An orange Myxococcus and its application in biological control of plant bacterial diseases

Abstract

The present invention discloses an orange sticky coccus and its application in biological control of plant bacterial diseases, belonging to the field of microbial technology. The bacterium is deposited in the General Microbiological Center of China Microorganism Culture Collection Administration Committee, the deposit date is May 30, 2022, and the deposit number is CGMCCNO.24981. The orange sticky coccus WCH05 described in the present invention has good predation ability on a variety of plant pathogenic bacteria such as amylopectin, bacterial soft rot, pepper bacterial leaf spot, pear rust water pathogen, and melon bacterial fruit spot, showing a broad spectrum of anti-pathogenic bacteria. The test of in vitro inflorescence of fragrant pear and potted pear seedlings showed that orange sticky coccus WCH05 has good preventive and therapeutic control effects on amylopectin, is a strain with high prevention effect, good environmental safety, and is not easy to produce drug resistance. It has great application potential in the biological control of plant bacterial diseases and predation of pathogens.

Description

Technical Field

[0001] The present invention relates to the technical field of microbiology, and more particularly to a strain of Myxococcus fulvus and its application in biological control of plant bacterial diseases. Background Art

[0002] Plant diseases endanger agricultural production and cause huge economic losses. The research on their prevention and control has important practical significance. At present, various prevention and control methods have their limitations: chemical pesticides are not friendly to the environment and are prone to induce drug resistance; agricultural measures are time-consuming and laborious; disease-resistant breeding work is difficult and the traits are unstable; although the microbial biological control technology takes effect slowly, it has the advantages of not polluting the environment, being safe for humans and other organisms, having a long-lasting control effect, no residue, strong specificity in killing diseases, being easy to coordinate and cooperate with other prevention and control measures, and saving energy, so it has broad development prospects. In today's world, people pay increasing attention to environmental protection and the demand for pollution-free products is constantly increasing. The microbial biological control technology that meets the requirements of agricultural sustainable development has gradually become an important means for plant disease control.

[0003] Fire blight of pear is the most devastating bacterial disease caused by Erwinia amylovora infecting a variety of Rosaceae plants. It is a class I crop disease and a quarantine harmful organism for agricultural plants in China. The disease has a wide host range and harms more than 220 species of plants in more than 40 genera of Rosaceae. Among them, the most severely affected are Rosaceae pome fruit trees such as pears, apples, hawthorns and Chinese flowering crabapples. The pathogen infects flowers, leaves, young shoots, young fruits, branches and trunks, causing flower wilt, leaves withering but not falling like being burned, young shoots dying into a "shepherd's crook", fruits rotting, turning black and wrinkling. When the disease is severe, the spreading speed is extremely fast. It can spread from the diseased young organs to the main branches and trunks within just a few weeks, and even to the roots, causing the whole plant to die, and can destroy the entire orchard within one to several growing seasons, causing serious economic losses.

[0004] Pear rust water disease is a new bacterial disease that specifically harms the branches and trunks of pear trees in China. It was first discovered in the Xuhuai area of Jiangsu and also occurs in places such as Zhejiang, Shandong, Dezhou and Xinjiang. Its pathogen was recently identified as Dickeya fangzhongdai, a new species in the genus Dickeya. It mainly harms the main trunks and backbone branches of pear trees. In the initial stage of the disease, it is not easy to be detected, and there are no disease spots on the surface, and the epidermal color is normal. For branches with less rust water and less severe disease, the withering is slow or does not wither, the leaves turn red and fall early, and the tree vigor weakens. The early symptoms of diseased fruits are not obvious, or water-soaked disease spots appear on the fruit skin, causing the fruits to rot.

[0005] Bacterial soft rot is a global disease, mainly caused by infection with Pectobacterium carotovorum subsp. Carotovorum (Pcc). The host range of Pcc is very wide, and many vegetables and flower plants such as Chinese cabbage, potato, radish, tulip, Clivia, hyacinth, etc. can serve as its hosts to cause soft rot. It can cause serious yield and economic losses in crop field production and storage, etc. Once the disease occurs, it is difficult to control.

[0006] Bacterial fruit blotch of cucurbitaceae, also known as bacterial fruit rot of watermelon, bacterial fruit blotch of watermelon, etc., is a highly dangerous quarantine seed-borne disease caused by Acidovorax citrulli. This pathogen mainly infects cucurbitaceae crops such as watermelon, melon, cantaloupe, netted melon, honeydew melon, muskmelon, cucumber and pumpkin. In addition, it can also infect crops such as tomato, pepper and eggplant.

[0007] Pseudomonas syringae pv. syringae is one of the pathogens of bacterial leaf spot of pepper. This disease is the main disease on pepper in the southern Xinjiang region, and some severely diseased fields cause a 20%-30% reduction in yield. In addition to damaging pepper, this pathogen can also infect many plants of Solanaceae such as tomato, eggplant, potato, as well as Cucurbitaceae, Leguminosae, Cruciferae, Umbelliferae, etc. through artificial inoculation.

