A substrate-tolerant xanthine oxidase mutant and its application
A mutant yellow phosphorus oxidase enzyme with enhanced substrate tolerance addresses the inhibition issue in high-concentration environments, effectively degrading purines and other compounds, enhancing fish sauce flavor and expanding its consumer base, and facilitating nucleoside drug production and biological sensor applications.
Patent Information
- Application Number
- CN202210930497.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-08-04
- Publication Date
- 2025-07-15
- Estimated Expiration
- 2042-08-04
AI Technical Summary
The catalytic efficiency of existing xanthine oxidases is reduced at high substrate concentration, resulting in limited enzymatic production and degradation effects, especially in the treatment of purines and unhealthy flavor substances in fish sauce.
By performing site-directed mutations on the β subunit of Acinetobacter bauma's xanthine oxidase, enhancing its tolerance to substrates, xanthine oxidase mutants with higher catalytic activity were prepared, including Q201E, Q201C, Q201L, P319K and P319Y, for degrading purines, acids, aldehydes and amines.
At high substrate concentration, xanthine oxidase mutants show stronger catalytic activity, can effectively degrade purines and unflavored substances in fish sauce, expand their application range to other catalytic substrates, and have potential applications in the field of biosensors.
Smart Images

Figure HDA0003781150590000011 
Figure HDA0003781150590000012 
Figure HDA0003781150590000021
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, specifically to a substrate-tolerant xanthine oxidase mutant and its applications. Based on Acinetobacter baumannii xanthine oxidase, a xanthine oxidase mutant with enhanced substrate tolerance to xanthine oxidation is created through point mutation. This mutant is used in the degradation of purine-containing substances, acids, aldehydes, amines, and nitrogen-containing heterocyclic substances. Background Technology
[0002] Xanthine oxidase (XOD) is a molybdenum-containing oxidoreductase encoded by the same gene as xanthine dehydrogenase (XDH), which is derived from XDH through post-translational modification. XOD can catalyze the oxidation of heterocyclic compounds, including purines, pterin, aldehydes, and amines. 2 The hybrid carbon atom has important commercial application value. The application of xanthine oxidase mainly involves five aspects: drug metabolism, nucleoside drug synthesis, in vitro detection, biorepair, and health food (Wang Chenghua, Xing Xinhui. Research progress and development prospects of xanthine oxidase [J]. Guangxi Science, 2017, 24(1):15-24.).
[0003] Substrate inhibition is a common phenomenon in xanthine oxidase catalysis. Previous studies have shown that when the xanthine substrate concentration is greater than 50 µM, xanthine oxidase exhibits substrate inhibition, manifested as a decreased enzymatic reaction rate and a slower rate of urate formation (RUBBO H, RADI R, PRODANOV E. Substrate inhibition of xanthine oxidase and its influence on superoxide radical production [J]. Biochimica et Biophysica Acta (BBA) - General Subjects, 1991, 386-391). Therefore, in situations involving ultra-high substrate concentrations, such as the enzymatic production of low-purine products, the enzymatic synthesis of nucleoside analogs like ribavirin, and the enzymatic degradation of organic pollutants, high substrate concentration inhibition limits the effective application of the enzyme.
[0004] Fish sauce is a clarified flavoring liquid obtained by naturally fermenting marine fish and then processing it. The inventors, through preliminary sampling and research and using high-performance liquid chromatography (HPLC) to determine the concentration, found that the hypoxanthine content in currently commercially available fish sauce seasonings can reach 1-2 mM. However, there are no reports on the effectiveness of XOD in degrading purines at this concentration. In addition, the unique flavor of fish sauce is mainly due to the large amount of acids, carbonyl groups, and sulfur-containing compounds (FUKAMI K, ISHIYAMA S, YAGURAMAKI H, et al. Identification of distinctive volatile compounds in fish sauce [J]. J Agric Food Chem, 2002, 50(19): 5412-6), while trimethylamine causes a fishy smell, and a mixture of butyric acid, valeric acid, hexanoic acid, and heptanoic acid produces a pungent, dirty sock smell (PHAM AJ, SCHILLING MW, YOON Y, et al. Characterization of fish sauce aroma-impact compounds using GC-MS, SPME-Osme-GCO, and Stevens' power law exponents [J]. JFood Sci, 2008, 73(4): C268-74). These special volatile components limit its acceptance range compared to soy sauce. Enzymatic methods for reducing the purine content and undesirable flavor compounds such as trimethylamine, aldehydes, acids, and heterocyclic compounds in fish sauce products represent a development direction for improving the quality and flavor of fish sauce, innovatively preparing low-purine fish sauce, expanding the consumer base for fish sauce products, and to some extent meeting the needs of people with hyperuricemia and gout.
[0005] In previous research, the inventors obtained a novel XDH source of capsular red bacteria (application number 201410764840.5, inventors Xing Xinhui, Wang Chenghua, and Zhang Chong, a xanthine dehydrogenase and its encoding gene and application), and a novel XDH source of Acinetobacter baumannii (application number 201510406718.5, inventors Xing Xinhui, Wang Chenghua, Zhang Chong, and Su Nan, an alkaline xanthine dehydrogenase and its application in a detection kit). Furthermore, through genetic engineering, we obtained a truncated variant XDH with higher catalytic activity (application number 201510048275.7, inventors Xing Xinhui, Wang Chenghua, and Zhang Chong, a truncated xanthine dehydrogenase and its application), a xanthine dehydrogenase mutant (application number 201710152663.9, inventors Xing Xinhui, Wang Chenghua, and Zhang Chong, a xanthine dehydrogenase mutant and its application), and a xanthine dehydrogenase mutant with oxidase function (application number 201911098145.9, inventors Wang Chenghua, Zhu Chunyan, Xie Feng, Zhang Ting, and Zhang Ran, an Acinetobacter baumannii xanthine dehydrogenase mutant and its application). Addressing the long-standing issue of inhibition at high substrate concentrations and the need for expanded research and application areas, this invention further develops novel XODs with a wider substrate tolerance range, stronger substrate affinity, and better catalytic efficiency. Summary of the Invention
[0006] The purpose of this invention is to provide a substrate-tolerant xanthine oxidase and its application. Based on Acinetobacter baumannii xanthine oxidase, a xanthine oxidase mutant with enhanced substrate tolerance to xanthine oxidation is created through point mutation. This mutant is used to degrade purine-containing substances, acids, aldehydes, amines, and nitrogen-containing heterocyclic substances.
[0007] The *Acinetobacter baumannii* xanthine oxidase mutant provided by this invention exhibits enhanced xanthine oxidase activity in a high substrate concentration model. This xanthine oxidase mutant is obtained by site-directed mutagenesis of the *Acinetobacter baumannii* xanthine oxidase sequence, which consists of the α subunit of the amino acid sequence shown in SEQ ID NO. 1 and the β subunit of the amino acid sequence shown in SEQ ID NO. 2. The site-directed mutagenesis involves mutation of only the β subunit (without mutation of the α subunit).
[0008] This invention provides a xanthine oxidase mutant of Acinetobacter baumannii, which is composed of an α subunit and a β subunit. The amino acid sequence of the α subunit is shown in SEQ ID NO.1, and the amino acid sequence of the β subunit is shown in SEQ ID NO.2 in the sequence listing.
