A method for preparing L-vinylglycine by multi-enzyme cascade

Abstract

The present invention relates to a method for preparing L-vinylglycine by multi-enzyme cascade. Using threonine as a raw material, L-amino acid oxidase and / or D-amino acid oxidase are added for biocatalytic reaction to obtain β-hydroxybutyric acid; β-hydroxybutyric acid reacts under the action of lactate dehydratase or phenyl lactate dehydratase to obtain 3-ene-butyric acid; L-glutamate dehydrogenase and glucose dehydrogenase are added to the prepared 3-ene-butyric acid for reaction to obtain L-vinylglycine. The fine chemical intermediate L-vinylglycine is prepared with a total yield of 75%-90% and an optical purity of over 99%. For the synthesis of this intermediate, various protections of each amino group and carboxyl group are not required, nor are high temperatures and strong acids needed. Under the condition of glacial acetic acid, L-vinylglycine undergoes an addition reaction with ethyl methylphosphonate, and after acidolysis, ammonia neutralization, and methanol recrystallization, glufosinate-ammonium with an optical purity greater than 99% and a yield greater than 95% can be obtained.

Description

Technical Field

[0001] The present invention belongs to the fields of fine chemical engineering, genetic engineering and enzyme engineering, and relates to a method for preparing L-vinylglycine by multi-enzyme cascade and its application in the synthesis of glufosinate-ammonium. Background Art

[0002] The structural formula of L-vinylglycine is shown as follows. It is a natural, non-protein amino acid, a coenzyme inhibitor of pyridoxal phosphate PLP, and can also be used as a raw material for the synthesis of the novel herbicide glufosinate-ammonium (L-phosphinothricin). L-vinylglycine derivatives can also be used as preservatives to delay the loss of fruit quality and bioactive components during cold storage and shelf life. Therefore, the low-cost and high-efficiency synthesis of L-vinylglycine is crucial.

[0003]

[0004] Currently, the synthesis of L-vinylglycine is mainly by chemical methods, and there is no report on enzymatic synthesis. There are more reports by foreign scholars on chemical synthesis methods. The main raw materials for its synthesis are methionine and homocysteine. After protection of amino and carboxyl groups, it is prepared by dehydration, and the total yield is less than 50%. The main process is as follows:

[0005]

[0006] Due to the long synthesis route, low yield, high temperature and hazardous chemicals involved in the chemical synthesis of L-vinylglycine, high requirements for equipment, and difficulty in industrialization. Therefore, the present invention uses a biocatalyst to first prepare its β-hydroxybutyric acid compound using L-amino acid oxidase or D-amino acid oxidase, then uses dehydratase to prepare the corresponding vinyl butyric acid, and finally ammoniates and reduces it using L-amino acid dehydrogenase and coenzyme NADH or NADPH to prepare L-vinylglycine. Considering that the final product will have a certain toxicity to amino acid oxidase and dehydratase, a multi-enzyme cascade reaction system will be used in the process. The research group of the present invention has applied for corresponding patents (Gong Dachun, Wang Delin, Zhang Shuyin, etc., Multi-enzyme cascade reaction separation coupling system and method, CN 113088443 A). Therefore, there is no report on the method for efficiently synthesizing L-vinylglycine using multi-enzyme cascade reaction, and it has broad application prospects. Summary of the Invention

[0007] To solve the technical problems such as low yield and harsh conditions of the above chemical synthesis, the present invention provides a method for preparing L-vinylglycine by multi-enzyme cascade and applies it to the synthesis of glufosinate-ammonium.

[0008] The technical route of the present invention is shown as follows:

[0009]

[0010] The method for preparing L-vinylglycine by multi-enzyme cascade using the above technical concept of the present invention comprises the following steps:

[0011] (1) Using threonine as a raw material, adding L-amino acid oxidase or D-amino acid oxidase for biocatalytic reaction to obtain β-hydroxybutyric acid.

[0012] To ensure the enzyme activity of amino acid oxidase, a buffer solution of 0.1 - 0.3 mol / L Tris-HCl is selected, and the reaction is carried out at a reaction temperature of 20 - 35 °C with the pH controlled at 5.5 - 7.5. Among them, when the pH is in a neutral environment such as 6.5 - 7.0, a more preferable catalytic effect is obtained.

[0013] (2) Under the action of lactate dehydratase or phenyl lactate dehydratase, β-hydroxybutyric acid reacts to obtain 3-oxobutyric acid; to ensure the enzyme activity of the dehydratase, a 0.1 - 0.3 mol / L Tris-HCl buffer solution is selected, and the reaction is carried out at a reaction temperature of 15 - 35 °C with the pH controlled at 4.5 - 7, and further preferably at pH 5.5 - 6.5.

[0014] (3) Adding L-glutamate dehydrogenase and glucose dehydrogenase to the prepared 3-en-oxobutyric acid, and reacting to obtain L-vinylglycine.

[0015] To ensure the enzyme activity of L-glutamate dehydrogenase, a 0.1 - 0.3 mol / L Tris-HCl buffer solution or a phosphate buffer solution is selected, and at a reaction temperature of 25 - 55 °C, the pH is controlled at 6.5 - 8.5, and further preferably at pH 7.5 - 8.0.

[0016] The starting material threonine described is D-threonine, L-threonine, or DL-threonine.

[0017] 1.1 Preparation of the enzyme or enzyme preparation used for β-hydroxybutyric acid

[0018] 1.1.1 Preparation steps of the recombinant enzyme L-amino acid oxidase CgLAAO or its mutant enzyme used for selectively oxidizing L-threonine The L-amino acid oxidase described in step (1) is the recombinant enzyme CgLAAO, and the amino acid and DNA sequences of the recombinant enzyme CgLAAO are SEQ ID NO.1 and SEQ ID NO.2 respectively.

[0019] The preparation method of L-amino acid oxidase is as follows: By constructing a recombinant bacterium E. coli BL21(DE3) / pet28a–LAAO to express the L-AAO amino acid oxidase gene of Corynebacterium glutamicum B1 with a histidine tag (Corynebacterium glutamicum B1 is from the public patent 109971676A, deposit number CCTCC NO: M 2019118), primers SEQ ID No.27 and SEQ ID No.28 are used during construction, and Ni-Agarose affinity chromatography is adopted to isolate and purify the recombinant enzyme CgLAAO. The full-length gene sequence of the recombinant enzyme CgLAAO is 1143bp, containing 380 amino acids, with a molecular weight of 41.9KD and a specific enzyme activity of 3U / mg. It is used to prepare a liquid enzyme preparation for the catalytic reaction of β-hydroxybutyric acid. The liquid enzyme preparation is composed of the isolated pure enzyme, Tris-HCl buffer, protective agent PEG2000 - 4000, β-cyclodextrin or starch, and its enzyme activity is 3000±50U / L.

[0020] The L-amino acid oxidase described above can also be replaced by the L-amino acid oxidase mutant enzyme A117N, and the amino acid sequences of the L-amino acid oxidase mutant enzyme A117N are SEQ ID NO.3 and SEQ ID NO.4 respectively.

[0021] The L-amino acid oxidase variant enzyme A117N is synthesized by Sangon Biotech (Shanghai) Co., Ltd. with self-designed primers SEQ ID No.29 and SEQ ID No.30, and site-directed mutagenesis is carried out using the site-directed mutagenesis kit Mut Express II Fast Mutagenesis Kit V2 of Nanjing Novozymes Biotech Co., Ltd. to construct the mutant enzyme A117N, and the enzyme activity of the liquid enzyme preparation is increased to 9000±130U / L.

[0022] The addition amount of L-amino acid oxidase or L-amino acid oxidase mutant enzyme A117N is 1 - 5% of the mass of the threonine (the threonine is D-threonine, L-threonine, or DL-threonine) substrate, and the substrate can be added in batches or at one time.