[0008] For plant diseases caused by pathogens, the strategy of separating and applying antagonistic bacteria for biological control was formed relatively early. Therefore, the research in this field is the most active and has the most practical significance. So far, researchers have screened a large number of antagonistic bacterial strains with the effect of inhibiting plant pathogens, including Bacillus, Streptomyces, Pseudomonas, Paenibacillus and Trichoderma, etc. The main biocontrol mechanisms of these strains are to produce various antibiotic substances, toxins, bacteriocins, proteinaceous antibacterial substances, etc. that antagonize pathogens during their growth and metabolism, so as to achieve the effect of inhibiting or killing pathogens. Due to the large influence of environmental factors on the production of secondary metabolites, such antagonistic bacterial strains often face problems such as unstable control efficacy and poor persistence when applied in the field.

[0009] Myxobacteria are a type of higher prokaryotes with multicellular group behaviors and complex life histories. They have a wide range of predatory abilities against bacteria and fungi and are recognized as a type of generalist microbial predator. Related reported studies have demonstrated that myxobacteria can prey on and antagonize pathogenic bacteria through strategies such as secreting lytic enzymes to the outside, synthesizing antibacterial metabolites, and regulating the structure of soil microbial communities, and are regarded as a type of new biocontrol microorganisms. As new biocontrol strains, myxobacteria have characteristics superior to those of reported biocontrol bacteria, including rich and diverse predatory strategies, a wide prey spectrum, good colonization ability, the ability to produce abundant new secondary metabolites, the ability to produce myxospores with strong stress resistance, and participation in the metabolism of soil organic matter. These characteristics give myxobacteria good advantages as biocontrol bacteria. However, most current studies focus on the developmental characteristics of myxobacteria and the research on their metabolites as drug lead compounds, while the research and application of myxobacteria in the control of plant diseases during agricultural production are less. Currently, the main patent protections include the applications of Myxococcus sp. e-3-1, Polyangium sp. 8#-3, and Cystobacter sp. XJ9-1 applied for by the Guangdong Institute of Microbiology in the preparation of drugs for preying on and inhibiting plant pathogenic bacteria (201611095485.2); the application of myxobacterium M34 in inhibiting plant pathogenic bacteria (202010469601.2); the application of Myxococcus stipitatus BS in the biological control of bacterial diseases (201711363218.3). However, there are significant differences in the antibacterial effects among different species and strains of myxobacteria. For example, Bacillus shows different antibacterial characteristics against plant pathogenic bacteria, and related strains have also applied for patent protections (201380042989.6; 201410164779.0; 201510666311.6, etc.). And there is no report on the application of Myxococcus fulvus in the biological control of Erwinia amylovora, Pectobacterium carotovorum subsp. carotovorum, Physalospora piricola, Xanthomonas campestris pv. vesicatoria, and Acidovorax avenae subsp. citrulli. Therefore, based on the current status of patent protection for existing biocontrol bacteria, especially myxobacteria as a type of biocontrol microorganism with application potential, new myxobacteria with different characteristics and good biocontrol abilities are of great significance for the biological control of plant diseases. Summary of the Invention

[0010] In view of the above problems, the present invention provides the application of a strain of Myxococcus fulvus WCH05 in the biological control of plant bacterial diseases.

[0011] A strain of Myxococcus fulvus WCH05, which is deposited in the General Microbiology Center of the China Committee for Culture Collection of Microorganisms. The deposit address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The deposit date is May 30, 2022, and the deposit number is CGMCC NO. 24981.

[0012] The fermentation culture broth of Myxococcus fulvus WCH05 described in the present invention.

[0013] A biological bactericide with Myxococcus fulvus WCH05 described in the present invention as the active ingredient.

[0014] A biological fertilizer with Myxococcus fulvus WCH05 described in the present invention as the active ingredient.

[0015] The application of Myxococcus fulvus WCH05 described in the present invention in the biological control of plant bacterial diseases and the predation of plant pathogenic bacteria.

[0016] The application of the fermentation culture broth of Myxococcus fulvus WCH05 described in the present invention in the biological control of plant bacterial diseases and the predation of plant pathogenic bacteria.

[0017] For the application described above, the plant pathogenic bacteria include Erwinia amylovora, Pectobacterterium carotovorum subsp. Carotovorum, Dickeya fangzhongdai, Acidovorax citrulli, and Pseudomonas syringae pv. Syringae.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] The present invention successfully screened a myxobacterium strain WCH05 from the collected soil samples by using the rabbit dung fruiting body induction method. After identification, it is Myxococcus fulvus. This strain shows strong predation ability against a variety of plant pathogenic bacteria, indicating broad-spectrum resistance to plant pathogenic bacteria. Based on plate predation experiments, in vitro inflorescence and potted Pyrus betulifolia seedling experiments, it shows that the myxobacterium (Myxococcus fulvus) WCH05 involved in the present invention has a good control effect on fire blight. The present invention has a significant disease prevention effect, is pollution-free to the environment, is beneficial to the production of green and pollution-free agricultural products and ecological environment protection. It is a biocontrol strain with good application prospects and shows great application potential in the control of plant pathogenic bacteria. Description of the Drawings