[0009] The Acinetobacter baumannii xanthine oxidase mutant provided by this invention is composed of the following α subunit and β subunit.
[0010] The α subunit is as follows (a):
[0011] (a1) The amino acid sequence is the subunit shown in SEQ ID NO.1 in the sequence listing;
[0012] (a2) A subunit with the same function obtained by replacing and / or deleting and / or adding one or more amino acid residues in any amino acid sequence in (a1).
[0013] The β subunit is any one of the following (b1)-(b6):
[0014] (b1) The subunits of the amino acid sequence obtained by replacing glutamine (Q) at position 201 of SEQ ID NO.2 in the sequence listing with glutamic acid (E);
[0015] (b2) The amino acid sequence obtained by replacing glutamine (Q) at position 201 of SEQ ID NO.2 in the sequence listing with cysteine (C) is shown in the subunit;
[0016] (b3) The subunits obtained by replacing glutamine (Q) at position 201 of SEQ ID NO.2 in the sequence listing with leucine (L);
[0017] (b4) The subunits obtained by replacing proline (P) at position 319 of SEQ ID NO.2 in the sequence listing with lysine (K);
[0018] (b5) The subunits obtained by replacing proline (P) at position 319 of SEQ ID NO.2 in the sequence listing with tyrosine (Y);
[0019] (b6) A subunit with the same function obtained by replacing and / or deleting and / or adding one or more amino acid residues in any of the amino acid sequences in (b1)-(b5).
[0020] For (b1) above, the site-directed mutation specifically involves replacing glutamine (Q) at position 201 of the β subunit (SEQ ID NO.2) of Acinetobacter baumannii xanthine oxidase with glutamate (E). This mutation is denoted as Q201E.
[0021] For (b2) above, the site-directed mutation specifically involves replacing glutamine (Q) at position 201 of the β subunit (SEQ ID NO.2) of Acinetobacter baumannii xanthine oxidase with cysteine (C). This mutation is denoted as Q201C.
[0022] For (b3) above, the site-directed mutation specifically involves replacing glutamine (Q) at position 201 of the β subunit (SEQ ID NO.2) of Acinetobacter baumannii xanthine oxidase with leucine (L). This mutation is denoted as Q201L.
[0023] For (b4) above, the site-directed mutation specifically involves replacing the proline (P) at position 319 of the β subunit (SEQ ID NO.2) of Acinetobacter baumannii xanthine oxidase with a lysine (K). This mutation is denoted as P319K.
[0024] For (b5) above, the site-directed mutation specifically involves replacing the proline (P) at position 319 of the β subunit (SEQ ID NO.2) of Acinetobacter baumannii xanthine oxidase with a tyrosine (Y). This mutation is denoted as P319Y.
[0025] The nucleic acid molecule encoding the Acinetobacter baumannii xanthine oxidase mutant is also within the scope of protection of this invention.
[0026] The nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA, hnRNA, or tRNA.
[0027] The parental gene used to create xanthine oxidase mutants is the xanthine oxidase gene derived from *Acinetobacter baumannii*, whose nucleotide sequence is shown in SEQ ID NO.3. The DNA molecule represented by nucleotides 1 to 1500 from the 5' end of SEQ ID NO.3 encodes the α subunit, and the DNA molecule represented by nucleotides 1502 to 3877 encodes the β subunit. In addition to the α and β subunits, the gene also includes a base sequence encoding a chaperone protein essential for the formation of active xanthine dehydrogenase, with the corresponding base sequence being positions 3884 to 4867. Since the xanthine oxidase mutants Q201E, Q201C, Q201L, P319K, and P319L of this invention are mutated only in the β subunit of the parental enzyme, they possess the same amino acid sequence as the parental enzyme in their α subunit and chaperone protein.
[0028] The use of the Acinetobacter baumannii xanthine oxidase mutant as xanthine oxidase or as an enzyme preparation in food in any of the following is also within the scope of protection of this invention:
[0029] (a) Degradation of hypoxanthine and / or xanthine for non-disease treatment;
[0030] (b) Degradation of materials containing hypoxanthine and / or xanthine;
[0031] The application of the Acinetobacter baumannii xanthine oxidase mutant in the preparation of products with xanthine oxidase activity also falls within the scope of protection of this invention:
[0032] The optimal temperature for the Acinetobacter baumannii xanthine oxidase mutant Q201E in a 5 mM xanthine system was 45°C, and the optimal pH was 9. Kinetic analysis showed that Km was 3.53 µM, Ki was too high to fit, no inhibition was observed, and the transformation number was 189.15 s⁻¹. -1 The specific activity was 79.31 U / mg protein. At this concentration, it was 1.95 times higher than that of the parent enzyme.
[0033] The optimal temperature for the Acinetobacter baumannii xanthine oxidase mutant Q201C in a 5 mM xanthine system was 40 °C, and the optimal pH was 9.5. Kinetic analysis showed that Km was 11.66 µM, Ki was too high to fit, no inhibition was observed, and the transformation number was 147.70 s⁻¹. -1 The specific activity was 61.93 U / mg protein. At this concentration, it was 1.52 times higher than that of the parent enzyme.
[0034] The optimal temperature for the Acinetobacter baumannii xanthine oxidase mutant Q201L in a 5 mM xanthine system is 40 °C, and the optimal pH is 9. Kinetic measurements show that Km is 6.48 µM and Ki is 115.9 × 10⁻⁶. 3 µM, transformation number 121.25 s -1 The specific activity is 50.84 U / mg protein. At this concentration, it is 1.25 times higher than that of the parent enzyme.
[0035] The optimal temperature for the Acinetobacter baumannii xanthine oxidase mutant P319K in a 5 mM xanthine system is 50°C, and the optimal pH is 8.5. Kinetic measurements show that the Km is 7.37 × 10⁻⁶. 3 µM, Ki was too large to fit, no suppression was observed, and the transformation number was 348.92 s. -1 Its specific activity is 146.3 U / mg protein, which is 3.60 times higher than that of the parent enzyme.
[0036] The optimal temperature for the Acinetobacter baumannii xanthine oxidase mutant P319Y in a 5 mM xanthine system was 55°C, and the optimal pH was 8.5. Kinetic analysis showed that Km was 86.17 µM, Ki was too high to fit, no inhibition was observed, and the transformation number was 161.37 s⁻¹. -1 The specific activity is 67.66 U / mg protein. At this concentration, it is 1.66 times higher than that of the parent enzyme.
[0037] The outstanding beneficial effects of this invention are as follows:
[0038] The provided Acinetobacter baumannii xanthine oxidase mutant exhibits stronger xanthine oxidase activity than the parent enzyme at high substrate concentrations. It can utilize molecular oxygen as an electron acceptor to degrade hypoxanthine byproducts generated during the production of nucleoside analogs such as ribavirin, as well as high concentrations of xanthine and undesirable flavor substances such as 2-methylbutyraldehyde, 2-methylpropionic acid, and trimethylamine in fish sauce. It can also be extended to other catalytic substrates, such as the oxidation of various substrates including other purines, pteridines, heterocyclic molecules, and aldehydes, and various types of electron acceptors such as methylene blue, benzoquinone, ferricyanide, and nitrates. Furthermore, this mutant xanthine oxidase can be applied to the field of biosensors. Attached Figure Description
[0039] Figure 1 SDS-PAGE electrophoresis images of purified recombinant xanthine oxidase mutants. Lane M: Standard protein marker, band sizes are 245 kDa, 180 kDa, 135 kDa, 100 kDa, 75 kDa, 63 kDa and 48 kDa; (A) Lane 1: Mutant Q201E; (B) Lane 1: Mutant P319K; (C) Lane 1: Mutant Q201C; Lane 2: Mutant Q201L; (D) Lane 1: Mutant P319Y
[0040] Figure 2 The enzyme activity of the purified recombinant xanthine oxidase mutant in a 5 mM xanthine system was measured.