[0023] The D-amino acid oxidase described in step (1) of the preparation steps of the recombinant enzyme CgDAAO and its mutant for selectively oxidizing D-threonine is the recombinant enzyme CgDAAO, and the amino acid sequences of the recombinant enzyme CgDAAO are SEQ ID NO:5 and SEQ ID NO:6 respectively.

[0024] D - Amino Acid Oxidase: By constructing the recombinant bacterium E. coli BL21(DE3) / pet28a - DAAO, the DAAO amino acid oxidase gene of Corynebacterium glutamicum (Corynebacterium glutamicum B1, obtained from the public patent 109971676A, deposit number CCTCC NO: M 2019118) with a histidine tag was expressed, and the recombinant enzyme CgDAAO was isolated and purified by Ni - Agarose affinity chromatography. Primers for constructing the recombinant enzyme CgDAAO: SEQ ID No.31 and CgDAAO - R: SEQ ID No.32. The full - length gene sequence of the recombinant enzyme CgDAAO is 1125bp, containing 374 amino acids, with a molecular weight of 40.446KD and a specific enzyme activity of 4U / mg. The enzyme activity of the liquid enzyme preparation used for the catalytic reaction of preparing 3 - substituent pyruvic acid by the racemization of D - threonine is 4000 ± 50U / L.

[0025] Replace D - amino acid oxidase with the D - amino acid oxidase mutant enzyme CgDAAO - E218D, and its amino acid and DNA sequences are SEQ ID NO:7 and SEQ ID NO:8 respectively.

[0026] The D - amino acid oxidase mutant CgDAAO - E218D was synthesized by Sangon Biotech (Shanghai) Co., Ltd. The self - designed primers CgDAAO - E218D–F (see SEQ ID No.33) and CgDAAO - E218D - R (see SEQ ID No.34) were used, and site - directed mutagenesis was carried out using the Site - Directed Mutagenesis Kit Mut Express II Fast Mutagenesis KitV2 of Nanjing Novoprotein Science & Technology Co., Ltd. to construct the mutant enzyme E218D, and the enzyme activity of the liquid enzyme preparation was increased to 12000 ± 115U / L.

[0027] The addition amount of D - amino acid oxidase or the D - amino acid oxidase mutant enzyme E218D is 1 - 5% of the mass of the threonine (the threonine is D - threonine, L - threonine, or DL - threonine) substrate. The substrate can be added in batches or at one time.

[0028] Using L - amino acid oxidase with L - threonine as the raw material; using D - amino acid oxidase with D - threonine as the raw material; using DL - threonine as the raw material, both amino acid oxidases of the two configurations need to be added.

[0029] 1.2 Enzymatic Preparation of 3 - en - pyruvic acid

[0030] To prepare 3-en-butanoic acid from β-hydroxybutanoic acid, a dehydratase is required. The research of the present invention finds that lactic acid dehydratase and phenyl lactic acid dehydratase and their mutant enzymes have good dehydration catalytic activity.

[0031] The lactic acid dehydratase is the recombinant enzyme CsLDAH. The amino acid sequence of the recombinant enzyme CsLDAH has three subunits. The amino acid and DNA sequences of the three subunits are SEQ ID No.9-14; the phenyl lactic acid dehydratase is the recombinant enzyme CsPLDAH. The amino acid and DNA sequences of the recombinant enzyme CsPLDAH have three subunits, and the amino acid sequences of the three subunits are SEQ ID No.15-20.

[0032] The preparation methods of lactic acid dehydratase and phenyl lactic acid dehydratase are as follows: by constructing recombinant bacteria E. coli BL21(DE3) / pet28a–LDAH or E. coli BL21(DE3) / pet28a–PLDAH, expressing the lactic acid dehydration or phenyl lactic acid dehydration recombinant enzyme CsLDAH or CsPLDAH gene with a histidine tag derived from Clostridium sporogenes (deposit number CGMCC1.1765).

[0033] The lactic acid dehydration recombinant enzyme CsLDAH contains three subunits. The primers used for constructing the engineering bacteria are shown in SEQ ID No.35~No.40 respectively.

[0034] The phenyl lactic acid dehydration recombinant enzyme CsPLDAH also contains three subunits. The primers used for constructing the engineering bacteria are shown in SEQ ID No.41~No.46.

[0035] Ni-Agarose affinity chromatography was used to separate and purify lactic acid acyl dehydratase or phenyl lactic acid acyl dehydratase CsLDAH or CsPLDAH, respectively. The recombinant enzyme CsLDAH has a total of 3 subunits, with the full-length gene sequences being 1125bp, 1269bp, and 780bp respectively, containing 374, 422, and 259 amino acids respectively, with molecular weights of 41.81KD, 47.390KD, and 27,120KD respectively. The amino acid and DNA sequences are shown in SEQ ID NO.9-14; the specific enzyme activities are 1.8U / mg, 2.7U / mg, and 0.6U / mg respectively; the recombinant enzyme CsPLDAH has a total of 3 subunits, with the full-length gene sequences being 1239bp, 1224bp, and 1125bp respectively, containing 412, 407, and 374 amino acids respectively, with molecular weights of 46.387KD, 46.238KD, and 43.149KD respectively. The amino acid and DNA sequences are shown in SEQ ID NO.15-20. The protectant used for the preparation of the liquid enzyme preparation for the catalytic reaction to prepare 3-enyl butyric acid is the same as that used for the enzyme or enzyme preparation for (β-hydroxy butyric acid). The enzyme activities of the recombinant enzyme CsLDAH or CsPLDAH enzyme preparations can reach 3500±120U / L and 3200±110U / L.

[0036] The addition amount of the dehydratase (lactic acid dehydratase or phenyl lactic acid dehydratase) is 0.5-3.5% of the mass of the β-hydroxy butyric acid substrate.

[0037] 1.3 The obtained 3-enyl butyric acid was ammoniated and reduced using L-glutamate dehydrogenase, and glucose dehydrogenase was used for the regeneration of reduced coenzyme to prepare L-vinylglycine. The L-glutamate dehydrogenase described above is the recombinant enzyme CgGDH, and the amino acid and DNA sequences of the recombinant enzyme CgGDH are SEQ ID NO.21 and SEQ ID NO.22 respectively; the catalytic effect will be better when the L-glutamate dehydrogenase is replaced with the L-glutamine dehydrogenase mutant CgGDH-Q113E, and its amino acid and DNA sequences are SEQ ID NO.23 and SEQ ID NO.24 respectively.

[0038] The preparation method of L-glutamine dehydrogenase is as follows: Recombinant bacterium E. coli BL21(DE3) / pet28a-GDH was constructed to express the L-glutamine dehydrogenase amino acid GDH gene of Corynebacterium glutamicum B1 (preservation number CCTCC NO: M 2019118) with a histidine tag. The primers used for constructing the engineering bacterium are shown in SEQ ID NO.47 and SEQ ID NO.48. And Ni-Agarose affinity chromatography was used to study the separation and purification of the recombinant enzyme CgGDH. The full length of the recombinant enzyme CgGDH gene sequence is 1344 bp, encoding 447 amino acids, with a molecular weight of 48.988 kD. The enzyme activity of the liquid enzyme preparation used for the catalytic synthesis of L-vinylglycine is 10300±150 U / L.

[0039] In order to further improve the enzyme activity, the present invention screened mutants of L-glutamine dehydrogenase and found that CgGDH-Q113E has better catalytic activity. The primers used for synthesizing the CgGDH-Q113E mutant enzyme are shown in SEQ ID NO.49 and SEQ ID NO.50. Site-directed mutagenesis was carried out using the Site-Directed Mutagenesis Kit Mut Express II Fast Mutagenesis Kit V2 from Nanjing Novoprotein Scientific Inc. to construct the mutant enzyme CgGDH-Q113E, and the enzyme activity of the liquid enzyme preparation was increased to 18500±150 U / L.