[0020] Figure 1 For the morphology of strain WCH05, where Figure 1 a is the morphological diagram of the fruiting body; Figure 1 b is the morphological diagram of the mycelial film of strain WCH05 inoculated on VY / 4 solid medium; Figure 1 c is the morphological diagram under the oil immersion microscope after Gram staining;

[0021] Figure 2 a is the phylogenetic tree constructed with the 16S rDNA gene, Figure 2 b is the phylogenetic tree constructed with the lepA gene;

[0022] Figure 3 For the results of the mycelial prey experiment of the myxobacterium strain WCH05;

[0023] Figure 4 For the remaining viable counts of 5 pathogenic bacteria after 5 days of the mycelial prey experiment;

[0024] Figure 5 For the confrontation culture results of the myxobacterium strain WCH05 and 5 pathogenic bacteria;

[0025] Figure 6 For the remaining viable counts of 5 pathogenic bacteria after 5 days of the confrontation culture;

[0026] Figure 7 For the control effect diagram of the myxobacterium strain WCH05 on Erwinia amylovora by using the detached inflorescence of fragrant pear. Specific implementation manners

[0027] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative efforts belong to the scope of protection of the present invention.

[0028] The culture media used in the following embodiments are specifically described as follows:

[0029] LB medium: Tryptone 10.0 g / L, yeast extract 5.0 g / L, NaCl 10.0 g / L, agar powder 15 g / L, pH 7.0.

[0030] LBS liquid medium: Soluble starch 7.0 g / L, tryptone 1.0 g / L, yeast extract 5.0 g / L, MgSO 4 ·7H 2 O 1.0 g / L, pH 7.2 - 7.4.

[0031] VY / 4 Medium: 2.5 g / L of Angel Yeast, 1.0 g / L of CaCl 2 1.0 g / L, 15 g / L of agar powder, pH 7.2 - 7.4.

[0032] VY / 2 Liquid Medium: 5.0 g / L of Angel Yeast, 1.0 g / L of CaCl 2 1.0 g / L, pH 7.2. After sterilization, VB 12 (Final concentration is 50 μg / mL) is added.

[0033] WCX Medium: 1.0 g / L of CaCl 2 1.0 g / L, 15 g / L of agar powder, pH 7.2. After sterilization, cycloheximide is added to a final concentration of 25 μg / mL.

[0034] TPM Medium: 10.0 mmol / L Tris - HCl, 1.0 mmol / L KH 2 PO 4 ,MgSO 4 ·7H 2 O 1.97 g / L, 15 g / L of agar powder.

[0035] Example 1 Isolation, Purification and Growth Characteristics of Myxobacteria

[0036] 1. Collection of Soil Samples

[0037] Soil samples were collected from different regions in Xinjiang, immediately air - dried naturally after removing stones, and stored dry at room temperature.

[0038] 2. Pretreatment of Soil Samples

[0039] Weigh 10 - 15 g of soil samples, remove small stones and plastic film residues with a sieve (40 mesh), place them in a sterile petri dish, treat them in an oven at 65 °C for 30 min, and after the soil samples cool down, add a cycloheximide solution (final concentration is 25 μg / mL) to soak them thoroughly and soak overnight at room temperature.

[0040] 3. Induction of Myxobacterial Fruiting Bodies

[0041] (1) Rabbit - dung Induction Method: Remove the residual liquid in the soil in a laminar flow hood, half - embed 2 - 4 sterile rabbit - dungs on the surface of the soil sample, incubate at 30 °C with constant humidity, and start observing the formation of fruiting bodies on the rabbit - dungs after 72 h.

[0042] (2) Predation bacterium induction method: Escherichia coli and Erwinia amylovora were used as predation bacteria and inoculated into LB liquid medium respectively. They were cultured overnight at 30 °C with shaking. 1 mL of the bacterial suspension was taken and placed in a centrifuge tube, centrifuged at 12,000 rpm for 1 min, the thalli were collected, rinsed 3 times with sterile water, and 100 μL was left as the bacterial suspension. A sterile inoculation loop was used to pick up the bacterial suspension and draw a "field" - shaped line on the surface of WCX medium containing cycloheximide (final concentration of 25 μg / mL). After drying, a small amount of pre - treated soil sample was placed in the center of each of the four squares, and cultured at 30 °C with constant humidity. After 72 h, the formation of fruiting bodies was observed.

[0043] 4. Purification of Myxobacteria

[0044] Under a stereomicroscope, the fruiting bodies induced in rabbit feces or WCX liquid medium were picked with the tip of a sterilized fine needle and spot - inoculated on the surface of VY / 4 plate medium, and cultured at a constant temperature of 30 °C. When a transparent bacterial film grew, the outer edge of the transparent bacterial film was promptly picked and transferred to a fresh VY / 4 plate for further purification until no contaminants grew.

