Hydrogenase gene hycE and use thereof

Abstract

The application provides a hydrogenase gene hycE and application thereof, and belongs to the technical field of genetic engineering. The nucleotide sequence of the hydrogenase gene hycE provided by the application is shown as SEQ ID NO. 1. The hydrogenase gene hycE provided by the application is transformed into E. coli for expression, and the hydrogen production capacity and hydrogen production efficiency of the E. coli can be significantly improved. The method for producing hydrogen provided by the application has higher safety. Moreover, compared with other hydrogen production microorganisms, the E. coli has low culture cost, high realizability and controllable conditions, and is beneficial to industrial production.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of genetic engineering, and particularly relates to a hydrogenase gene hycE and application thereof. BACKGROUND

[0002] As a clean energy and energy carrier without pollution, hydrogen energy has been highly valued in industrialized countries in recent years. At present, hydrogen production mainly has three ways, i.e. fossil energy conversion, water decomposition, and biological hydrogen production. Biological hydrogen production has the advantages of safety, low cost, environmental friendliness, and rational utilization of renewable resources. If it can be widely applied, it will have important significance for environmental protection. In addition, studies have shown that hydrogen, as the smallest molecule in nature, can easily diffuse into any organ, tissue, cell, mitochondria and nucleus of the body, and achieve ideal antioxidant effect by selectively removing malignant free radicals, thereby having certain health care effects on the organism. Compared with other hydrogen-producing microorganisms, Escherichia coli has low culture cost and strong realizability, and is therefore the best choice for developing microbial hydrogen production. Wild-type Escherichia coli does not produce hydrogen or produces little hydrogen, and the technical field urgently needs to provide a method for improving the hydrogen production efficiency of Escherichia coli to meet the demand of human development of hydrogen energy. SUMMARY

[0003] Therefore, the purpose of the present application is to provide a hydrogenase gene hycE, which can significantly improve the hydrogen production capacity of Escherichia coli by being introduced into Escherichia coli for expression.

[0004] In order to achieve the above-mentioned purpose of the application, the present application provides the following technical solutions.

[0005] The present application provides a hydrogenase gene hycE, the nucleotide sequence of which is shown in SEQ ID NO. 1.

[0006] Preferably, the hydrogenase gene hycE is cloned from Enterobacter cloacae with strain number CMCC43501.

[0007] The present application also provides a recombinant plasmid capable of expressing the above-mentioned hydrogenase gene hycE.

[0008] Preferably, the recombinant plasmid comprises pET32a-hycE.

[0009] The present application also provides a hydrogen-producing conversion bacterium, which is prepared by transforming the above-mentioned recombinant plasmid into Escherichia coli BL21.

[0010] The present application also provides the use of the above-mentioned hydrogenase gene hycE, the above-mentioned recombinant plasmid, or the above-mentioned conversion bacterium in the preparation of hydrogen.

[0011] The application also provides a method for preparing hydrogen, comprising the following steps:

[0012] The hydrogenase gene hycE is connected with the plasmid pET32a to obtain the recombinant plasmid pET32a-hycE; the recombinant plasmid pET32a-hycE is transformed into the E. coli BL21 to obtain the transformed bacteria; and the transformed bacteria are amplified and cultured, and then an inducing agent is added into the culture medium to induce the culture to produce hydrogen.

[0013] Preferably, the method for preparing the hydrogenase gene hycE comprises the following steps:

[0014] The gene of the E. coli strain numbered CMCC43501 is used as a template, and the upper and lower primers with the nucleotide sequences shown in SEQ ID NO. 2 and SEQ ID NO. 3 are used for PCR amplification.

[0015] Preferably, the inducing agent comprises an IPTG inducing agent.