[0040] The addition amount of L-glutamine dehydrogenase or the L-glutamine dehydrogenase mutant Q113E is 2-6% of the mass of the 3-ketobutanoic acid substrate. The substrate can be added in batches or at once.

[0041] The amino acid and DNA sequences of glucose dehydrogenase are SEQ ID NO.25 and SEQ ID NO.26 respectively. It is provided by the Enzyme Preparation Division of Angel Yeast Co., Ltd. The authorized patent is CN 107779459 A. The strain is Escherichia coli.A149-170, which is preserved in the China Center for Type Culture Collection, and the preservation number is CCTCC M2016102. The molecular weight is about 30 kD, and the enzyme activity of the provided liquid enzyme preparation is 5000 U / L±240 U / L.

[0042] The addition amount of glucose dehydrogenase is 2-6% (mass ratio) of the mass of glucose.

[0043] 1.4 Recovery and product application of three types of enzymes

[0044] After each enzymatic reaction in steps (1), (2), and (3) of the above technical solution of the present invention, an ultrafiltration device with a membrane pore size of 5-20 kD is selected to separate the enzyme and small molecule products. The product enters the next enzymatic reaction in the permeate, and the enzyme solution is recovered and reused. The enzyme can be recovered at least 5 times, and the enzyme activity is still more than 80%. For the second continuous reaction system, only about 1-20% of the liquid enzyme preparation needs to be supplemented. The product L-vinylglycine is obtained in the last reaction, effectively avoiding the mutual influence of the enzyme and different substrates.

[0045] Separation and purification of fine chemical intermediate L-vinylglycine: Using hydrogen-type 001×7 cation exchange resin, after equilibration, column loading, ammonia water elution, vacuum distillation, and vacuum concentration, fine chemical intermediate L-vinylglycine with an optical purity of 99% can be obtained.

[0046] Steps (1), (2), and (3) of the present invention are all carried out in a tubular reactor for three-stage multi-enzymatic cascade reaction. The yield of the product reaches more than 90%, the yield of the batch reaction reaches more than 75%, and the optical purity of L-vinylglycine is more than 99%.

[0047] 1.5 Application in the synthesis of glufosinate-ammonium

[0048] Under the protection of nitrogen or helium, an acetic acid solution of L-vinylglycine is added at 5-25°C, and diethyl methylphosphonate (1:1 to 1.1.3) is added dropwise, and the reaction is carried out for 4-10 hours. Then, it is heated under reflux in a hydrochloric acid solution for 3-6 hours, and finally refluxed in an ammonia water solution for 4-8 hours. After vacuum distillation, it is recrystallized with methanol to obtain white L-glufosinate-ammonium crystals, with a yield of up to 95% and an optical purity of 99.6% of the product.

[0049] Advantages of the present invention:

[0050] The present invention uses L-amino acid oxidase and its mutant A117N, D-amino acid oxidase and its mutant E218D, dehydratase, L-glutamine dehydrogenase reductase and its mutant Q113E, and through three-stage enzymatic reactions, catalyzes the synthesis of L-vinylglycine in a series of multi-stage tubular reactors (see the patent independently declared by this research group: Gong Dachun, Wang Delin, Zhang Shuyin, etc., Multi-enzymatic cascade reaction separation coupling system and method, CN 113088443 A) or a batch reactor. Among them, the coenzyme NADPH is regenerated by glucose dehydrogenase, and the enzyme after the reaction is concentrated and recycled by ultrafiltration technology. This process has the technical characteristics of low cost and high efficiency. Description of the drawings

[0051] Figure 1Schematic diagrams of the recombinant expression vectors E. coli BL21(DE3) / pet28a–CgLAAO(a), E. coli BL21(DE3) / pet28a–CgDAAO(b), and E. coli BL21(DE3) / pet28a–CgGDH(c) of L-amino acid oxidase, D-amino acid oxidase, and L-glutamine dehydrogenase.

[0052] Figure 2 Recombinant expression vectors E. coli BL21(DE3) / pet28a–CsLDAH(d) and E. coli BL21(DE3) / pet28a–CsPLDAH(e) of dehydratases CsLDAH and CsPLDAH.

[0053] Figure 3 L-vinylglycine 1 HNRM diagram.

[0054] Figure 4 For L-phosphinothricin 1 HNRM diagram. Specific implementation manners

[0055] The present invention will be further described below in conjunction with the embodiments, but the scope claimed by the present invention is not limited to the scope described in the embodiments.

[0056] Example 1

[0057] The expression, purification, amino acid, and DNA sequences of the L-amino acid oxidase of the mutagenized strain Coryne bacterium glutamicum B1 (authorized by the inventor, deposit number CCTCC NO: M2019118) are SEQ ID NO.1 and SEQ ID NO.2, respectively.

[0058] Using Corynebacterium glutamicum B1 L-amino acid oxidase as a template, primers CgLAAO-F: tttgaattcatgaaaattgcggtaatcggc (SEQ ID No. 27) and CgLAAO-R: tttctcgagctatacgtgcaccgcctctt (SEQ ID No. 28) were used to amplify the CgLAAO gene. The reaction system was as follows: 0.5 μL of genomic DNA template, 0.5 μL of Phusion DNA polymerase, 10 μL of Phusion GC Buffer (5X), 2.5 μL of CgLAAO-F (10 μmol / L), 2.5 μL of CgLAAO-R (10 μmol / L), 1 μL of dNTP (10 μmol / L), 1.5 μL of DMSO, 1.5 μL of Mg 2+ , 30 μL of ddH2O. Amplification conditions: PCR reaction conditions: pre-denaturation at 95 °C for 3 min; denaturation at 95 °C for 10 s; annealing at 64.7 °C for 20 s; extension at 72 °C for 45 s; a total of 30 PCR cycles were carried out; finally, extension was continued at 72 °C for 5 min.

[0059] The CgLAAO amplification product was digested with the restriction enzymes EcoRI and XhoI and then directionally cloned into the expression vector, and transformed into competent E. coli BL21(DE3) cells. After transformation, an appropriate amount of the bacterial solution was spread on an LB plate containing 100 μg / mL chloramphenicol and cultured in the dark at 37 °C to screen for positive transformants. The plasmid was cultured and extracted, and after sequencing verification, the cloning vector was obtained and named pet28a-CgLAAO (as Figure 1 in a).

[0060] A single colony containing the recombinant expression plasmid was picked and cultured overnight in an LB medium containing 100 μg / mL chloramphenicol. Inoculate at a ratio of OD 600 value of 4 into 100 mL of induction medium (100 μg / mL chloramphenicol, 1 mmol / L Mg 2+ , 1 mmol / L Zn 2+ ), and culture at 23 °C and 200 rpm until OD 600It was 0.6, IPTG was added to make the final concentration 0.4 mmol / L, and induction was carried out at 23 °C for 16 h. At the same time, the empty vector and uninduced Escherichia coli were used as controls. The cells were collected by centrifugation, resuspended with an appropriate volume of Buffer A (20 mmol / L Tris, 500 mmol / L NaCl, 5% glycerol, 0.5 mmol / L PMSF, pH 7.5), sonicated (working for 2 s, stopping for 6 s, 25 min), and centrifuged (12,000 rpm, 4 °C, 10 min) to obtain the supernatant of the target protein.

