, de-waxed, stained with Schiff reagent, and mounted. The results were observed and photographed under a 10x100 ordinary microscope: A: AD5+hTERC(MT-I); B: AD5+hTERC(MT-II) and C: control AD5+hTERC(WT) sample, compared to the control AD5+hTERC(WT) sample, the nucleus was condensed and small, the size was uneven, there were many dense and condensed phenomena caused by karyopyknosis, the cell contact became loose, and obvious apoptosis was observed. Figure 11

[0186] Example 12 Detection of the Programmed Apoptosis Effect of the Recombinant hTERC Gene Mutant on Human Breast Cancer Cells

[0187] The genomic DNA fragment of cell programmed apoptosis is composed of a polymer of about 180bp, which presents a typical "ladder" feature in agarose gel electrophoresis separation, which can be clearly distinguished from the DNA degradation characteristics of other dead cells. The specific implementation is as follows:

[0188] The genomic DNA of the solid tumor sample obtained in Example 9 was prepared using Takara MiniBEST Universal Genomic DNA Extraction Kit, and quantified using Nanodrop 2000. The solid tumor genomic DNA was analyzed by 1% agarose gel electrophoresis, and the results showed almost the same characteristics. It is shown that the single base mutation of the hTERC gene triggers programmed apoptosis of cancer cells. Figure 12

[0189] The above examples show that using the recombinant telomerase RNA gene mutant of the present application, by repairing the genetic defect telomere, the high telomerase activity of the genetic defect telomere is significantly reduced, the abnormal growth of senescent cells, cancer cells and hyperplastic tissues is significantly inhibited, and they are reversed into normal cell programmed apoptosis, thereby achieving the purpose of delaying aging, preventing cell carcinogenesis, treating cancer and hyperplastic diseases.