[0041] Figure 3 The graph shows the purine-lowering effect of Q201E in fish sauce. (A) shows the purine-lowering effect of the parent enzyme in fish sauce as determined by HPLC; (B) shows the purine-lowering effect of Q201E in fish sauce as determined by HPLC. In the graph, 1 represents uric acid, 2 represents hypoxanthine, 3 represents xanthine, and Control represents the control group. Detailed Implementation
[0042] The technical solution of the present invention will be further described below through specific embodiments.
[0043] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.
[0044] Unless otherwise specified, all experimental materials and reagents used in the following examples are commercially available.
[0045] The gene source strain was Acinetobacter baumannii, purchased from the China Industrial Microbial Culture Collection Center (CICC), strain number CICC10254.
[0046] pTrc99A is a product of Biovector Science Lab, Inc., a Chinese gene repository of plasmid vector strains and cell lines. Its catalog number is Biovector 108321 (GenBank accession number is M22744.1). [Amann, E., Ochs, B. and Abel, KJ: Tightly regulated tac promoter vectors useful for the expression of unfused and fused proteins in Escherichia coli. Gene, 1988, 69(2):301-315.]
[0047] The recombinant plasmid pTRAN-Y351V is a recombinant plasmid expressing xanthine oxidase from the parent Acinetobacter baumannii. It is obtained by preparing the recombinant plasmid in Example 1 of the applicant's previous patent application (application number 201911098145.9, inventors Wang Chenghua, Zhu Chunyan, Xie Feng, Zhang Ting, and Zhang Ran, A mutant of xanthine dehydrogenase from Acinetobacter baumannii and its application). The gene sequence information of the parent enzyme in the plasmid is shown in SEQ ID NO.3.
[0048] The nickel ion metal chelate affinity chromatography medium—nickel column affinity resin—is a product of Tianyan Biotechnology Co., Ltd.
[0049] Xanthine is a product of Sigma, catalog number Sigma X7375-10g.
[0050] The Acinetobacter baumannii substrate-tolerant xanthine oxidase mutants in the following examples all refer to the Acinetobacter baumannii substrate-tolerant xanthine oxidase mutants prepared in Example 1, whose small and large subunits are abbreviated as α subunit (XDHA) and β subunit (XDHB), respectively.
[0051] Example 1
[0052] Preparation of substrate-tolerant xanthine oxidase mutants of Acinetobacter baumannii
[0053] I. Construction of recombinant plasmids of Acinetobacter baumannii substrate-tolerant xanthine oxidase mutant
[0054] 1. Selection of mutation sites and design of mutation primers
[0055] This invention selects the Q201 site, which has a potential correlation with the substrate channel conformation, and the P319 site, which has a potential interaction with the substrate in the substrate channel, for site-directed mutagenesis to construct a substrate-tolerant Acinetobacter baumannii xanthine oxidase mutant.
[0056] A PCR primer-mediated mutagenesis method was used to construct a mutant using the plasmid DNA of Y351V, which the team had previously patented, as the parental template. The designed primer sequences are as follows:
[0057] Primer pairs for constructing the mutant at the Q201E site:
[0058] Q201E-S:5'- gattccacaagaaaat GAG agtttaaaagtctattgctcgacacaacat -3'(SEQ ID NO.4)
[0059] Q201E-A:5'- gcaatagacttttaaact CTC attttcttgtggaatcgcataagaaatc -3'(SEQ ID NO.5)
[0060] Primer pairs for constructing the mutant at the Q201C site:
[0061] Q201C-S:5'- gattccacaagaaaat TGT agtttaaaagtctattgctcgacacaacat -3'(SEQ ID NO.6)
[0062] Q201C-A:5'- gcaatagacttttaaact ACA attttcttgtggaatcgcataagaaatc -3'(SEQ ID NO.7)
[0063] Primer pairs for constructing the mutant at the Q201L site:
[0064] Q201L-S:5'- gattccacaagaaaat CTT agtttaaaagtctattgctcgacacaacat -3'(SEQ ID NO.8)
[0065] Q201L-A:5'- gcaatagacttttaaact AAG attttcttgtggaatcgcataagaaatc -3'(SEQ ID NO.9)
[0066] Primer pairs for constructing the mutant at the P319K site:
[0067] P319K-S:5'- GATCTTTCTGGG AAGGTAAATGAACGTGCGATTTGCCATATTG -3' (SEQ IDNO.10)
[0068] P319K-A:5'- ACGTTCATTTAC CTT CCCAGAAAGATCAGCCGAAAAACCAC -3' (SEQ IDNO.11)
[0069] Primer pairs for constructing the mutant at the P319Y site:
[0070] P319Y-S:5'- GATCTTTCTGGG TAT GTAAATGAACGTGCGATTTGCCATATTG -3' (SEQ IDNO.12)
[0071] P319Y-A:5'- ACGTTCATTTAC ATA CCCAGAAAGATCAGCCGAAAAACCAC -3' (SEQ IDNO.13)
[0072] 2. Amplification of PCR products
[0073] Using the plasmid DNA of the mutant Y351V, which the team had previously applied for a patent for, as the parental template, the Y351V mutation occurs on the α subunit of the protein. Using the upstream and downstream primers synthesized in step 1 above as primers, PCR amplification was performed to obtain a full-length plasmid PCR product of 9kb in length, which is the full-length recombinant plasmid fragment of the Acinetobacter baumannii substrate-tolerant xanthine oxidase mutant.
[0074] 25 μL PCR reaction system: 1 ng total plasmid DNA, 0.5 μL upstream primer, 0.5 μL downstream primer, 5 μL 5×PrimeSTAR Reaction buffer, 2 μL dNTPs (2.5 mM each), 0.25U PrimeSTAR DNA polymerase, and ddH2O to bring the total to 25 μL.
[0075] The PCR reaction program was as follows: 95℃ pre-denaturation for 3 min; 98℃ for 10 s, 68℃ for 9 min, 25 cycles; and finally annealing at 68℃ for 2 min.
[0076] 3. Transformation of PCR products
[0077] The PCR product obtained above was added to 10 U of DpnI enzyme and incubated in a 37°C water bath for 1 hour to demethylate the template plasmid. Then, using standard molecular biology procedures, 10 μL of the digested product was directly transformed into E. coli DH5α competent cells. The transformation product was plated on LB solid medium containing ampicillin (50 µg / mL) and incubated upside down in a 37°C incubator for 16 hours.