[0061] The crude protein was separated and purified using a Ni-Agarose column. The supernatant of the target protein with a histidine tag was filtered through a 0.45 μm filter membrane and then loaded onto the column. The column was washed with 10 column volumes of Binding Buffer (20 mmol / L Tris-HCl, 10 mmol / L imidazole, 500 mmol / L NaCl, pH 8.0) to remove impurities, and eluted with 20 mL of Elution Buffer (20 mmol / L Tris-HCl, 500 mmol / L imidazole, 500 mmol / L NaCl, pH 8.0). The eluate was collected in 1 mL fractions and stored at 4 °C for later use. The recombinant enzyme CgLAAO with a specific activity of 3 U / mg was obtained. Its amino acid and DNA sequences are shown in SEQ ID NO.1 and SEQ ID NO.2. The full-length gene sequence of the recombinant enzyme CgLAAO is 1143 bp, containing 380 amino acids, and the molecular weight is 41.9 KD. The enzyme activity of the enzyme preparation can reach 3000 ± 50 U / L.

[0062] Example 2

[0063] The mutant enzyme CgLAAO-A117N was obtained by site-directed mutagenesis, in which alanine A at position 117 was mutated to asparagine N. Its amino acid and DNA sequences are shown in SEQ ID NO.3 and SEQ ID NO.4. The specific steps are as follows:

[0064] (1) Primer design

[0065] Primer design was carried out using SnapGene software and synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0066] CgLAAO-A117N-F: gcaaacaaggtgcaaatacatacaactccaaggatgtcagatc (SEQ ID No.29);

[0067] CgLAAO-A117N-R: attgcaccttgtttgcaggtattgctcaatgt (SEQ ID No.30)

[0068] (2) Amplification of mutant plasmid

[0069] Use Phanta Max Super-Fidelity DNA Polymerase to amplify pet28a-CgLAAO. The reaction system is as follows: 1 ng genomic DNA template, 1 μL Phanta Max Super-Fidelity DNA Polymerase, 25 μL Max Buffer (2X), 2 μL F / R primer (10 μmol / L), 1 μL dNTP (10 μmol / L), supplemented with ddH2O to 50 μL. Amplification conditions: pre-denaturation at 95 °C for 30 s, denaturation at 95 °C for 15 s, annealing at 61 °C for 15 s, extension at 72 °C for 60 s, 30 cycles, and finally incubation at 75 °C for 5 min.

[0070] (3) DpnI digestion of amplification product

[0071] To prevent the original template plasmid from forming false positive transformants after transformation, DpnI digestion is required before recombination cyclization. The reaction system is as follows: 1 μL DpnI, 50 μL amplified mutant plasmid. Treatment conditions: incubate at 37 °C for 1 h.

[0072] (4) Recombination reaction

[0073] The amplified mutant plasmid is linear. It is necessary to carry out homologous recombination of the mutant plasmid under the catalysis of Exnase II enzyme to complete the cyclization process.

[0074] (5) Construction of mutant enzyme CgLAAO-A117N

[0075] Use the site-directed mutagenesis kit Mut Express II Fast Mutagenesis Kit V2 from Nanjing Novoprotein Biological Technology Co., Ltd. for site-directed mutagenesis to obtain the mutant point plasmid, and transform it into E. coli BL21(DE3) competent cells to construct the genetic engineering bacteria of mutant enzyme CgLAAO-A117N. Store at -80 °C.

[0076] Pick a single colony containing the recombinant expression plasmid of mutant enzyme CgLAAO-A117N according to Example 1 and culture it until OD 600It was 0.6, IPTG was added to make the final concentration 0.4 mmol / L, and induction was carried out at 23 °C for 16 h. At the same time, the empty vector and uninduced Escherichia coli were used as controls. The cells were collected by centrifugation and disrupted by ultrasound to obtain the supernatant of the target protein. The crude protein was separated and purified using a Ni-Agarose column. The supernatant of the target protein with a histidine tag was filtered through a 0.45 μm filter membrane and then loaded onto the column. The methods for washing impurities and elution were the same as in Example 1. The L-amino acid oxidase mutant enzyme CgLAAO-A117N was obtained, and its amino acid and DNA sequences were SEQ ID NO.7 and SEQ ID NO.8. A buffer solution with a pH of 5.5 - 7.5 was added, and a protective agent such as β-cyclodextrin or starch, PEG2000 - 4000 was added to prepare a liquid enzyme preparation, and its enzyme activity was increased to 9000 ± 130 U / L.

[0077] Example 3

[0078] The expression, purification, amino acid and DNA sequences of D-amino acid oxidase of the wild strain Coryne bacterium glutamicum B1 (deposit number CCTCC NO: M 2019118) were SEQ ID NO.5 and SEQ ID NO.6 respectively.

[0079] Using Corynebacterium glutamicum B1 D-amino acid oxidase as a template, primers: CgDAAO-F: tttgaattcatgaaaaagcatgcgattattatcg (SEQ ID No.31), CgDAAO-R: tttctcgagttaaatttggtggcgaaacggat (SEQ ID No.32) were used to amplify the CgDAAO gene. The reaction system was: 0.5 μL of genomic DNA template, 0.5 μL of Phusion DNA polymerase, 10 μL of Phusion GC Buffer (5X), 2.5 μL of CgDAAO-F (10 μmol / L), 2.5 μL of CgDAAO-R (10 μmol / L), 1 μL of dNTP (10 μmol / L), 1.5 μL of DMSO, 1.5 μL of Mg 2+ , 30 μL of ddH2O. Amplification conditions: PCR reaction conditions: pre-denaturation at 95 °C for 3 min; denaturation at 95 °C for 10 s; annealing at 64.7 °C for 20 s; extension at 72 °C for 45 s; a total of 30 PCR cycles were carried out; finally, extension was continued at 72 °C for 5 min.

[0080] The amplified product of CgDAAO was digested with restriction enzymes EcoRI and XhoI and then directionally cloned into an expression vector, which was then transformed into competent E. coli BL21(DE3) cells. After transformation, an appropriate amount of the bacterial solution was spread on an LB plate containing 100 μg / mL chloramphenicol and cultured in the dark at 37 °C to screen for positive transformants. After culturing and plasmid extraction, and verification by sequencing, a cloning vector was obtained and named pet28a-CgDAAO (as shown in Figure 1 b) in

[0081] According to the method of Example 1, a single bacterium containing the recombinant expression plasmid was picked, induced to culture, the cells were collected by centrifugation, resuspended, ultrasonically disrupted, and centrifuged to obtain the supernatant of the target protein. The crude protein was separated and purified using a Ni-Agarose column. The supernatant of the target protein with a histidine tag was filtered through a 0.45 μm filter membrane and then loaded onto the column. The methods of washing impurities and elution were the same as in Example 1, and a recombinant enzyme CgDAAO with a specific enzyme activity of 4 U / mg was obtained. The full-length gene sequence of the recombinant enzyme CgLAAO is 1125 bp, and its amino acid and DNA sequences are SEQ ID NO.21 and SEQ ID NO.22, containing 374 amino acids and with a molecular weight of 40.446 KD. An appropriate buffer solution was added, and liquid enzyme preparation was carried out according to the method of Example 2, and its enzyme activity was 4000 ± 50 U / L.

[0082] Example 4

[0083] The D-amino acid oxidase mutant enzyme CgDAAO-E218D was obtained by site-directed mutagenesis, which mutated the E at position 218 of CgDAAO to D. Its amino acid and DNA sequences are as shown in SEQ ID NO.7 and SEQ ID NO.8. The specific steps are as follows:

[0084] (1) Primer design

[0085] Primer design was carried out using SnapGene software and synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0086] CgDAAO-E218D-F: TTT GAA TTCatgaaaaagcatgcgattattatcg (SEQ ID No.33)

[0087] CgDAAO-E218D-R: TTTCTCGAGttaaatttg gtggcgaaacggat (SEQ ID No.34)

[0088] 2) Mutant plasmid amplification

[0089] Amplify pet28a-CgDAAO using Phanta Max Super-Fidelity DNA Polymerase. The reaction system is as follows: 1 ng genomic DNA template, 1 μL Phanta Max Super-Fidelity DNA Polymerase, 25 μL Max Buffer (2X), 2 μL F / R primers (10 μmol / L), 1 μL dNTP (10 μmol / L), and ddH2O is added to make up to 50 μL. Amplification conditions: pre-denaturation at 95 °C for 30 s, denaturation at 95 °C for 15 s, annealing at 61 °C for 15 s, extension at 72 °C for 60 s, 30 cycles, and finally incubation at 75 °C for 5 min.