[0045] 5. Pure culture test and strain preservation of Myxobacteria

[0046] The isolated and purified strain was inoculated into LB liquid medium and cultured overnight at 30 °C with shaking at 180 rpm. If the medium was clear and transparent, it indicated that the myxobacterium was a pure strain (myxobacteria do not grow in LB liquid medium); if the medium was turbid, it proved that there were other contaminants in the myxobacterial colonies. The pure strain was transferred into 20% glycerol and stored in a - 80 °C refrigerator; or the purified myxobacteria were adhered to the surface of sterile rabbit feces, cultured at 30 °C for 5 - 8 d, and after the formation of fruiting bodies, the rabbit feces were transferred into a sterile centrifuge tube and dried at room temperature for preservation.

[0047] 6. One strain of myxobacterium was isolated and purified from the saline - alkali soil without vegetation cover in Huoshaoshan, Wucaiwan, Jimsar County, Changji Prefecture, Xinjiang by using the rabbit - feces induction method, and named WCH05.

[0048] Example 2 Identification of Strain WCH05

[0049] (1) Observation of the morphology and cultural characteristics of strain WCH05

[0050] When strain WCH05 was inoculated on VY / 4 solid medium, the bacterial film expanded in a semi - transparent film shape ( Figure 1 b), and there were regularly arranged fruiting bodies on the bacterial film; under a stereomicroscope, the morphology of the fruiting bodies was mostly spherical or ovoid, solitary, and the color was orange - yellow ( Figure 1 a); after Gram staining and observation under an oil microscope, it was found that the vegetative cells were rod - shaped and the myxospores were spherical ( Figure 1c).

[0051] (2) Growth characteristics of strain WCH05

[0052] Using VY / 4 medium as the basal medium, the effects of different NaCl concentrations (0 - 6%) and different initial pH values (6.0 - 9.0) on strain WCH05 were determined. The results showed that the strain grew most suitably in the medium without NaCl and in the medium with an initial pH of 7.5. However, the strain was still able to grow in the culture environment with a 5% NaCl concentration and an initial pH of 9.0. This indicates that the bacterium is a halotolerant myxobacterium that has long adapted to saline-alkali soil environments.

[0053] (3) Sequencing and analysis of 16S rRNA and lepA genes of strain WCH05

[0054] The total DNA of myxobacteria was extracted using a bacterial genomic DNA extraction kit (TIANamp Bacteria DNA Kit, TIANGEN). The 16S rDNA gene was amplified using the universal bacterial primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’, SEQ ID No:1) and 1492R (5’-TACGGCTACCTTGTTACGACTT-3’, SEQ ID No:2); the housekeeping gene lepA was amplified using the primers lepAF (5’-CATCGCCCACATCGAYCAYGGNAA-3’, SEQ ID No:3) and lepAR (5’-CATGTGCAGCAGGCCNARRAANCC-3’, SEQ ID No:4). The PCR reaction system was 25 μL: 1.0 μL of DNA template, 1.0 μL of each 10 μmol / L primer pair, 1.5 μL of 10 mmol / L dNTPs, 2.5 μL of 10×PCR Buffer (2.5 mmol / L MgCl 2 ) 2.5 μL, 0.5 μL of 2.5 U / μL Taq DNA polymerase, and made up to 25 μL with sterilized ultrapure water. The reaction conditions were: pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, extension at 72 °C for 60 s, for 35 cycles; extension at 72 °C for 10 min, and stored at 4 °C. After the amplified products were detected by 10 g / L agarose gel electrophoresis, the PCR products were cloned and sequenced by Shanghai Sangon Biotech Co., Ltd. The 16S rDNA sequencing results are shown in SEQ ID No:5, and the lepA gene sequencing results are shown in SEQ ID No:6.

[0055] The 16S rDNA gene sequence of Myxococcus fulvus WCH05 is as follows:

[0056]

[0057] The lepA gene of Myxococcus fulvus WCH05 is as follows:

[0058] cgctcctcgacagacggggacgctgagcaagcgcgaggcgcaggcccagttcctcgacaacatggacatcgagcgcgaacggggcatcaccatcaaggcccagtccgtgcggatgaactacacggcgaaggacggcaagcagtacgtcctgaacctcatcgacacgccggggcacgtggacttcgcctacgaggtgagccgcagcctggccgcgtgcgagggcgcgctgctggtggtggacgcgtcgcagggcgtggaggcgcagacgctcgccaacgtctacatggcgttggaccacgacctggagatcatcccggtcatcaacaagattgatttgcccagcgccgacgtcgaccgcacgcgcgccgagatcgaagacgtcatcggcatcgacgcgtcggtggccgtgcccgcgtccgcgaaggagggcatcggcatccacgagatcctcgagtccgtggtggcccgcgtgcccccgccgacgggcatgccggacgcaccgctcaaggccctgatcttcgactcctggtacgacaactaccggggcgtggtgacgctggtgcgcgtgctcgagggcacgctgaagctcaagcagaagatcaagctgtggagcaacaacaaggccttcgaggtcatggagctgggtgtcttcagcccgttctcccgtccggtgacgcagttgatggccggcgaggtgggcgtgctggtggccaacatcaaggagctccaggacgccaaggtcggtgacaccgtcacggaggaggcccgccccaccgcggagccgttccctggcttccaggaagtcaagccgatggtgttctccggcatcttcccggtggactcggaccagtacgagaacctgcgcgacgcgctggcgaagctgaagctcaacgactccgccttcacgtacgagcccgagtcctccacgcgctcgct CGCTCCGACAGACGGGGTGCTGAGCAAGCGCGAGGCGCAGGCCAGTTCCGACAACATGGACATCGAGCGCGAACGGGGCATCACATCAAGGCCCAGTCCGTGCGGATGAACTACACGGCGAAGGACGGCAAGCAGTACGTCCTGAACCTCATCGACACGCCGGGGCACGTGGACTTCGCTTACGAGGTGAGCCGCAGCCTGGCCGCGTGCAGGGCGCGCTGCTGGTGGTCGACGCGTCGCAGGGCGTGGAGGCGCAGACGCTCGCCAACGTCTACATGGCAGTGGACCACGACCTGGAGATCATCCCGGTCTCAACAAGATTGATTTGCCCAACGCCGACGTCGACCACGCGCGCCGAGATCGAAGACGTCATCGGCATCGACGCGTCGGTGGCCGTGCCCGCGTCCGCGAAGGAGGGCGATCGGCATCCACGAGATCCGAGTCCGTGGTCGCCCGCGTGCACCCGCCGACGGGGCATGCCGGACGCACCGCTCAAGGCCCAGATCTTCGACTCCGGGTACGACAACTACCGGGGCGTGGTCGACGCTGGTGCGCGTGCAGGGCGACGCTGAAGCTCAACGACAAGATCAAGCTGTGGAGCAACAACAAGGCCTTCGAGGTGATGGAGCTGGGCGTCTTCAGCCCGTTCTCCCGTCCGGTGACGCGTTGATGGCCGGCGAAGGTGGGCGTGCAGGTGGCCAACATCAAGGAGCTCCAGGACGCCAAGGTGGTCGACACCGTCCACGGAGGA GGCCCGCCCCACCACGGAGCCGTTCCCTGGCTTCCAGGAATCAAGCCGATGGCGTTCTCCGGATCTTCCCAGGTGGACTCCGACCAGTACGAGAACCACGCGACGCGCTGGCGAAGCTGAACGACTCCGCTTTCACGTACGAGCCCGAGTCCACACGCGCTCGCT

[0059] The sequencing results of the 16S rDNA gene and the housekeeping gene lepA were compared in NCBI, and the phylogenetic trees of the two genes were constructed using the neighbor-joining method in MEGA 5.0 software. The results showed ( Figure 2 ), the phylogenetic trees constructed based on the 16S rDNA and lepA genes both clustered Myxobacteria WCH05 into the genus Myxococcus, and they were clustered into the same phylogenetic branch with the reference strains of Myxococcus fulvus in the phylogenetic trees. The homology of the 16S rDNA and lepA genes was 100% and 98% respectively. Based on the comprehensive morphological characteristics, physiological and biochemical properties, and molecular identification results, strain WCH05 was identified as Myxococcus fulvus. The strain has been deposited in the international depository authority for microorganisms under the Budapest Treaty: the General Microbiological Center of the China Committee for Culture Collection of Microorganisms (abbreviated as CGMCC). The deposit address: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The deposit date was May 30, 2022, and the deposit number was CGMCC No. 24981.

[0060] Example 3 Determination of the ability of Myxobacteria to prey on phytopathogenic bacteria

[0061] 1. Preparation of pathogenic bacteria and Myxobacteria

[0062] Activate Erwinia amylovora (Ea), Pectobacterium carotovorum subsp. carotovorum (Pcc), Dickeya fangzhongdai (Df), Acidovorax citrulli (Ac), and Pseudomonas syringae pv. syringae (Pss). Pick single colonies and inoculate them into LB liquid medium. Incubate them in a constant temperature shaker at 30 °C and 160 rpm for 24 h. Centrifuge at 12,000 rpm for 1 min, collect the bacterial cells, rinse them three times with sterile water, and then resuspend them with TPM culture medium for standby. After activating the pure culture of Myxobacteria on VY / 4 plates, scrape an appropriate amount of Myxobacteria colonies and transfer them to LBS liquid medium. Incubate them at 30 °C and 160 rpm for 3 - 4 days. Centrifuge the prepared Myxobacteria suspension at 12,000 rpm for 1 min, remove the supernatant and collect the bacterial cells, then wash them 3 times with TPM liquid medium, and finally resuspend them with 500 μL of TPM liquid medium for standby.

[0063] 2. Evaluation of the Ability of Myxobacteria to Predate on Phytopathogenic Bacteria

[0064] (1) Bacterial lawn predation test: Vertically suspend and inoculate 50 μL of the phytopathogenic bacterial suspension on the TPM nutrient-free solid medium. After natural air drying, inoculate 3 μL of the myxobacterial suspension in the center of the phytopathogenic bacterial lawn and let it air dry naturally (recorded as the WCH05 treatment). Use the treatment without inoculating myxobacteria in the center of the phytopathogenic bacterial lawn as the control group (recorded as CK), and incubate at a constant temperature of 30 °C for 5 days. Observe the expansion of myxobacteria at 1, 3, and 5 days. And on the 5th day, scrape the bacterial lawn with a sterile capillary tube and mix it with 1 mL of sterile water. Using the dilution plating method, take 100 μL from each gradient and spread it evenly on the LB plate. Place the plate in a constant temperature incubator at 30 °C until single colonies grow out. Count the number of phytopathogenic bacterial colonies, calculate the number of residual live cells, and evaluate the predation ability.