[0190] Finally, it should be particularly noted that the above examples are only part of the specific embodiments of the present application. Obviously, the present application is not limited to the above embodiments. Any way, modification technique, method and approach related to the repair of TC and TG genetic defect telomere to achieve the same purpose should be considered as the protection scope of the present application. SEQUENCE LISTING <110> Liu Xiaokuan ​​<120> A mutated human telomerase RNA gene and its application in the prevention and treatment of pan-cancer <130> IDC206048 <160> twenty four <170> PatentIn version 3.5 <210> 1 <211> 451 <212> DNA <213> people <400> 1 gggttgcgga gggtgggcct gggaggggtg gtggccattt tttgtctaac cctaactgag 60 aagggcgtag gcgccgtgct tttgctcccc gcgcgctgtt tttctcgctg actttcagcg 120 ggcggaaaag cctcggcctg ccgccttcca ccgttcattc tagagcaaac aaaaaatgtc 180 agctgctggc ccgttcgccc ctcccgggga cctgcggcgg gtcgcctgcc cagcccccga 240 accccgcctg gaggccgcgg tcggcccggg gcttctccgg aggcacccac tgccaccgcg 300 aagagttggg ctctgtcagc cgcgggtctc tcgggggcga gggcgaggtt caggcctttc 360 aggccgcagg aagaggaacg gagcgagtcc ccgcgcgcgg cgcgattccc tgagctgtgg 420 gacgtgcacc caggactcgg ctcacacatg c 451 <210> 2 <211> 11 <212> DNA <213> people <400> 2 ctaaccctaa c 11 <210> 3 <211> 17 <212> DNA <213> Artificial Sequence <400> 3 gcagtctacg agaccct 17 <210> 4 <211> 18 <212> DNA <213> Artificial Sequence <400> 4 tcgtagactg cgtaccga 18 <210> 5 <211> 23 <212> DNA <213> Artificial Sequence <400> 5 gaatcctgcg caccgagatt ctc 23 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <400> 6 cggtacgcag tctacgagac 20 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <400> 7 ttccattttt aaggtagtcg agg 23 <210> 8 <211> 23 <212> DNA <213> Artificial Sequence <400> 8 taaaaggcaa caaaaagcgg aag 23 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <400> 9 gtctaaccct gactgagaag g 21 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <400> 10 ccttctcagt cagggttaga c 21 <210> 11 <211> 27 <212> DNA <213> Artificial Sequence <400> 11 gcgtgaattc tccctttata agccgac 27 <210> 12 <211> 33 <212> DNA <213> Artificial Sequence <400> 12 caggatccaa aaaaaaatgg gggctcacaa gcc 33 <210> 13 <211> 21 <212> DNA <213> Artificial Sequence <400> 13 gtctaaccct cactgagaag g 21 <210> 14 <211> 21 <212> DNA <213> Artificial Sequence <400> 14 ccttctcagt gagggttaga c 21 <210> 15 <211> 451 <212> DNA <213> Human <400> 15 gggttgcgga gggtgggcct gggaggggtg gtggccattt tttgtctaac cctgactgag 60 aagggcgtag gcgccgtgct tttgctcccc gcgcgctgtt tttctcgctg actttcagcg 120 ggcggaaaag cctcggcctg ccgccttcca ccgttcattc tagagcaaac aaaaaatgtc 180 agctgctggc ccgttcgccc ctcccgggga cctgcggcgg gtcgcctgcc cagcccccga 240 accccgcctg gaggccgcgg tcggcccggg gcttctccgg aggcacccac tgccaccgcg 300 aagagttggg ctctgtcagc cgcgggtctc tcgggggcga gggcgaggtt caggcctttc 360 aggccgcagg aagaggaacg gagcgagtcc ccgcgcgcgg cgcgattccc tgagctgtgg 420 gacgtgcacc caggactcgg ctcacacatg c 451 <210> 16 <211> 451 <212> DNA <213> Human <400> 16 gggttgcgga gggtgggcct gggaggggtg gtggccattt tttgtctaac cctcactgag 60 aagggcgtag gcgccgtgct tttgctcccc gcgcgctgtt tttctcgctg actttcagcg 120 ggcggaaaag cctcggcctg ccgccttcca ccgttcattc tagagcaaac aaaaaatgtc 180 agctgctggc ccgttcgccc ctcccgggga cctgcggcgg gtcgcctgcc cagcccccga 240 accccgcctg gaggccgcgg tcggcccggg gcttctccgg aggcacccac tgccaccgcg 300 aagagttggg ctctgtcagc cgcgggtctc tcgggggcga gggcgaggtt caggcctttc 360 aggccgcagg aagaggaacg gagcgagtcc ccgcgcgcgg cgcgattccc tgagctgtgg 420 gacgtgcacc caggactcgg ctcacacatg c 451 <210> 17 <211> 26 <212> DNA <213> Artificial sequence <400> 17 acatacgtac acgcacctgt tcccag 26 <210> 18 <211> 29 <212> DNA <213> Artificial sequence <400> 18 tcctgaattc gcgggggtgg ccggggcca 29 <210> 19 <211> twenty one <212> DNA <213> Artificial sequence <400> 19 attacatacg tacacgcacc t 21 <210> 20 <211> 20 <212> DNA <213> Artificial sequence <400> 20 aacgggaaag cgaactgcat 20 <210> twenty one <211> twenty four <212> DNA <213> Artificial sequence <400> twenty one ggatccaatc cgtcgagcag agtt 24 <210> 22 <211> 24 <212> DNA <213> Artificial Sequence <400> 22 cccttaccct tacccttacc ctta 24 <210> 23 <211> 451 <212> RNA <213> Transript of Artificial Sequence or Mutated Human hTERC Gene I <400> 23 ggguugcgga gggugggccu gggaggggug guggccauuu uuugucuaac ccugacugag 60 aagggcguag gcgccgugcu uuugcucccc gcgcgcuguu uuucucgcug acuuucagcg 120 ggcggaaaag ccucggccug ccgccuucca ccguucauuc uagagcaaac aaaaaauguc 180 agcugcuggc ccguucgccc cucccgggga ccugcggcgg gucgccugcc cagcccccga 240 accccgccug gaggccgcgg ucggcccggg gcuucuccgg aggcacccac ugccaccgcg 300 aagaguuggg cucugucagc cgcgggucuc ucgggggcga gggcgagguu caggccuuuc 360 aggccgcagg aagaggaacg gagcgagucc ccgcgcgcgg cgcgauuccc ugagcugugg 420 gacgugcacc caggacucgg cucacacaug c 451 <210> 24 <211> 451 <212> RNA <213> Transcript of an artificial sequence or mutated human hTERC gene II <400> 24 ggguugcgga gggugggccu gggaggggug guggccauuu uuugucuaac ccucacugag 60 aagggcguag gcgccgugcu uuugcucccc gcgcgcuguu uuucucgcug acuuucagcg 120 ggcggaaaag ccucggccug ccgccuucca ccguucauuc uagagcaaac aaaaaauguc 180 agcugcuggc ccguucgccc cucccgggga ccugcggcgg gucgccugcc cagcccccga 240 accccgccug gaggccgcgg ucggcccggg gcuucuccgg aggcacccac ugccaccgcg 300 aagaguuggg cucugucagc cgcgggucuc ucgggggcga gggcgagguu caggccuuuc 360 aggccgcagg aagaggaacg gagcgagucc ccgcgcgcgg cgcgauuccc ugagcugugg 420 gacgugcacc caggacucgg cucacacaug c 451