[0078] 4. Screening for high substrate-tolerant xanthine oxidase mutants of Acinetobacter baumannii
[0079] Single colonies of the recombinant bacteria were selected from the above transformation products and inoculated into 10 mL of LB liquid medium containing 50 μg / mL ampicillin. The cultures were incubated at 37 ℃ and 220 rpm / min until OD500. 600 To a concentration of approximately 0.3–0.6, add 1 mM IPTG inducer and continue induction culture for 16 h under the same conditions. Centrifuge the induced bacterial culture at 8000 rpm / min, 4℃ for 10 min, collect the precipitate to obtain the induced engineered bacteria, and resuspend the precipitate in 600 μL of phosphate buffer (50 mM, pH 7.4) to obtain the bacterial suspension. Disrupt the cells using a high-throughput cryogenic cell disruptor for 12 min, pausing for 1 min every 3 min. Centrifuge the disrupted cell solution at 12000 rpm / min, 4℃ for 30 min, and the supernatant is the crude enzyme solution. The xanthine oxidase activity of the crude enzyme solution is determined using the following method:
[0080] Construct a 2 mL reaction system as follows: 1 mL of 100 mM Tris-HCl buffer solution (pH 8.5); 0.20 mL of 10 mM EDTA (pH 8.5); 0.02 mL of 10 mM potassium oxonate aqueous solution; 0.1 mL of 100 mM xanthine solution; 0.58 mL of ddH₂O; and 0.1 mL of 10 µg / mL crude enzyme solution.
[0081] Except for the enzyme solution, which is added last, the order of addition of other samples is not important. After mixing all reagents in the reaction system except for the aqueous solution of *Acinetobacter baumannii* xanthine oxidase mutant, incubate at 40°C for 5 min. Then add 100 μL of the aqueous solution of *Acinetobacter baumannii* xanthine oxidase mutant to initiate the reaction. Record the OD of the reaction system within 3-5 min while reacting at 40°C. 314 Calculate the rate of change of absorbance over time (ΔOD) in the initial linear portion of the reaction curve based on the change in absorbance. 314 / min).
[0082] The plasmids extracted from positive clones with enzyme activity were sequenced for verification. The resulting plasmid was the DNA molecule obtained by replacing the DNA fragment between the NcoI and HindIII enzyme recognition sites of the pTrc99A plasmid with the sequence shown in the image, which is the DNA molecule obtained by replacing the cag at positions 2102-2104 of SEQ ID NO.3 with gag. This recombinant plasmid was named pTRAN-Q201E, which is the recombinant plasmid that produces the Acinetobacter baumannii substrate-tolerant xanthine oxidase mutant. It expresses the Acinetobacter baumannii xanthine oxidase mutant and is designated Q201E. In Q201E, glutamine is replaced with glutamate at the Q201 site.
[0083] The DNA molecule shown in SEQ ID NO.3 encodes the α subunit from nucleotides 1 to 1500 from the 5' end, with an amino acid sequence as shown in SEQ ID NO.1 and a size of approximately 56 kDa. The DNA molecule encodes the β subunit from nucleotides 1502 to 3877, with an amino acid sequence as shown in SEQ ID NO.2 and a size of 87 kDa. Nuclei 3884 to 4867 encode the chaperone protein sequence required for active xanthine oxidase, with an amino acid sequence as shown in SEQ ID NO.14 and a size of 37 kDa.
[0084] Using the same method, the mutant of the Q201 site and its recombinant plasmid pTRAN-Q201C were constructed by PCR amplification using Q201C-S and Q201C-A, respectively; the recombinant plasmid pTRAN-Q201L was constructed using Q201L-S and Q201L-A; the mutant of the P319 site and its recombinant plasmid pTRAN-P319K was constructed using P319K-S and P319K-A; and the mutant of the P319 site and its recombinant plasmid pTRAN-P319Y was constructed using P319Y-S and P319Y-A. The structure of pTRAN-Q201C is described as follows: the recombinant plasmid obtained by replacing the DNA fragment between the NcoI and HindII enzyme recognition sites of the pTrc99A plasmid with the DNA molecule shown in the sequence obtained by replacing "cag at positions 2102-2104 of SEQ ID NO.3 with tgt". The structure of pTRAN-Q201L is described as follows: a recombinant plasmid obtained by replacing the DNA fragment between the NcoI and HindII enzyme recognition sites of pTrc99A plasmid with the DNA molecule obtained by replacing "cag" at positions 2102-2104 of SEQ ID NO. 3 with "ctt". The structure of pTRAN-P319K is described as follows: a recombinant plasmid obtained by replacing the DNA fragment between the NcoI and HindII enzyme recognition sites of pTrc99A plasmid with the DNA molecule obtained by replacing "cca" at positions 2456-2458 of SEQ ID NO. 3 with "aag". The structure of pTRAN-P319Y is described as follows: a recombinant plasmid obtained by replacing the DNA fragment between the NcoI and HindII enzyme recognition sites of pTrc99A plasmid with the DNA molecule obtained by replacing "cca" at positions 2456-2458 of SEQ ID NO. 3 with "tat". The recombinant plasmids contain only a mutation in the β subunit, while the α subunit is identical to the parental sequence.
[0085] II. Purification of xanthine oxidase mutants from Acinetobacter baumannii
[0086] 1. Transform the pTRAN-Q201E obtained in step one above into *Escherichia coli* DH5α to obtain recombinant bacteria. Pick a single colony of the recombinant bacteria and inoculate it into 5 mL of LB broth containing 50 µg / mL ampicillin. Incubate overnight at 37°C and 220 rpm / min. Transfer the overnight culture to 500 mL of LB broth containing 50 μg / mL ampicillin at a 1% inoculation rate and incubate at 37°C and 220 rpm / min until the culture reaches OD200. 600 The concentration was approximately 0.3-0.6. IPTG inducer was added to a final concentration of 1 mM, and the culture was continued for 18 h under the same conditions.
[0087] 2. Centrifuge the bacterial solution obtained in step 1 at 8000 rpm / min for 10 min, collect the precipitate, and obtain the engineered bacteria for induced expression. Resuspend the bacterial cells in 30 mL of phosphate buffer (50 mM, pH 7.4) to obtain a bacterial suspension. Disrupt the cells in the bacterial suspension using an ultrasonic cell disruptor (Nanjing Xianou Instrument Manufacturing Co., Ltd. X0-400SD). Sonicate for 2 seconds, rest for 2 seconds, and sonicate for 30 min. Centrifuge the cell disruption solution at 12000 rpm / min for 30 min at 4℃. The supernatant is the crude enzyme solution.
[0088] 3. Purification of substrate-tolerant xanthine oxidase mutant of Acinetobacter baumannii by metal chelate chromatography
[0089] (1) The crude enzyme solution obtained in step 2 above was filtered through a 0.22 μm filter membrane to obtain the filtrate;
[0090] (2) Load the filtrate with a total volume of 30 mL onto the nickel column affinity resin, and wash the impurities with 20 mM, 50 mM and 80 mM imidazole, 500 mM sodium chloride and 20 mM pH 7.4 phosphate buffer in sequence. The volume of each elution should be at least 10 column volumes. Then elute with 100 mM imidazole, 500 mM sodium chloride and 20 mM pH 7.4 phosphate buffer. Collect the eluent as the target recombinant enzyme. The flow rate of the above elution is 1.5 mL / min.