[0090] (3) Dpnl digestion of the amplification product

[0091] To prevent the original template plasmid from forming false positive transformants after transformation, Dpnl digestion is required before recombination cyclization. The reaction system is as follows: 1 μL Dpnl, 50 μL amplified mutant plasmid. Treatment conditions: incubation at 37 °C for 1 h.

[0092] (4) Recombination reaction

[0093] The amplified mutant plasmid is linear. It is necessary to carry out homologous recombination of the mutant plasmid under the catalysis of Exnase II enzyme to complete the cyclization process.

[0094] (5) Construction of mutant enzyme CgDAAO-E218D

[0095] Use the site-directed mutagenesis kit Mut Express II Fast Mutagenesis Kit V2 from Nanjing Novoprotein Scientific Inc. for site-directed mutagenesis to obtain the mutant point plasmid, and transform it into E. coli BL21(DE3) competent cells to construct the mutant enzyme E218D genetic engineering bacteria. Store at -80 °C.

[0096] According to the method of Example 1, pick a single colony containing the recombinant expression plasmid of mutant enzyme E218D, induce culture, centrifuge to collect the thallus, resuspend it with an appropriate volume of Buffer A, ultrasonically disrupt it, and centrifuge to obtain the supernatant of the target protein. The crude protein is separated and purified using a Ni-Agarose column. The supernatant of the target protein with a histidine tag is filtered through a 0.45 μm filter membrane and then loaded onto the column for impurity washing and elution to obtain the D-amino acid oxidase mutant CgDAAO-E218D. After verification, its amino acid and DNA sequences are consistent with SEQ ID NO.7 and SEQ ID NO.8. Add an appropriate buffer solution to prepare it into a liquid enzyme preparation, and its enzyme activity is increased to 12000 ± 115 U / L.

[0097] Example 5

[0098] Expression, purification and amino acid sequences SEQ ID NO.9 - 14 of the lactic acid acyl dehydratase of Clostridium sporogenes (Accession No. CGMCC1.1765).

[0099] Using Clostridium sporogenes (Accession No. CGMCC1.1765) as a template, the following primers were synthesized:

[0100] CsLDHa - F: gacagcaaatgggtcgcggatccatgagtagagtagaagctattttatcccaattaaaagac (SEQ ID NO.35)

[0101] CsLDHa - R: tgttaaactcatcagcatttctacgaaagactgcagt (SEQ ID NO.36)

[0102] CsLDHb - F: tagaaatgctgatgagtttaacacaaggcatgaaagca (SEQ ID NO.37),

[0103] CsLDHb - R: tgtgtacatttctgctgcagccatgttgg (SEQ ID NO.38)

[0104] CsLDHc - F:gcagcagaaatgtacacataggtattgatgtgggttcc (SEQ ID NO.38)

[0105] CsLDHc - R: tggtggtggtggtggtgctcgagttattttttttgtgccgcttcatatgcgtaca (SEQID NO.40)

[0106] Amplify three CsLDAHa, CsLDAHb, CsLDAHc genes. The reaction system is: 0.5 μL genomic DNA template, 0.5 μL Phusion DNA polymerase, 10 μL Phusion GC Buffer (5X), 2.5 μL CsLDAHa - F or CsLDAHb - F or CsLDAHc - F (10 μmol / L), 2.5 μL CsLDAHa - R or CsLDAHb - R or CsLDAHc - R (10 μmol / L), 1 μL dNTP (10 μmol / L), 1.5 μL DMSO, 1.5 μL Mg 2+, 30 μL of ddH₂O. Amplification conditions: PCR reaction conditions: pre-denaturation at 95 °C for 3 min; denaturation at 95 °C for 10 s; annealing at 64.7 °C for 20 s; extension at 72 °C for 45 s; a total of 30 PCR cycles were carried out; finally, extension was continued at 72 °C for 5 min.

[0107] The amplification product of the CsLDAH gene was digested with the restriction enzymes EcoRI and XhoI, directionally cloned into the expression vector, and transformed into competent E. coli BL21(DE3) cells, and positive transformants were screened. The plasmid was cultured and extracted, and after verification by sequencing, the cloning vector was obtained and named pet28a-CsLDAH (as Figure 2 shown in d).

[0108] According to the method of Example 1, single colonies were picked, induced and cultured, the cells were collected by centrifugation, suspended with an appropriate volume of Buffer A, sonicated and centrifuged to obtain the supernatant of the target protein. The crude protein was separated and purified using a Ni-Agarose column and purified according to the method of Example 1. The amino acid sequence was consistent with SEQ ID NO.9-14. The recombinant enzyme CsLDAH has 3 subunits, and the full-length gene sequences are 1125 bp, 1269 bp and 780 bp respectively, containing 374, 422 and 259 amino acids respectively, with molecular weights of 41.81 KD, 47.390 KD, 27,120 KD respectively, and specific enzyme activities of 1.8 U / mg, 2.7 U / mg, 0.6 U / mg respectively. A liquid enzyme preparation was prepared by adding a buffer solution, a protective agent, etc., and its enzyme activity was 3500 ± 120 U / L.

[0109] Example 6

[0110] Expression, purification of lactic acid acyl dehydratase from Clostridium sporogenes (deposit number CGMCC1.1765) and amino acid sequence SEQ ID NO.8-10.

[0111] Using Clostridium sporogenes (deposit number CGMCC1.1765) as a template, the primers used for synthesis are:

[0112] CsPLDAHa-F: acagcaaatgggtcgcggatccatggatctggaaaacatacaatatgtttagtggagtaaacatacaaatatgtttagtggagtaaagg (SEQ ID No.41)

[0113] CsPLDAHa-R: ctatcac tcattttttccttcct taccttaccattatactttatctttttctaattcctca(SEQ ID No.42)

[0114] CsPLDAHb-F: ggaaggaaaaatgagtgata gaa ataaggaatgaaaagaaaaaaaggc(SEQ IDNo.43)

[0115] CsPLDAHb-R: aatttgacatttcag cct cct ttttagcaaccattact(SEQ ID No.44)

[0116] CsPLDAHc-F: gaggctgaaatgtcaaattcagataaattttaatgacttaaggatattgtagaaaa(SEQ ID No.45)

[0117] CsPLDAHc-R: tggtgggtggtggtgctcgagttaaagtgtttctgaattgcagt(SEQ ID No.46)

[0118] Amplify the three CsPLDAHa, CsPLDAHb, and CsPLDAHc genes respectively. The reaction system is as follows: 0.5 μL of genomic DNA template, 0.5 μL of Phusion DNA polymerase, 10 μL of Phusion GC Buffer (5X), 2.5 μL of F (10 μmol / L), 2.5 μL of R (10 μmol / L), 1 μL of dNTP (10 μmol / L), 1.5 μL of DMSO, 1.5 μL of Mg 2+ , 30 μL of ddH2O. Amplification conditions: PCR reaction conditions: pre-denaturation at 95 °C for 3 min; denaturation at 95 °C for 10 s; annealing at 64.7 °C for 20 s; extension at 72 °C for 45 s; a total of 30 PCR cycles; finally, continue to extend at 72 °C for 5 min.

[0119] The amplification products of the CsPLDAH gene were digested with the restriction enzymes EcoRI and XhoI and then directionally cloned into the expression vector, and transformed into competent E. coli BL21(DE3) cells. After transformation, an appropriate amount of the bacterial solution was spread on an LB plate containing 100 μg / mL chloramphenicol and cultured in the dark at 37 °C to screen for positive transformants. The plasmid was cultured and extracted, and after sequencing verification, the cloning vector was obtained and named pet28a-CsPLDAH (as Figure 2 in f).