[0065] (2) Confrontation culture test: Vertically suspend and spot-inoculate 50 μL of the phytopathogenic bacterial suspension on the TPM solid medium. After natural air drying, spot-inoculate 3 μL of the myxobacterial suspension at a position adjacent to the edge of the phytopathogenic bacterial lawn (recorded as the WCH05 treatment). In the control group, spot-inoculate 3 μL of the TPM liquid medium at a position adjacent to the edge of the Erwinia amylovora bacterial lawn (recorded as CK). After air drying, place it in a constant temperature incubator at 30 °C for incubation. Observe the movement direction and movement distance of myxobacteria at 1, 3, and 5 days. And on the 5th day, scrape the bacterial lawn with a sterile capillary tube and mix it with 1 mL of sterile water. Using the dilution plating method, take 100 μL from each gradient and spread it evenly on the LB plate. Place the plate in a constant temperature incubator at 30 °C until single colonies grow out. Count the number of phytopathogenic bacterial colonies, calculate the number of residual live cells, and evaluate the predation ability.

[0066] 3. The results of the bacterial lawn test show that ( Figures 3-4 ), after 1 day of culture, it can be observed that myxobacteria can grow diffusively using phytopathogenic bacteria as nutrients. After 5 days of culture, myxobacteria can completely spread and cover the entire phytopathogenic bacterial lawn, and fruiting bodies are formed in the crossed area, indicating that myxobacteria WCH05 has good predation characteristics. At this time, scrape the entire colony and count the amount of residual live cells of phytopathogenic bacteria in the LB solid plate by the dilution plating method. It is found that the strain WCH05 has the strongest predation ability against Erwinia amylovora, and the residual live cells decrease from 10 8 cfu / mL to 10 3 cfu / mL. The residual live cells of the other 4 phytopathogenic bacteria decrease from 10 9 cfu / mL to 10 5 ~10 6 cfu / mL. It shows that myxobacteria WCH05 has good predation ability against a variety of phytopathogenic bacteria, demonstrating its good broad-spectrum anti-phytopathogenic bacteria ability.

[0067] To further statistically analyze and evaluate the motility and predatory ability of the myxobacterium strain WCH05, the myxobacterium strain WCH05 was co-cultured with 5 pathogenic bacteria, and the motility direction and expansion rate of the myxobacterium were observed at regular intervals. The results showed that the myxobacterium strain WCH05 had an obvious tropic movement towards the 5 pathogenic bacteria and was able to cover and prey on the bacterial lawns of the pathogenic bacteria. After 5 days, the bacterial lawns were scraped and diluted for plating, and the number of residual viable cells of the pathogenic bacteria was calculated. The results indicated that the strain WCH05 had the strongest ability to expand outward and prey on Erwinia amylovora, and the residual viable cell count of Erwinia amylovora decreased from 10 8 cfu / mL to 10 4 cfu / mL, and the residual viable cells of the other 4 pathogenic bacteria decreased from 10 9 cfu / mL to 10 7 cfu / mL.( Figures 5-6 ).

[0068] Example 4 Determination of the antibacterial ability of the extracellular metabolites of the myxobacterium strain WCH05 against Erwinia amylovora

[0069] 1. Effect of the fermentation supernatant of strain WCH05 on the growth of Erwinia amylovora

[0070] The myxobacterium strain was inoculated into LBS liquid medium and cultured with shaking at 30 °C and 160 rpm until the stationary phase. The supernatant was collected by centrifugation at 12,000 rpm for 20 min and filtered through a 0.22 μm bacterial filter to obtain a sterile fermentation supernatant. 1 mL of the sterile fermentation supernatant was co-cultured with 100 μL of the Erwinia amylovora bacterial suspension, and the experiment was repeated 3 times. After static culture at 30 °C for 24 h, it was diluted for plating to count the number of residual viable cells of Erwinia amylovora, with the heat-boiled treatment of the fermentation supernatant and normal saline as controls.

[0071] 2. Effect of the secondary metabolites of strain WCH05 on the growth of Erwinia amylovora

[0072] Referring to the preparation methods in the invention patents (201611095485.2, 201711363218.3), inoculate the myxobacterium WCH05 into the VY / 2 liquid medium, culture at 30 °C and 160 rpm for 5 days, centrifuge at 8000 rpm, and collect the thalli and the supernatant of the fermentation broth. The fermentation supernatant is extracted with an equal volume of ethyl acetate for 12 h. After the extract is rotary evaporated, the extract is dissolved in methanol to obtain the fermentation broth extract. The thalli are soaked in acetone and then ultrasonically disrupted, and then extracted with ethyl acetate for 12 h. After the extract is rotary evaporated, the extract is dissolved in methanol to obtain the thallus disrupted liquid extract. The fermentation broth extract and the thallus disrupted liquid extract are respectively dissolved in methanol at concentrations of 50 mg / mL and 100 mg / mL. Inoculate Erwinia amylovora into the LB liquid medium and culture at 180 rpm and 30 °C until the logarithmic phase. Mix the logarithmic-phase Erwinia amylovora bacterial suspension with the LB medium (in liquid state) at about 50 °C in a volume ratio of 1:100, shake well and add 20 mL to each petri dish. Adhere 6-mm-diameter filter paper discs dropped with 5 μL of solutions of the fermentation broth extract or the thallus disrupted liquid extract at different concentrations on the plate. Measure the diameter of the inhibition zone after culturing at 37 °C for 24 - 36 h.