[0016] The application has the following beneficial effects:

[0017] The hycE gene cloned from the E. coli strain numbered CMCC43501 is transformed into the E. coli for expression, which can significantly improve the hydrogen production capacity and hydrogen production efficiency of the E. coli. The E. coli strain numbered CMCC43501 is an important opportunistic pathogenic bacterium in clinic, and the E. coli is a non-pathogenic bacterium, that is, the method for producing hydrogen has higher safety. Moreover, compared with other hydrogen-producing microorganisms, the E. coli has low culture cost, high realizability and controllable conditions, and is conducive to industrialized production. BRIEF DESCRIPTION OF DRAWINGS

[0018] Figure 1 The figure is the result of agarose electrophoresis, and the electrophoresis bands from left to right in the figure are the Shanghai Jetstar GsDL2502 DNA marker and the amplified hycE gene band, respectively;

[0019] Figure 2 The figure is a schematic diagram of the pET32a-hycE recombinant plasmid of the application;

[0020] Figure 3 The figure is the result of Western Blot detection of the hycE protein expression of the transformed bacteria, and the bands from left to right in the figure are the BL21 bacteria transformed with pET32a-hycE, the untransformed BL21 bacteria and the Thermo26616 protein pre-stained marker, respectively;

[0021] Figure 4 The figure is an anaerobic fermentation hydrogen production device, wherein 1 is a water bath, 2 is a triangular flask, 3 is a sampling port, 4 is a gas collection bottle, and 5 is a leveling bottle;

[0022] Figure 5 The hydrogen production results of the transformed bacteria. DETAILED DESCRIPTION

[0023] The present application provides a hydrogenase gene hycE, the nucleotide sequence of which is shown in SEQ ID NO. 1.

[0024] The hydrogenase gene hycE of the present application is cloned from Enterobacter cloacae with strain number CMCC43501. The present application does not have special limitations on the specific source of Enterobacter cloacae with strain number CMCC43501, and the conventional commercially available products in the art can be used.

[0025] The present application also provides a recombinant plasmid capable of expressing the above-mentioned hydrogenase gene hycE.

[0026] In the present application, the recombinant plasmid preferably includes pET32a-hycE. In the construction of the recombinant plasmid pET32a-hycE, the present application preferably uses a rapid recombination cloning kit instead of the traditional T4 ligase method. The present application uses a rapid recombination cloning kit for vector construction, which is not limited by the restriction sites. The traditional T4 ligase method will be limited by the restriction sites. Specifically, using T4 ligase, the vector and the inserted gene need to be digested first. If there is a restriction site in the middle of the inserted gene, the inserted gene will be cut into pieces, so that the complete target gene cannot be expressed. The present application selects pET32a plasmid, which has the advantages of easy to obtain, convenient to detect, and can drive high-level expression of target genes.

[0027] The present application also provides a hydrogen-producing transformed bacteria, which is prepared by transforming the above-mentioned recombinant plasmid into Escherichia coli BL21.

[0028] The present application does not have special limitations on the specific transformation method of transforming the recombinant plasmid into Escherichia coli BL21, and the conventional transformation method in the art can be used.

[0029] The present application also provides a use of the above-mentioned hydrogenase gene hycE or the above-mentioned recombinant plasmid or the above-mentioned transformed bacteria in the preparation of hydrogen.

[0030] The present application also provides a method for preparing hydrogen, comprising the following steps:

[0031] The above-mentioned hydrogenase gene hycE is connected with the plasmid pET32a to obtain the recombinant plasmid pET32a-hycE; the recombinant plasmid pET32a-hycE is transformed into Escherichia coli BL21 to obtain the transformed bacteria; after the transformed bacteria are amplified and cultured, an inducer is added to the culture medium to induce the culture to produce hydrogen.

[0032] In the present application, the preparation method of the hydrogenase gene hycE preferably comprises the following steps:

[0033] The gene of Enterobacter cloacae with strain number CMCC43501 is used as a template, and the upper and lower primers are respectively shown in SEQ ID NO. 2: ATGTCTGAAGAAAAGAAAGGTC and SEQ ID NO. 3: TTTCAGCGGCGAGTTCTTAC. The present application is not particularly limited in the specific method for obtaining the gene of Enterobacter cloacae with strain number CMCC43501, and the conventional gene extraction method in the art can be used.

[0034] The present application is not particularly limited in the specific amplification culture method of the transformed bacteria, and the culture medium for hydrogen production is preferably LB culture medium with additional sugar carbon source. In the present application, the inducer preferably comprises IPTG inducer, and the present application is not particularly limited in the specific source of the IPTG inducer, and the conventional commercially available product in the art can be used.

[0035] The technical solutions provided by the present application are described in detail in combination with the examples below, but they should not be understood as limitations on the protection scope of the present application.

[0036] In the following examples, the conventional methods are used unless otherwise specified.