[0120] Single colonies containing the recombinant expression plasmid were picked according to Example 1, cultured overnight, induced for expression, and the bacterial cells were collected by centrifugation. After resuspension with an appropriate volume of Buffer A, the cells were sonicated and centrifuged to obtain the supernatant of the target protein.

[0121] The crude protein was separated and purified using a Ni-Agarose column according to the method of Example 1. The obtained recombinant enzyme CsPLDAH had 3 subunits with amino acid and DNA sequences identical to SEQ ID NO.15 - 20. The full lengths of the gene sequences were 1239 bp, 1224 bp, and 1125 bp, containing 412, 407, and 374 amino acids respectively, with molecular weights of 46.387 KD, 46.238 KD, and 43.149 KD respectively. A liquid enzyme preparation was prepared by adding an appropriate pH, and its enzyme activity was 3200 ± 110 U / L.

[0122] Example 7

[0123] Expression, purification of L-glutamine dehydrogenase of the mutagenized strain Coryne bacterium glutamicum B1 (deposit number CCTCC NO: M 2019118) and amino acid and DNA sequences SEQ ID NO.21, SEQ ID NO.22.

[0124] Using Corynebacterium glutamicum B1 L-amino acid oxidase as a template, with primers: CgGDH-F: tttgaaattcatgacagttgatgagcaggtc (SEQ ID No.47), CgGDH-R: tttc tcga gttagatgacgccctgtgcca (Seq ID No.48), the CgGDH gene was amplified. The reaction system was: 0.5 μL of genomic DNA template, 0.5 μL of Phusion DNA polymerase, 10 μL of Phusion GC Buffer (5X), 2.5 μL of CgGDH-F (10 μmol / L), 2.5 μL of CgGDH-R (10 μmol / L), 1 μL of dNTP (10 μmol / L), 1.5 μL of DMSO, 1.5 μL of Mg 2+ , 30 μL of ddH2O. Amplification conditions: PCR reaction conditions: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 10 s; annealing at 64.7°C for 20 s; extension at 72°C for 45 s; a total of 30 PCR cycles were performed; finally, extension was continued at 72°C for 5 min.

[0125] The amplified product of CgGDH was digested with restriction enzymes EcoRI and XhoI and then directionally cloned into an expression vector, and the competent cells of E. coli BL21(DE3) were transformed. After transformation, an appropriate amount of the bacterial solution was spread on an LB plate containing 100 μg / mL chloramphenicol and cultured in the dark at 37 °C to screen for positive transformants. After culturing and extracting the plasmid, and verifying by sequencing, a cloning vector was obtained and named pet28a-CgGDH (as shown in Figure 1 c) in

[0126] According to the method of Example 1, single colonies containing the recombinant expression plasmid were picked, cultured overnight, induced to culture, and the bacterial cells were collected by centrifugation. After resuspending with an appropriate volume of Buffer A, the cells were ultrasonically disrupted and centrifuged to obtain the supernatant of the target protein.

[0127] The crude protein was separated and purified using a Ni-Agarose column according to Example 1. The recombinant enzyme CgGDH was identical to SEQ ID No. 11, with a full-length gene sequence of 1344 bp, 447 amino acids, a molecular weight of 48.988 kD. After adding a buffer solution, a liquid enzyme preparation was prepared, and its enzyme activity was 10300 ± 120 U / L.

[0128] Example 8

[0129] The mutant enzyme CgGDH-Q113E was obtained by site-directed mutagenesis technology, and its amino acid sequence was as shown in SEQ ID NO. 23 and SEQ ID NO. 24. The specific steps were as follows:

[0130] (1) Primer design

[0131] Primer design was carried out using SnapGene software and synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0132] CgGDH-Q113E-F: tttgaattcatgacagttgatgagcaggtc (Seq ID No. 49)

[0133] CgGDH-Q113E-R: tttctcgag ttagatgacgccctgtgcca (Seq ID No. 50)

[0134] 2) Amplification of mutant plasmid

[0135] The pet28a-CgGDH was amplified using Phanta Max Super-Fidelity DNA Polymerase, and the reaction system was as follows: 1 ng genomic DNA template, 1 μL Phanta Max Super-Fidelity DNA Polymerase, 25 μL Max Buffer (2X), 2 μL Q113E-F / Q113E-R primers (10 μmol / L), 1 μL dNTP (10 μmol / L), supplemented with ddH2O to 50 μL. Amplification conditions: pre-denaturation at 95 °C for 30 s, denaturation at 95 °C for 15 s, annealing at 61 °C for 15 s, extension at 72 °C for 60 s, 30 cycles, and finally incubation at 75 °C for 5 min.

[0136] (3) Dpnl digestion of the amplification product

[0137] To prevent the original template plasmid from forming false positive transformants after transformation, Dpnl digestion is required before recombinant cyclization. The reaction system was as follows: 1 μL Dpnl, 50 μL amplified mutant plasmid. Treatment conditions: incubation at 37 °C for 1 h.

[0138] (4) Recombinant reaction

[0139] The amplified mutant plasmid is linear, and homologous recombination of the mutant plasmid needs to be catalyzed by Exnase II enzyme to complete the cyclization process.

[0140] (5) Construction of mutant enzyme CgGDH-Q113E

[0141] Site-directed mutagenesis was carried out using the Site-directed Mutagenesis Kit Mut Express II Fast Mutagenesis Kit V2 from Nanjing Novoprotein Scientific Inc., to obtain the mutant point plasmid, which was then transformed into E. coli BL21(DE3) competent cells to construct a genetic engineering bacterium of mutant enzyme CgGDH-Q113E. It was stored at -80 °C.

[0142] According to Example 1, single colonies containing the recombinant expression plasmid of mutant enzyme Q113E were picked, cultured overnight, induced for expression, and the cells were collected by centrifugation. After resuspension with an appropriate volume of Buffer A, they were sonicated and centrifuged to obtain the supernatant of the target protein.

[0143] The crude protein was separated and purified using a Ni-Agarose column according to the example to obtain the L-glutamine dehydrogenase mutant CgGDH-Q113E, whose amino acid and DNA sequences were consistent with SEQ ID NO.23 and SEQ ID NO.24, and the enzyme activity of the liquid enzyme preparation was increased to 18500 ± 175 U / L.

[0144] Example 9

[0145] Glucose dehydrogenase: provided by the Enzyme Preparation Division of Angel Yeast Co., Ltd., with the authorized patent CN107779459 A. The strain is Escherichia coli.A149-170, preserved in the China Center for Type Culture Collection with the preservation number CCTCC M2016102. The DNA molecule encodes amino acids and DNA sequences as SEQ ID NO.25 and SEQ ID NO.26, with a molecular weight of about 30 kD. The enzyme activity of the provided liquid enzyme preparation is 5000±65 U / L.

[0146] Example 10 Preparation of β-hydroxybutyric acid Using L-threonine as the raw material, in a tubular reactor, at a temperature of 25°C and a pH of 6.5, 45 kg / h (substrate concentration of 50 g / L) of the substrate L-threonine, 0.09 kg / h (4% of the substrate mass) of L-amino acid oxidase (prepared in Example 1), and 2 kg / h of Tris hydrochloride buffer solution were respectively fed. The reaction residence time was 130 minutes, and then ultrafiltration was carried out through an organic membrane with a pore size of 15 kD and a water flux of 60 kg / h. 85% of the L-amino acid oxidase was recovered and returned to the tubular reactor for 5 times of recycling. The conversion rate of the tubular reaction reached 93.4%, and the purity of the β-hydroxybutyric acid product was 98.5%.