[0073] The results showed that neither the sterile fermentation supernatant nor the secondary metabolites of the strain WCH05 had an antibacterial effect on the growth of Erwinia amylovora. Combining the results obtained in Example 3 indicated that the antibacterial effect of the strain WCH05 on Erwinia amylovora was completely achieved by directly contacting and preying on Erwinia amylovora. This antibacterial property was significantly different from Myxococcus sp. e-3-1 involved in the invention patent (201611095485.2) and Myxococcus stipitatus BS involved in the invention patent (201711363218.3). Among them, the metabolites produced by Myxococcus sp. e-3-1 had good antibacterial effects, while although the antibacterial effect of Myxococcus stipitatus BS was mainly achieved through the predation of myxobacteria, its sterile fermentation broth and secondary metabolites still had partial antibacterial effects on pathogenic bacteria.

[0074] Example 5 Evaluation of the biocontrol effect of the myxobacterium strain WCH05 on fire blight

[0075] 1. Preparation of myxobacteria and pathogen inoculation solutions

[0076] Inoculate the activated myxobacterium strain into 3 mL of LBS liquid medium, culture at 30 °C and 160 rpm for 24 h, and then inoculate all of it into 200 mL of VY / 4 liquid medium, culture at 30 °C and 160 rpm for 3 - 4 days. Activate Erwinia amylovora, pick a single colony and inoculate it into the LB liquid medium, and culture it in a constant temperature shaker at 28 °C and 160 rpm for 24 h until the OD of the bacterial liquid600 =1.0, dilute to 10 with sterile water 7 cfu / mL, for future use.

[0077] 2. Determination of the control effect of myxobacterium strain WCH05 on fire blight of pear in vitro

[0078] Flower branches were collected in the pear orchard and inserted into a 0.05% NaCl solution for moisture preservation and preservation. The pear inflorescence was sprayed with the myxobacterial liquid using a handheld pressure sprayer, and the pathogen liquid was sprayed after culturing in an artificial climate box at 28°C and 70% air humidity for 24 hours. The inoculated inflorescence was placed in an artificial climate box at 28°C and 70% air humidity. The disease was observed and recorded regularly after 3d, 4d, 5d and 7d, and the flower rot rate was counted and the prevention effect was calculated. At the same time, sterile water was used instead of the myxobacterial fermentation liquid, and then the pathogen liquid was sprayed as CK. At the same time, a 4000-fold solution of agricultural streptomycin (produced by North China Pharmaceutical Factory, with an effective ingredient of 72%) was sprayed, and then the pathogen liquid was sprayed as a control, and only sterile water was sprayed as a blank control. After the test, the diseased plant materials were sterilized by dry heat and destroyed. Flower rot rate (%) = (number of diseased flowers / total number of flowers) × 100%; Flower rot prevention effect (%) = (control flower rot rate-treated flower rot rate) / control flower rot rate × 100%.

[0079] The results showed (Table 1, Figure 7 ), sprayed the fermented liquid of myxobacteria on the in vitro fragrant pear inflorescence, and then inoculated with pathogens, and then investigated the flower rot rate of each treatment at 3d, 4d, 5d and 7d, and calculated the protective efficacy. The control without spraying the fermented liquid of myxobacteria began to show flower rot symptoms in the anthers, stigmas, nectaries, calyx, ovary, pedicel, etc. of the fragrant pear inflorescence on the second day after the inoculation of pathogens, while the treatment of spraying myxobacteria WCH05 could delay the appearance of flower rot symptoms to a certain extent and reduce the flower rot rate. Its average 7d protection effect reached 71.46%, which is equivalent to the protection effect of agricultural streptomycin (70.89%).

[0080] Table 1 Determination of the efficacy of myxobacterium strain WCH05 against fire blight of detached inflorescences

[0081]

[0082] 3. Potted experiment of Pyrus betula to determine the control effect of myxobacterium strain WCH05 on fire blight

[0083] (1) Protective effect of myxobacteria against fire blight

[0084] The experiment was conducted in a greenhouse, and two-year-old potted Pyrus betulifolia Bunge seedlings were selected as inoculation materials. The fermentation broth of the tested myxobacteria was sprayed onto the leaves and branches with a handheld pressure sprayer until they were completely wet. After 24 h, the pathogen suspension was sprayed for inoculation. For each myxobacterial strain, three pots (about 20 branches per pot) were sprayed, and the experiment was repeated three times. At the same time, a control with 4000-fold solution of agricultural streptomycin (North China Pharmaceutical Factory, with 72% active ingredient) and a sterile water control (that is, sterile water was sprayed first for 24 h and then Erwinia amylovora was inoculated, CK) were set up. The disease incidence was observed every day, and the number of diseased branches, the length of branch blight, the proportion of branch blight length to the length of inoculated branches, and the disease grade were recorded. The disease incidence rate and disease index were calculated, and the control effect was statistically analyzed. After the experiment, the diseased plant materials were dry-heat sterilized and then destroyed.