[0091] The xanthine oxidase mutant Q201E of Acinetobacter baumannii was detected by denaturing polyacrylamide gel electrophoresis (SDS-PAGE), and the results are as follows: Figure 1 As shown, the results indicate that Q201E consists of two subunits: a small subunit of approximately 56 kDa and a large subunit of approximately 87 kDa. The purified enzyme does not contain a chaperone protein of approximately 37 kDa.
[0092] The same method was used to express and purify the xanthine oxidase mutants Q201C, Q201L, P319K, and P319Y from Acinetobacter baumannii. The SDS-PAGE results are also listed below. Figure 1 The results showed that Q201C, Q201L, P319K, and P319Y are all composed of two types of subunits: a small subunit of approximately 56 kDa and a large subunit of approximately 87 kDa.
[0093] Example 2
[0094] The substrate-tolerant xanthine oxidase mutant of Acinetobacter baumannii was characterized as xanthine oxidase at a substrate concentration of 5 mM.
[0095] I. Methods for determining xanthine oxidase activity
[0096] Based on the following reactions catalyzed by xanthine oxidase (reactions 1 and 2), and the fact that xanthine substrates have a significant specific absorption effect on uric acid at 295 nm, 314 nm, which has a smaller influence on xanthine characteristic absorption, was selected as the wavelength for detecting uric acid. The enzyme activity can be characterized by measuring the production of uric acid by spectrophotometry.
[0097] Reaction 1
[0098] Reaction 2
[0099] In this invention, the reaction system for determining xanthine oxidase activity is shown in Table 1.
[0100] Table 1. Composition of the 2 mL reaction system for xanthine oxidase activity assay
[0101] serial number Reagent Name Mother liquor concentration (mM) Amount added (µL) Final concentration (mM) 1 Tris-HCl (pH 8.5) 100 1000 50 2 EDTA (pH 8.5) 10 200 1 3 Potassium oxonate aqueous solution 10 20 0.1 4 xanthine storage solution 100 100 0.1 5 enzyme solution 0.1 U / mL 100 6 <![CDATA[ddH2O]]> 580
[0102] In Table 1, except for the enzyme solution which was added last, the order of addition of other samples was not important. After mixing all reagents in the reaction system except for the aqueous solution of the Acinetobacter baumannii substrate-resistant xanthine oxidase mutant, the mixture was incubated in a 40°C water bath for 5 min. Then, 100 μL of the Acinetobacter baumannii substrate-resistant xanthine oxidase mutant aqueous solution was added to initiate the reaction. The OD of the reaction system was recorded within 3-5 min while the reaction was under 40°C. 314 Calculate the rate of change of absorbance over time (ΔOD) in the initial linear portion of the reaction curve based on the change in absorbance. 314 / min).
[0103] The enzyme activity and specific enzyme activity of the xanthine oxidase being tested are calculated using the following formula.
[0104] Enzyme activity (U / mL) = ΔOD 314 / min×16×df (Formula 1)
[0105] Specific enzyme activity (U / mg) = (U / mL) × 1 / C (Formula 2)
[0106] In Formula 1, 16 is the coefficient used to convert the change in absorbance of uric acid in the above 2 mL reaction system into molar concentration using the extinction coefficient method. The calculation method for this coefficient is as follows:
[0107] (Formula 3)
[0108] Where: Vt is the total reaction volume (2.0 mL), Vs is the enzyme solution volume in the reaction system (0.1 mL), and 1.25 is the molar extinction coefficient of uric acid under the assay conditions (cm). 2 / μmol), 1.0 cm is the optical path length of the measuring cuvette.
[0109] In Formula 1, df represents the enzyme solution dilution factor.
[0110] In Formula 2, C represents the concentration of the enzyme solution, in mg / mL.
[0111] Enzyme activity unit (U) definition: The amount of enzyme required to convert 1 μmol of uric acid per minute under the measured temperature and pH conditions.
[0112] II. Determination of Optimal Temperature and Optimal pH
[0113] When using xanthine as a substrate, the optimal pH and optimal temperature of the Acinetobacter baumannii xanthine oxidase mutant prepared in Example 1 as xanthine oxidase in a 5 mM xanthine system were specifically determined.
[0114] The optimal temperature was determined by constructing a 600 μL reaction system according to Table 1 and measuring enzyme activity within the range of 30-80℃. The optimal temperature is expressed as the temperature corresponding to the maximum relative enzyme activity.
[0115] The optimal pH value was determined by measuring the relative enzyme activity in buffer systems within the pH range of 5.5-12.0, and expressed as the pH value corresponding to the maximum enzyme activity. Specifically, the 0.05 M pH 8.5 Tris hydrochloric acid buffer solution in the reaction systems in Table 1 (xanthine oxidase activity) was replaced with phosphate buffer systems at pH 5.5-7.5, Tris hydrochloric acid buffer systems at pH 8-9.5, sodium carbonate buffer systems at pH 10-10.5, and phosphate-NaOH buffer systems at pH 10.5-12, respectively, for measurement.
[0116] The results are shown in Table 2. When used as xanthine oxidase in a 5 mM xanthine system, the optimal pH for each Acinetobacter baumannii substrate-tolerant xanthine oxidase mutant was as follows: Q201E had an optimal pH of 9, 2 pH units higher than the parent enzyme; and an optimal temperature of 45℃, 5℃ lower than the parent enzyme. Q201C had an optimal pH of 9.5, 2.5 pH units higher than the parent enzyme; and an optimal temperature of 40℃, 10℃ lower than the parent enzyme. Q201L had an optimal pH of 9, 2 pH units higher than the parent enzyme; and an optimal temperature of 40℃, 10℃ lower than the parent enzyme. P319K had an optimal pH of 8.5, 1.5 pH units higher than the parent enzyme; and an optimal temperature of 50℃, consistent with the parent enzyme. P319Y had an optimal pH of 8.5, 1.5 pH units higher than the parent enzyme; and an optimal temperature of 55℃, 5℃ higher than the parent enzyme.
[0117] Table 2. Partial enzymatic parameters of substrate-tolerant xanthine oxidase mutants and parental enzymes in Acinetobacter baumannii.