[0147] Example 11 Preparation of β-hydroxybutyric acid

[0148] The method and steps are the same as in Example 10, only using the L-amino acid oxidase mutant enzyme A117N prepared in Example 2 as the catalytic enzyme. It can be recycled by ultrafiltration 6 times. The conversion rate of the tubular reaction reaches 95.8%, and the purity of the β-hydroxybutyric acid product is 99.1%.

[0149] Example 12 Preparation of β-hydroxybutyric acid

[0150] The method and steps are the same as in Example 10, only using D-threonine as the raw material and the D-amino acid oxidase prepared in Example 3. The recycling times are 5 times. The conversion rate of the tubular reaction reaches 93.1%, and the purity of the β-hydroxybutyric acid product is 98.3%.

[0151] Example 13 Preparation of β-hydroxybutyric acid

[0152] The method and steps are the same as in Example 10, only using D-threonine as the raw material and the D-amino acid oxidase mutant CgDAAO-E218D prepared in Example 4. The recycling times are 7 times. The conversion rate of the tubular reaction reaches 96.5%, and the purity of the β-hydroxybutyric acid product is 99.2%.

[0153] Preparation of Example 14 β-Hydroxybutyric Acid

[0154] The method and steps are the same as those in Example 10, except that L-threonine and D-threonine are used as raw materials. Among them, the addition amount of L-threonine is 25 kg / h, the addition amount of D-threonine is 25 kg / h, and the concentration of L-threonine and D-threonine as substrates is 50 kg / h; using the L-amino acid oxidase prepared in Example 1 and the D-amino acid oxidase prepared in Example 2 as enzyme catalysts. Among them, the addition amount of the L-amino acid oxidase prepared in Example 1 is 0.04 kg / h, and the addition amount of the D-amino acid oxidase prepared in Example 2 is 0.05 kg / h, so that the catalytic enzyme accounts for 4% of the total mass of the substrate. Then, the recycling times are 6 times, the conversion rate of the tubular reaction reaches 94.8%, and the purity of the β-hydroxybutyric acid product is 98.9%.

[0155] Example 15 Preparation of 3-Ene-butyric Acid

[0156] Using the β-hydroxybutyric acid prepared in Example 10 as the substrate, in a tubular reactor, at a temperature of 30 °C and a pH of 6, 36 kg / h of the substrate (substrate concentration is 40 g / L) and 43.2 g / h (3% of the substrate amount) of lactate dehydratase CsLDAH (prepared in Example 5) are respectively transported. The reaction residence time is 167 minutes, and then through an organic membrane ultrafiltration with a 10 kD membrane pore size and a water flux of 55 kg / h, 86.3% of the dehydratase is recovered and returned to the tubular reactor. The recycling times are 5 times, the conversion rate of the tubular reaction reaches 95.2%, and the purity of the 3-ene-butyric acid product is 99.1%.

[0157] Example 16 Preparation of 3-Ene-butyric Acid

[0158] The method and steps are the same as those in Example 15, except that the β-hydroxybutyric acid prepared in Example 11 is used as the substrate, and the dehydratase CsLDAH prepared in Example 5 is used for the dehydration catalytic reaction. Through ultrafiltration, 80.5% of the dehydratase is recovered and returned to the tubular reactor. The recycling times are 6 times, the conversion rate of the tubular reaction reaches 96.7%, and the purity of the 3-ene-butyric acid product is 98.9%.

[0159] Example 17 Preparation of 3-Ene-butyric Acid

[0160] The method and steps are the same as those in Example 15, except that the β-hydroxybutyric acid prepared in Example 12 is used as the substrate, and 79.8% of the dehydratase is recovered by using the dehydratase CsLDAH prepared in Example 5 and returned to the tubular reactor. The recycling times are 4 times, the conversion rate of the tubular reaction reaches 94.8%, and the purity of the 1-butenoic acid product is 97.9%.

[0161] Example 18 Preparation of 3-ene-butanone acid

[0162] The method and steps are the same as those in Example 15. Only using the β-hydroxybutanone acid prepared in Example 13 as the substrate, and using the dehydratase CsLDAH prepared in Example 5, 80.2% of the dehydratase is recovered and returned to the tubular reactor. The recycling times is 6 times. The conversion rate of the tubular reaction reaches 95.4%, and the purity of the 1-butenone acid product is 98.1%.

[0163] Example 19 Preparation of 3-ene-butanone acid

[0164] The method and steps are the same as those in Example 15. Only using the β-hydroxybutanone acid prepared in Example 14 as the substrate, and using the dehydratase CsLDAH prepared in Example 5, 81.3% of the dehydratase is recovered and returned to the tubular reactor. The recycling times is 6 times. The conversion rate of the tubular reaction reaches 95.8%, and the purity of the 1-butenone acid product is 98.3%.

[0165] Example 20 Preparation of 3-ene-butanone acid

[0166] Using the β-substituted hydroxy butanone acid prepared in Example 10 as the substrate, in a tubular reactor, at a temperature of 30 °C and a pH of 6, 36 kg / h of the substrate (substrate concentration is 40 g / L) and 43.2 g / h (3% of the substrate amount) of phenyl lactate acyl dehydratase CsPLDAH (prepared in Example 6) are respectively fed. The reaction residence time is 167 minutes, and then ultrafiltration is carried out through an organic membrane with a 10 kD membrane pore size and a water flux of 55 kg / h. 86.3% of the dehydratase is recovered and returned to the tubular reactor. The recycling times is 5 times. The conversion rate of the tubular reaction reaches 97.2%, and the purity of the 1-butenone acid product is 98.9%.

[0167] Example 21 Preparation of 3-ene-butanone acid

[0168] The method and steps are the same as those in Example 20. Only using the β-hydroxybutanone acid prepared in Example 11 as the substrate, and using the phenyl lactate acyl dehydratase CsPLDAH in Example 6 for dehydration catalysis, 81.5% of the dehydratase is recovered and returned to the tubular reactor. The recycling times is 6 times. The conversion rate of the tubular reaction reaches 97.8%, and the purity of the vinyl butanone acid product is 99.3%.

[0169] Example 22 Preparation of 3-ene-butanone acid

[0170] The method and steps are the same as those in Example 20. Only using the β-hydroxybutyric acid prepared in Example 12 as the substrate and the phenyl lactic acid acyl dehydratase CsPLDAH in Example 6 for dehydration catalysis, 82.1% of the dehydratase is recovered and returned to the tubular reactor. The number of recycling times is 5 times. The conversion rate of the tubular reaction reaches 98.2%, and the purity of the vinyl butyric acid product is 99.2%.

[0171] Example 23 Preparation of 3-ene-butyric acid

[0172] The method and steps are the same as those in Example 20. Only using the β-hydroxybutyric acid prepared in Example 13 as the substrate and the phenyl lactic acid acyl dehydratase CsPLDAH in Example 6 for dehydration catalysis, 82.3% of the dehydratase is recovered and returned to the tubular reactor. The number of recycling times is 6 times. The conversion rate of the tubular reaction reaches 98.1%, and the purity of the vinyl butyric acid product is 99.3%.

[0173] Example 24 Preparation of 3-ene-butyric acid

[0174] The method and steps are the same as those in Example 20. Only using the β-hydroxybutyric acid prepared in Example 14 as the substrate and the phenyl lactic acid acyl dehydratase CsPLDAH in Example 6 for dehydration catalysis, 82.5% of the dehydratase is recovered and returned to the tubular reactor. The number of recycling times is 6 times. The conversion rate of the tubular reaction reaches 98.3%, and the purity of the vinyl butyric acid product is 99.4%.