Claims

1. A mutant human telomerase RNA gene (hTERC) having a nucleotide sequence that is mutated at the nucleotide corresponding to position 54 of SEQ ID NO. 1 from "A" to "G" or "C" as compared to the nucleotide sequence of a wild-type hTERC gene set forth in SEQ ID NO.

1.

2. The mutant human telomerase RNA gene of claim 1, having a nucleotide sequence selected from the group consisting of SEQ ID NO. 15 or SEQ ID NO.

16.

3. A nucleic acid construct comprising a nucleic acid sequence encoding the mutant human telomerase RNA gene of claim 1 or 2 operably linked to a promoter.

4. The nucleic acid construct of claim 3, wherein the promoter is a constitutive promoter or an inducible promoter.

5. The nucleic acid construct of claim 3, wherein the promoter is a tissue-specific promoter.

6. The nucleic acid construct of claim 3, wherein the promoter is a cancer cell-specific promoter.

7. An expression vector comprising the nucleic acid construct of any one of claims 3-6.

8. The expression vector of claim 7, selected from the group consisting of a plasmid, a virus, or a bacteriophage.

9. The expression vector of claim 7, wherein the expression vector is a phagemid.

10. The expression vector of claim 7, wherein the expression vector is selected from the group consisting of a retroviral vector, an adenoviral vector, an adeno-associated viral vector, or a herpes viral vector.

11. The expression vector of claim 7, wherein the expression vector is an AD5 replication-deficient adenoviral vector or a human low serum positive rate chimpanzee adenoviral vector.

12. A mutant human telomerase RNA having a ribonucleic acid sequence identical to that transcribed from the mutant human telomerase RNA gene of claim 1 or 2.

13. The human telomerase RNA of claim 12, having a ribonucleic acid sequence of SEQ ID NO. 23 or SEQ ID NO.

24.

14. The human telomerase RNA of claim 12, which is synthesized in vitro.

15. A composition comprising the mutant human telomerase RNA gene of claim 1 or 2, the nucleic acid construct of any one of claims 3-6, the expression vector of any one of claims 7-11, or the mutant human telomerase RNA of any one of claims 12-14.

16. The composition of claim 15, further comprising a delivery vehicle.

17. The composition of claim 15, further comprising a packaged viral particle, a nanoparticle, or a microvesicle.

18. The composition of claim 15, further comprising a liposome.

19. A pharmaceutical composition comprising the mutant human telomerase RNA gene of any one of claims 1 or 2, the nucleic acid construct of any one of claims 3-6, the expression vector of any one of claims 7-11, the mutant human telomerase RNA of any one of claims 12-14, and / or the composition of any one of claims 15-18, and a pharmaceutically acceptable carrier.

20. Use of the mutant human telomerase RNA gene of claims 1 or 2, the nucleic acid construct of any one of claims 3-6, the expression vector of any one of claims 7-11, the mutant human telomerase RNA of any one of claims 12-14, or the composition of any one of claims 15-18, in the manufacture of a medicament for administration to a subject for the prevention or treatment of, or delay in the progression of, a tumor, wherein the tumor is breast cancer or cervical cancer.

21. The use of claim 20, wherein the subject has cancer or is at high risk of developing cancer.

22. The use of claim 20, wherein the subject is in a critical period of developing cancer.

Images