[0118] mutant enzyme Temperature (°C) pH Km(µM) <![CDATA[kcat (s -1 )]]> Ki(µM) <![CDATA[kcat / Km(µM -1 s -1 )]]> Ki / Km WT 50 7 13.31 96.93 <![CDATA[21.11×10 3 ]]> 7.28 <![CDATA[1.59×10 3 ]]> Q201E 45 9 3.53 189.15 <![CDATA[NI a ]]> 53.66 <![CDATA[NA b ]]> Q201C 40 9.5 11.66 147.70 <![CDATA[NI a ]]> 12.67 <![CDATA[NA b ]]> Q201L 40 9 6.48 121.25 <![CDATA[115.4×10 3 ]]> 18.72 <![CDATA[17.89×10 3 ]]> P319K 50 8.5 <![CDATA[7.37×10 3 ]]> 348.92 <![CDATA[NI a ]]> 0.047 <![CDATA[NA b ]]> P319Y 55 8.5 86.2 161.37 <![CDATA[NI a ]]> 1.87 <![CDATA[NA b ]]>
[0119] III. Enzyme Kinetic Parameters
[0120] The xanthine oxidase activity of the substrate-tolerant xanthine oxidase mutants of *Acinetobacter baumannii* in Example 1 was determined according to the method described in Step 1 above. Under optimal temperature and pH conditions, and within a concentration range of 0.005–1 mM, the initial reaction rate of xanthine degradation by each *Acinetobacter baumannii* xanthine oxidase mutant conformed to the Michaelis-Menten kinetic equation. Nonlinear fitting was performed according to the Michaelis-Menten equation, and the results are shown in Table 3. Compared to the parent enzyme, the Ki values of the mutant enzymes were all much higher than those of the parent enzyme, and no substrate inhibition was even observed. Specifically, the Km values of P319K and P319Y were 7.37 × 10⁻⁶. 3 The Km values of Q201E, Q201C, and Q201L are both greater than those of the parent enzyme, indicating decreased substrate affinity. Conversely, the Km values of Q201E, Q201C, and Q201L are 3.53 µM, 11.66 µM, and 6.48 µM, respectively, which are smaller than those of the parent enzyme, indicating increased substrate affinity. The substrate-tolerant xanthine oxidase mutants Q201E, Q201C, Q201L, P319K, and P319Y provided by this invention all exhibit stronger xanthine oxidation function in a 5 mM xanthine system. The ratios of the five oxidases' activities to the parent enzyme's activity in the 5 mM system are 296%, 235%, 154%, 177%, and 265%, respectively, representing increases of 2.90 times, 2.35 times, 1.55 times, 1.77 times, and 2.68 times compared to the parent enzyme.
[0121] Example 3
[0122] Application of Acinetobacter baumannii substrate-tolerant xanthine oxidase mutant as xanthine oxidase in high substrate concentration systems for the degradation of xanthine and hypoxanthine and the treatment of materials containing these substrates.
[0123] Referring to the construction method of the xanthine oxidase reaction system in Table 1, the following five reaction systems (a) to (e) were constructed:
[0124] a) 50 mM Tris-HCl buffer solution (pH 8.5) containing 1 mM EDTA, 0.1 mM potassium oxonate, 5 mM xanthine, and 10 mg / L Acinetobacter baumannii substrate-tolerant xanthine oxidase mutant Q201E prepared in Example 1.
[0125] b) 50 mM Tris-HCl buffer solution (pH 8.5) containing 1 mM EDTA, 0.1 mM potassium oxonate, 5 mM xanthine, and 10 mg / L Acinetobacter baumannii substrate-tolerant xanthine oxidase mutant Q201C prepared in Example 1.
[0126] c) 50 mM Tris-HCl buffer solution (pH 8.5) containing 1 mM EDTA, 0.1 mM potassium oxonate, 5 mM xanthine, and 10 mg / L Acinetobacter baumannii substrate-tolerant xanthine oxidase mutant Q201L prepared in Example 1.
[0127] d) 50 mM Tris-HCl buffer solution (pH 8.5) containing 1 mM EDTA, 0.1 mM potassium oxonate, 5 mM xanthine, and 10 mg / L Acinetobacter baumannii substrate-tolerant xanthine oxidase mutant P319K prepared in Example 1.
[0128] e) 50 mM Tris-HCl buffer solution (pH 8.5) containing 1 mM EDTA, 0.1 mM potassium oxonate, 5 mM xanthine, and 10 mg / L Acinetobacter baumannii substrate-tolerant xanthine oxidase mutant P319Y prepared in Example 1.
[0129] Add all reagents except enzymes to the five reaction systems (a) to (e) above and mix well. Incubate in a 40°C water bath for 5 min. Then add the corresponding purified enzyme solution to start the reaction. Use an ELISA reader with a heating module to control the reaction temperature at 40°C. Record the absorbance changes at 314 nm within 3-5 min of the reaction and plot the absorbance (ΔOD). 314 The relationship curve between absorbance and time was calculated, and the rate of change of absorbance (ΔOD) in the initial linear portion of the reaction curve was calculated. 314 The degradation of the substrate xanthine was detected by changes in uric acid ( / min).
[0130] The experimental results of groups a) to e) are listed below Figure 2 middle. Figure 2 The text indicates that:
[0131] When using 5 mM xanthine as a substrate, the rate of change of maximum absorbance (ΔOD) in the five reaction systems (a) to (e) 314 The values per minute (%) were 0.003583, 0.003329, 0.002819, 0.06996, and 0.08443, respectively.
[0132] Therefore, compared to the parental enzyme, which cannot utilize oxygen in the air as an electron acceptor and relies on NAD as an electron acceptor, the Acinetobacter baumannii substrate-tolerant xanthine oxidase mutants Q201E, Q201C, Q201L, P319K, and P319Y provided by this invention can effectively oxidize and degrade xanthine and hypoxanthine to produce uric acid.
[0133] Example 4
[0134] Application of Acinetobacter baumannii substrate-tolerant xanthine oxidase mutant as xanthine oxidase in fish sauce system for the degradation of xanthine and hypoxanthine and the treatment of materials containing such substrates.
[0135] The pH of the commercial fish sauce (Weihai Puyuan Food Co., Ltd.) was adjusted to 8.5 using 0.5 M sodium hydroxide.
[0136] Taking Q201E as an example, the fish sauce application reaction system was prepared with the above-mentioned pH=8.5 fish sauce as the reaction solution. The enzyme was added to the reaction system at a rate of 1.6 U / mL. The reaction solution was placed in a 40℃ water bath for 30 min, followed by boiling water inactivation for 20 min. The control group was first inactivated by boiling water for 20 min, and then reacted for 30 min. After the reaction was completed, the mixture was centrifuged at 130,000 rpm / min for 20 min, and then filtered through a membrane at 0.22 µm for HPLC analysis.
[0137] The chromatographic conditions were as follows: 20 mM potassium dihydrogen phosphate at pH 4.1: pure methanol = 95:5, column temperature 25℃, flow rate 0.5 mL / min, analysis time 20 min, and the column used was a Symmetry Shield RP18 column (100 Å, 5 µm, 4.6 mm × 250 mm, 1 pk, Waters).
[0138] The experimental results are listed in Figure 3 In the study, using fish sauce as the reaction system, after incubating Q201E at 40°C and pH 8.5 for 30 min, the change in uric acid concentration in the fish sauce (pH=8.5) was 15.81±1.38 μmol / mL, which was 7 times that of the parent enzyme (2.26±1.16 μmol / mL). The change in xanthine concentration was 103.09±10.41 μmol / mL, which was 14.5 times that of the parent enzyme (7.08±3.58 mol / mL).
[0139] Example 5
[0140] Application of Acinetobacter baumannii substrate-tolerant xanthine oxidase mutant in fish sauce system for the treatment of volatile components and materials containing this type of substrate.
[0141] The pH of the commercial fish sauce (Weihai Puyuan Food Co., Ltd.) was adjusted to 7 using 0.5 M sodium hydroxide, and then the pH was adjusted to 8.5 using 100 mM xanthine stock solution.
[0142] The fish sauce reaction system using P319K as an example uses the fish sauce prepared above with pH=8.5 as the reaction solution. The enzyme is added to the reaction system at a rate of 1.6 U / mL. The reaction solution is placed in a 40℃ water bath for 30 min, followed by boiling water inactivation for 20 min. The control group is first inactivated by boiling water for 20 min, then reacted for 30 min. After the reaction is completed, the mixture is centrifuged at 130,000 rpm for 20 min and then used for GC-IMS and GC-MS detection.