[0085] (2) Therapeutic control effect of myxobacteria on Erwinia amylovora

[0086] In the therapeutic experiment, the inoculation order of the pathogen and myxobacteria was opposite to that in the protective experiment, that is, the Erwinia amylovora suspension was sprayed on the Pyrus betulifolia Bunge seedlings first, and after 24 h, the fermentation broth of myxobacteria was sprayed. Other experimental materials, culture conditions, and control effect investigation methods were the same as those in the protective experiment.

[0087] Referring to and improving the method of Paprstein et al., a disease grading standard for inoculating potted Pyrus betulifolia Bunge seedlings with Erwinia amylovora was formulated: grade 0, no disease spots on the branches; grade I, the length of the disease spot on the branch accounted for 1 / 3 of the length of the inoculated branch; grade III, the length of the disease spot on the branch accounted for 1 / 3 - 2 / 3 of the length of the inoculated branch; grade V, the length of the disease spot on the branch accounted for more than 2 / 3 of the length of the inoculated branch.

[0088] Disease incidence rate (%) = (number of diseased branches / total number of inoculated branches) × 100%; disease index = ∑(number of diseased branches at each level × representative value of the disease level) / (total number of inoculated branches × highest level value) × 100; control effect of branch blight (%) = (control disease index - treatment disease index) / control disease index × 100%.

[0089] The results of the protective experiment showed (Table 2) that pre-spraying WCH05 on Pyrus betulifolia Bunge seedlings could significantly reduce the disease incidence rate and disease index of the seedlings. The average protective control effect from 7 to 21 d was 81.53%. Among them, the control effect of WCH05 was the highest on the 7th d (84.58%), and it could still remain at 80.19% on the 21st d, slightly lower than that of agricultural streptomycin (81.15%).

[0090] The results of the therapeutic experiment showed (Table 3) that spraying the WCH05 bacterial solution had an obvious therapeutic effect on the branch blight of Pyrus betulifolia Bunge seedlings. Among them, the control effect reached 76.44% on the 7th d, and the control effect decreased from 14 to 21 d. The average control effect from 7 to 21 d reached 63.84%, slightly lower than that of agricultural streptomycin (67.32%).

[0091] Table 2 Protective efficacy of strain WCH05 against fire blight of Pyrus betulifolia seedlings

[0092]

[0093]

[0094] Table 3 Therapeutic efficacy of strain WCH05 against fire blight of Pyrus betulifolia seedlings

[0095]

[0096] Although the preferred embodiments of the present invention have been described, those skilled in the art can make additional changes and modifications once they learn the basic creative concept. Therefore, the appended claims are intended to be construed to include the preferred embodiments as well as all changes and modifications falling within the scope of the present invention.

[0097] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalent technologies, the present invention also intends to include these modifications and variations.

Claims

1. An orange myxococcus ([[]] Myxococcus fulvus [[]]) WCH05, It is characterized in that it is deposited in the General Microbiological Center of the China Committee for Culture Collection of Microorganisms. The deposit address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The deposit date is May 30, 2022, and the deposit number is CGMCC NO. 24981.

2. The fermentation broth of Myxococcus fulvus WCH05 described in claim 1.

3. The biological bacterial agent with Myxococcus fulvus WCH05 described in claim 1 as the active ingredient.

4. The biological fertilizer with Myxococcus fulvus WCH05 described in claim 1 as the active ingredient.

5. The application of Myxococcus fulvus WCH05 described in claim 1 in the biological control of plant bacterial diseases and the predation of plant pathogenic bacteria, it is characterized in that The plant pathogenic bacteria are Erwinia amylovora Erwinia amylovora , bacterial soft rot bacteria Pectobacterterium carotovorum subsp.Carotovorum , Erwinia pyrifoliae Dickeya fangzhongdai , Acidovorax avenae subsp. Citrulli Acidovorax citrulli , and Xanthomonas euvesicatoria Pseudomonas syringae pv.Syringae .

6. The application of the fermentation broth of Myxococcus fulvus WCH05 described in claim 2 in the biological control of plant bacterial diseases and the predation of plant pathogenic bacteria, it is characterized in that The plant pathogenic bacteria are Erwinia amylovora Erwinia amylovora , Erwinia carotovora Pectobacterterium carotovorum subsp.Carotovorum , Physalospora piricola Nose Dickeyafangzhongdai , Acidovorax avenae subsp. Citrulli Acidovorax citrulli , and Xanthomonas campestris pv. Vesicatoria Pseudomonas syringae pv.Syringae .

Images