[0175] Example 25 Preparation of L-vinylglycine

[0176] Using the 3-ene-butyric acid prepared in Example 15 as the substrate, under the conditions of a temperature of 35 °C and a pH of 8.0, 40 kg / h (substrate concentration of 50 g / L), 100 g / h of L-glutamine dehydrogenase (prepared in Example 7) (5% of the substrate dosage) and glucose dehydrogenase (Example 9) are respectively fed. The addition amount of glucose dehydrogenase is 2.5 kg / h (5% of the glucose dosage), the addition amount of glucose is 50 kg / h, the reaction residence time is 150 minutes, and then ultrafiltration is carried out through an organic membrane with a membrane pore size of 20 kD and a water flux of 60 kg / h. 87% of the L-glutamine dehydrogenase is recovered and returned to the tubular reactor. The number of recycling times is 7 times. The conversion rate of L-vinylglycine in the tubular reaction reaches 95.8%, and the optical purity of L-vinylglycine is 99.5%. 1 HNMR(300MHz,D2O)δ: 4.18(t,J = 10.2Hz,1H),5.16(d,J = 5.8Hz,2H),5.83(m,1H).

[0177] Example 26 Preparation of L-vinylglycine

[0178] Using the 3-ene-butanoic acid prepared in Example 15 as the substrate, in a tubular reactor at a temperature of 35 °C and a pH of 8.0, 40 kg / h (substrate concentration of 50 g / L), 100 g / h of the L-glutamine dehydrogenase mutant Q113E (prepared in Example 8) (5% of the substrate by mass), and glucose dehydrogenase (Example 9) were respectively fed. The addition amount of glucose dehydrogenase was 2.5 kg / h (5% of the glucose dosage), the glucose addition amount was 50 kg / h, the reaction residence time was 150 minutes, and then ultrafiltration was carried out through an organic membrane with a 20 kD membrane pore size and a water flux of 60 kg / h. 87% of the L-glutamine dehydrogenase was recovered and returned to the tubular reactor. The recycling was carried out 7 times. The conversion rate of L-vinylglycine in the tubular reaction reached 96.4%, and the optical purity of L-vinylglycine was 99.6%. The hydrogen spectrum data was the same as that in Example 25.

[0179] Preparation of Example 27 of glufosinate-ammonium (L-glufosinate)

[0180] In a 500 L batch reactor, under the condition of 15 °C and protected by nitrogen or helium, an acetic acid solution of L-vinylglycine was added, and diethyl methylphosphonate was added dropwise. The mass ratio of L-vinylglycine to diethyl methylphosphonate was 1.01:1.36, and the mass concentration of the acetic acid solution of L-vinylglycine was 40%. The reaction was carried out for 6 hours, and then the pH was adjusted to 3.5 with a 10% hydrochloric acid solution, heated to 50 °C, and refluxed for 5 hours. Finally, a 20% ammonia water solution was added to adjust the pH to 6.8, and refluxed at 50 °C for 6 hours. After vacuum distillation, recrystallization was carried out with methanol to obtain white glufosinate-ammonium crystals, 188.1 kg was obtained, the yield was 95%, and the optical purity of the product was 99.6%. After nuclear magnetic detection, it was 1 HNMR(300MHz,D2O)δ: 1.12(d, J = 13.50Hz,3H); 1.86 - 1.94(m,2H); 1.34 - 1.58(m,2H); 3.64(t, J = 5.9Hz,1H)(see attachment Figure 2 ). After liquid phase detection, the retention time of L-glufosinate was: 7.010 min (mobile phase; 50 mM ammonium acetate buffer solution (Ph8.0): methanol = 9:1 flow rate; 0.8 mL / min, chromatographic column; Acclaim TM 120 C18 5um120A 4.6×150mm, detection wavelength; 350nm column temperature: 35 °C, high performance liquid chromatograph model; ThermoUItiMate3000).

[0181] The above-described examples merely represent the preferred embodiments of the present invention. The description is relatively specific and detailed, but it should not be construed as a limitation on the scope of the present invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several variations, improvements, and substitutions can be made, and these all fall within the protection scope of the present invention. Therefore, the protection scope of the present invention patent shall be subject to the appended claims.

Claims

1. A method for preparing L-vinylglycine by multi-enzyme cascade, characterized in that: It includes the following steps: (1) Using threonine as a raw material, adding L - amino acid oxidase and / or D - amino acid oxidase to carry out a biocatalytic reaction to obtain β - hydroxy - butyric acid; the L - amino acid oxidase is recombinant enzyme CgLAAO, and the amino acid and DNA sequences of recombinant enzyme CgLAAO are SEQ ID NO.1 and SEQ ID NO.2 respectively; the D - amino acid oxidase is recombinant enzyme CgDAAO, and the amino acid and DNA sequences of recombinant enzyme CgDAAO are SEQ ID NO.5 and SEQ ID NO.6 respectively; (2) Under the action of lactic acid acyl dehydratase or phenyl lactic acid dehydratase, β - hydroxy - butyric acid reacts to obtain 3 - en - butyric acid; the lactic acid acyl dehydratase is recombinant enzyme CsLDAH, and the amino acid sequence of recombinant enzyme CsLDAH has 3 subunits, and the amino acid and DNA sequences of the 3 subunits are SEQ ID NO.9 - 14; the phenyl lactic acid dehydratase is recombinant enzyme CsPLDAH, and the amino acid sequence of recombinant enzyme CsPLDAH has 3 subunits, and the amino acid and DNA sequences of the 3 subunits are SEQ ID NO:15 - 20; (3) Adding L - glutamate dehydrogenase and glucose dehydrogenase to the prepared 3 - en - butyric acid, and reacting to obtain L - vinylglycine, the L - glutamate dehydrogenase is recombinant enzyme CgGDH, and the amino acid and DNA sequences of recombinant enzyme CgGDH are SEQ ID NO.21 and SEQ ID NO.22 respectively; the amino acid and DNA sequences of glucose dehydrogenase are SEQ ID NO.25 and SEQ ID NO.26 respectively.

2. The method for preparing L-vinylglycine by multi-enzyme cascade according to claim 1, characterized in that: The threonine is D - threonine, L - threonine, or DL - threonine, and undergoes a deamination reaction to obtain hydroxy - butyric acid.

3. The method for preparing L-vinylglycine by multi-enzyme cascade according to claim 1, wherein: In step (1), the L - amino acid oxidase is replaced by the L - amino acid oxidase variant enzyme A117N, and the amino acid and DNA sequences of the L - amino acid oxidase mutant enzyme A117N are SEQ ID NO.3 and SEQ ID NO.4 respectively.

4. The method for preparing L-vinylglycine by multi-enzyme cascade according to claim 1, characterized in that: In step (1), the D - amino acid oxidase is replaced by the D - amino acid oxidase mutant enzyme CgDAAO - E218D, and the amino acid and DNA sequences of the D - amino acid oxidase mutant enzyme CgDAAO - E218D are SEQ ID NO.7 and SEQ ID NO.8 respectively.

5. The method for preparing L-vinylglycine by multi-enzyme cascade according to claim 1, characterized in that: In step (3), the L - glutamate dehydrogenase is replaced by the L - glutamine dehydrogenase mutant CgGDH - Q113E, and the amino acid and DNA sequences of the L - glutamine dehydrogenase mutant CgGDH - Q113E are SEQ ID NO.23 and SEQ ID NO.24 respectively.

6. The method for preparing L-vinylglycine by multi-enzyme cascade according to any one of claims 1-5, characterized in that: In step (1), a buffer solution of 0.1 - 0.3 mol / L Tris-HCl is used, the pH is controlled at 5.5 - 7.5, and the reaction temperature is 20 - 35°C; in step (2), a 0.1 - 0.3 mol / L Tris-HCl buffer solution is used, the pH is controlled at 4.5 - 7, and the reaction temperature is 15 - 35°C; in step (3), a 0.1 - 0.3 mol / L Tris-HCl buffer solution or a phosphate buffer solution is used, the pH is controlled at pH 6.5 - 8.5, and the reaction temperature is 25 - 55°C.

Images