[0143] Take 5 mL of the reaction solution into a 30 mL headspace vial for analysis. Headspace-Solid Phase Micro Extraction (HS-SPME) was used to treat the volatile components of the sample. The extraction head was aged at 250℃ for 30 min, and the sample was equilibrated in a 60℃ water bath for 10 min. After the aging time, the extraction handle was quickly inserted into the headspace vial, penetrating to the upper 1 / 3 of its length. The extraction head was then pulled out, and timing began. The adsorption time at 60℃ was 40 min. After adsorption, the extraction head was quickly reinserted, and the desorption time was 5 min.
[0144] The gas phase temperature program was as follows: initial temperature 50℃, held for 3 min, then increased to 250℃ at a rate of 5℃ / min, held for 10 min. The injection port temperature was 250℃. High-purity nitrogen was used as the carrier gas at a flow rate of 1 mL / min, and a VF-WAX 60m column was used. The mass spectrometry conditions were: interface temperature 280℃, ion source temperature 230℃, electron energy 70 eV, and mass scan range 30–400 u.
[0145] The experimental results are listed in Table 3.
[0146] Table 3. GC-MS Identification of Volatile Components in Fish Sauce
[0147] NO Compound Name Peak time (min) <![CDATA[RI 1 ]]> peak area of control group peak area of reaction group Response group / control group 1 <![CDATA[sec-Butylamine c > 3.946 <1000 580797.5 404170.3 70% 2 <![CDATA[Trimethylamine c > 4.147 <1000 6280452 4091438 65% 3 <![CDATA[2-Butanone c > 6.126 <1000 591189.3 511452.8 87% 4 <![CDATA[2-Methylbutyraldehyde c > 6.311 <1000 833152 261576.8 31% 5 <![CDATA[Isovaleraldehyde c > 6.366 <1000 899993.5 488172 54% 6 <![CDATA[2,3-Butanedione c > 7.307 <1000 98470.75 192535.8 196% 7 <![CDATA[2-Pentanone c > 7.369 <1000 98470.75 192535.8 196% 8 <![CDATA[Isoxazole c > 7.901 1001 131451.8 76495.25 58% 9 <![CDATA[n-Propanol b,c > 8.516 1029 6692 116444.5 1740% 10 <![CDATA[Sodium dimethyldisulfide b,c > 9.379 1068 898066.3 653524.8 73% 11 <![CDATA[2-Methyl-2-butenal b,c > 9.965 1094 356206.8 221484.5 62% 12 <![CDATA[Pyridine b,c > 12.365 1188 108828.3 102371.3 94% 13 <![CDATA[2-Methylbutanol b,c > 12.679 1200 609355.8 802520 132% 14 <![CDATA[Pyrimidine b,c > 13.047 1214 190431.8 196851.5 103% 15 <![CDATA[2-Methylpyridine b,c > 13.138 1217 29246.25 30796 105% 16 <![CDATA[Propylene glycol monomethyl ether acetate b,c > 13.195 1219 118084.5 265794 225% 17 <![CDATA[Styrene b,c > 14.15 1254 18954.75 7617.25 40% 18 <![CDATA[2-Methylpyrazine b,c > 14.527 1268 799140.3 801433.5 100% 19 <![CDATA[2-Ethylpyridine b,c > 14.94 1283 78197 90974.25 116% 20 <![CDATA[Cyclohexanone b,c > 15.442 1302 947004.8 670302 71% 21 <![CDATA[2,5-Dimethylpyrazine b,c > 16.06 1324 2573489 1283099 50% 22 <![CDATA[2,6-Dimethylpyrazine b,c > 16.206 1330 745451.8 657107.8 88% 23 <![CDATA[n-Hexanol b,c > 16.645 1346 10832.75 42444 392% 24 <![CDATA[2-Isopropylpiperazine b,c > 16.913 1356 185108 132209.5 71% 25 <![CDATA[2,4,6-Trimethylpyridine b,c > 17.184 1366 100536.3 96793.5 96% 26 <![CDATA[3-Ethylpyridine b,c > 17.672 1383 18725.25 19279.75 103% 27 <![CDATA[2-Ethyl-6-methylpyrazine b,c > 17.751 1386 369470 365408 99% 28 <![CDATA[Dimethyl trisulfide b,c > 17.952 1394 1292974 182735 14% 29 <![CDATA[2,3,5-Trimethylpyrazine b,c > 18.237 1404 436755.3 236942.5 54% 30 <![CDATA[2-Methyl-5-isopropylpyrazine b,c > 18.461 1413 975720.5 326342 33% 31 <![CDATA[Ethyl octanoate b,c > 18.889 1430 85635.75 503.75 1% 32 <![CDATA[2-Ethyl-3,5-dimethylpyrazine b,c > 19.306 1446 278652.8 132365.3 48% 33 <![CDATA[Glacial acetic acid b,c > 19.609 1457 159933.3 59438.25 37% 34 <![CDATA[3-Methylthiopropionaldehyde b,c > 19.706 1461 109736 278078.5 253% 35 <![CDATA[Furfural b,c > 19.884 1468 145597.5 144039.5 99% 36 <![CDATA[Isooctanol b,c > 20.264 1483 186138.8 103746.8 56% 37 <![CDATA[2-Acetylfuran b,c > 20.968 1510 70305.25 63032 90% 38 <![CDATA[Benzaldehyde b,c > 21.557 1534 3999728 2484810 62% 39 <![CDATA[n-Octanol b,c > 21.976 1550 5625.5 11228.25 200% 40 <![CDATA[3-Methylpyrrole b,c > 22.118 1556 8010.25 13543 169% 41 <![CDATA[5-Methylfurfural b,c > 22.707 1579 23503.75 19230.75 82% 42 <![CDATA[4-Isopropylidene-5,5-dimethyl-4,5-dihydro c > 23.313 1604 201239.8 10931.5 5% 43 <![CDATA[n-Butyric acid b,c > 23.918 1630 250586 90639.75 36% 44 <![CDATA[2-Cyclopenten-1-one b,c > 24.149 1640 16958.75 17620.5 104% 45 <![CDATA[Phenylacetaldehyde b,c > 24.459 1653 948718.8 1310086 138% 46 <![CDATA[Acetophenone b,c > 24.654 1662 114421 86817.75 76% 47 <![CDATA[n-Valeric acid b,c > 24.802 1668 78803.25 55567.5 71% 48 <![CDATA[Isovaleric acid b,c > 24.892 1672 171687.8 75597 44% 49 <![CDATA[3-Thiophenecarboxaldehyde b,c > 25.328 1691 43400.25 52357 121% 50 <![CDATA[Thiophene-2-carbaldehyde b,c > 25.714 1707 51131.25 38530.25 75% 51 <![CDATA[3,4-Dihydro-2,5-dimethylpyran-2-carbaldehyde c > 25.717 1708 51110.25 38530.25 75% 52 <![CDATA[3-Methylthiopropanol b,c > 25.913 1716 180749 181936.5 101% 53 <![CDATA[3-Methylthiophene-2-carbaldehyde b,c > 26.491 1742 1255.25 34672.25 2762% 54 <![CDATA[3-Methyl-N-(2-phenylmethylene)-1-butanamine c > 27.972 1807 41823.25 13957 33% 55 <![CDATA[o-Toluidine b,c > 28.09 1813 118818.5 109918 93% 56 <![CDATA[4-Methylthiobutyric acid c > 28.272 1821 19191.25 18439.25 96% 57 <![CDATA[3,5-Dimethylbenzaldehyde b,c > 28.439 1829 316066.8 605676 192% 58 <![CDATA[2-Methylpropanoic acid c > 29.29 1868 19616.75 15146 77% 59 <![CDATA[2-Methyl-2-ethyl-3-hydroxyhexyl propionate c > 29.302 1869 19616.75 15146 77% 60 <![CDATA[Benzyl alcohol b,c > 29.538 1879 282698.5 260160 92% 61 <![CDATA[2,4,5-Trimethylbenzaldehyde b,c > 29.7 1887 1441.5 62585.25 4342% 62 <![CDATA[Isoamylamide b,c > 30.14 1908 39253 23129.75 59% 63 <![CDATA[2-Phenylethanol b,c > 30.297 1915 1165934 915236.5 78% 64 <![CDATA[Cyclodecane c > 31.211 1960 3677.25 7320.25 199% 65 <![CDATA[2 - Acetylpyrrole b,c > 31.563 1977 66405 55097.5 83% 66 <![CDATA[Phenol b,c > 32.225 2009 2160850 1504462 70% 67 <![CDATA[p - cresol b,c > 33.71 2085 58184 32537.5 56% 68 <![CDATA[3,4-Dimethylbenzyl alcohol c > 34.304 2116 13813.75 35997 261% 69 <![CDATA[4-Methylpyrrolo[1,2-a]pyrazine b,c > 34.422 2122 49392.5 32275.25 65% 70 <![CDATA[1-Methylpyrrolo[1,2-a]pyrazine b,c > 34.432 2123 44760 32275.25 72% 71 <![CDATA[2-Piperidone b,c > 34.765 2141 20592.75 10251.25 50% 72 <![CDATA[Nonanoic acid b,c > 35.217 2165 17878.25 6826.25 38% 73 <![CDATA[2'-Aminoacetophenone b,c > 36.497 2234 47160.75 29646.5 63% 74 <![CDATA[4-tert-Butylphenol (PTBP) c > 37.537 2292 181218.8 4622.75 3% 75 <![CDATA[2,4-Di-tert-butylphenol b,c > 37.774 2305 1429111 1441353 101% 76 <![CDATA[Dimethyl phthalate b,c > 37.851 2309 344913 204736.8 59% 77 <![CDATA[Palmitic acid c > 38.949 2373 9645 616 6% 78 <![CDATA[Indole b,c > 40.51 2465 189618.5 3055907 1612% 79 <![CDATA[Diisobutyl phthalate b,c > 41.865 2547 108091.5 100548.3 93% 80 <![CDATA[1-Hydroxycyclohexyl phenyl ketone c > 43.603 >2600 8513.25 426900 5015%
[0148] 1 This is the retention index of the component obtained by passing it through C7-C40. b This indicates that the component was qualitatively identified using the NIST database. c This indicates that the component was qualitatively analyzed by MS.
[0149] The results in Table 3 show that:
[0150] The detected components showed a general decrease in acidic substances. Glacial acetic acid, with its sour odor, decreased to 37% of its original level; butyric acid, with its sweaty odor, decreased to 36%; nonanoic acid, with its fatty aroma, decreased to 38%; isovaleric acid, with its herbal aroma, decreased to 44%; n-valeric acid decreased to 71%; and 2-methylpropionic acid, with its pungent odor, decreased to 77%. Amines also showed some decrease: trimethylamine, with its putrid fishy odor, decreased to 65%; sec-butylamine decreased to 70%; and isovaleramide and hexamethylenetetramine both decreased to 59%. Furthermore, while some aldehydes decreased, others increased significantly. 2-methylbutanal, with its strong odor, decreased to 31%; 2,3-butanone, with its animal fat aroma, decreased to 54%; and 2-methyl-2-butenal, with its fruity aroma, decreased to 62%. The content of 5-methylfurfural, which provides a spicy aroma, decreased to 82% of its original value, while 3-methylthiopropional, which has a broth-like, seafood-like, and fruity aroma, increased to 253% of its original value. Among alcohols, the content of n-propanol increased to 1740% of its original value, n-octanol, which has a citrus aroma, increased to 200% of its original value, 3,4-dimethylbenzyl alcohol increased to 261% of its original value, n-hexanol, which has a floral and fruity aroma, increased to 392% of its original value, and 2-methylbutanol, which has a toasty aroma, increased to 132% of its original value. However, isooctanol, which has a distinctive odor, decreased to 56% of its original value, and 2-phenylethanol, which has a rose aroma, decreased to 78% of its original value. In addition, the content of dimethyl trisulfide decreased to 14% of its original value, the content of dimethyl disulfide decreased to 73% of its original value, ethyl octanoate, which has a brandy aroma, decreased to 1% of its original value, and indole increased to 1612% of its original value.
[0151] The preferred embodiments disclosed above are not intended to limit the present invention. It should be understood that any modifications and alterations made using techniques well known in the art without departing from the spirit and scope of the present invention are within the scope of protection defined in the claims of the present invention.
Claims
1. An Acinetobacter baumannii xanthine oxidase mutant, characterized in that, The mutant is composed of the amino acids of the α subunit and the amino acids of the β subunit. The amino acid sequence of the α subunit is shown as SEQ ID NO.1; The amino acid sequence of the β subunit is shown by any one of the following amino acid sequences b1-b5: b1 The amino acid sequence of the β subunit is the amino acid sequence obtained by replacing glutamine at position 201 shown in SEQ ID NO.2 with glutamate; b2 The amino acid sequence of the β subunit is the amino acid sequence obtained by replacing glutamine at position 201 shown in SEQ ID NO.2 with cysteine; b3 The amino acid sequence of the β subunit is the amino acid sequence obtained by replacing glutamine at position 201 shown in SEQ ID NO.2 with leucine; b4 The amino acid sequence of the β subunit is the amino acid sequence obtained by replacing proline at position 319 shown in SEQ ID NO.2 with lysine; b5 The amino acid sequence of the β subunit is the amino acid sequence obtained by replacing proline at position 319 shown in SEQ ID NO.2 with tyrosine.
2. Use of the protein according to claim 1 as xanthine oxidase in any one of the following: (a) Degrading hypoxanthine and / or xanthine for non-disease treatment; (b) Degrading materials containing hypoxanthine and / or xanthine.
3. Use of the protein according to claim 1 in the preparation of a product having xanthine oxidase activity.
Citation Information
Patent Citations
A xanthine dehydrogenase, its encoding gene, and its applications
CN105734027B
A xanthine dehydrogenase truncated form and its application
CN105985935B
Mutant xanthine dehydrogenase and applications thereof
CN108624568A
Alkaline xanthine dehydrogenase and application thereof in detection kits
CN106318918A
Acinetobacter baumannii Xanthine dehydrogenase mutant and application thereof
CN110846289A