[0037] In the following examples, the materials, reagents, etc. can be obtained from commercial channels unless otherwise specified.

[0038] Example 1

[0039] Construction of recombinant plasmid capable of expressing hydrogenase gene hycE

[0040] (1) Using bacterial genomic DNA extraction kit (purchased from Tian Gen Biochemical Technology (Beijing) Co., Ltd.), genomic DNA was extracted from Enterobacter cloacae with strain number CMCC43501 (purchased from Nanjing Maogjie Microbial Technology Co., Ltd.). The DNA was used as a template, and the nucleotide sequences were amplified by PCR using the upstream and downstream primers shown in SEQ ID NO. 2: ATGTCTGAAGAAAAGAAAGGTC and SEQ ID NO. 3: TTTCAGCGGCGAGTTCTTAC, respectively. The PCR reaction system was as follows: 10x buffer 10 μL, 2.5 mM dNTP 8 μL, 10 μM upstream and downstream primers 2 μL each, genomic DNA 2 μL, pfu enzyme 1 μL, deionized water 75 μL, and the total volume was 100 μL. (dNTP, pfu enzyme and other reagents were purchased from Tian Gen Biochemical Technology (Beijing) Co., Ltd.). The PCR reaction conditions were set as follows: denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 3 min, and a total of 30 cycles. The PCR amplification product was subjected to agarose electrophoresis, and the results showed that the size of the amplified gene fragment was 1710 bp (see Figure 1 ).

[0041] (2) Using the PCR product obtained in step (1) as a template, the following primers were used: upstream primer: TAAGAAGGAGATATACAT ATGTCTGAAGAAAAGAAAGGTC (SEQ ID NO. 4), downstream primer: GGTGGTGGTGGTGGTGCTCGAG TTTCAGCGGCGAGTTCTTAC (SEQ ID NO. 5) for PCR amplification. The reagents used for PCR reaction, reaction condition setting and step (1) were the same. The results showed that the length of the product was basically unchanged.

[0042] (3) Enzymatic digestion of pET32a plasmid: select the Nde I and Xho I sites in the multiple cloning site, double-digest the plasmid, and recover the large plasmid fragment.

[0043] (4) Ligation: using EasyGeno rapid recombination cloning kit (purchased from Tian Gen Biochemical Technology (Beijing) Co., Ltd.), the gene fragment hycE of step (2) and the large plasmid fragment of step (3) were ligated.

[0044] (5) Transformation: the constructed recombinant plasmid was transformed into DH5α competent cells. The bacterial liquid was taken and spread on ampicillin-resistant plates (ampicillin concentration 100 μg / ml), and incubated in a 37°C incubator overnight.

[0045] (6) Identification of positive transformants: single colonies were picked from the plates, liquid cultured, and the plasmid was extracted and sent to a biotechnology company for sequencing.

[0046] (7) Plasmid sequencing: Verify the sequence of the recombinant plasmid pET32a-hycE is correct. The sequencing correct pET32a-hycE expression plasmid, as shown in Figure 2 The hycE gene is fused with His Tag (tag protein) sequence on the vector.

[0047] (8) Western Blot detection of the expression of the target protein: The recombinant plasmid is transformed into BL21 competent cells. Single colonies are selected and cultured in 10 mL of LB medium containing 100 μg / mL ampicillin. The bacteria are collected and detected for hycE protein expression using mouse His Tag monoclonal antibody and DyLight 800 fluorescently labeled goat anti-mouse secondary antibody. BL21 bacteria not transformed with the recombinant plasmid pET32a-hycE are used as a control group, and the results are shown in Figure 3 The calculated molecular weight of the hycE protein is 66 kD, and the electrophoretogram is consistent with expectations.

[0048] Example 2

[0049] Recombinant plasmid pET32a-hycE enhances the hydrogen production efficiency of transformed bacteria

[0050] The recombinant plasmid pET32a-hycE, which was sequenced and verified to be correct in Example 1, is transformed into E. coli BL21 (DE3), and its hydrogen production characteristics are tested using a hydrogen production medium. The specific steps are as follows.

[0051] (1) Transform pET32a-hycE recombinant plasmid into BL21 and spread on ampicillin-resistant plates (denoted as the hycE group). BL21 bacteria not transformed are spread on plates without antibiotics as a control group (denoted as the BL21 group).

[0052] (2) Bacterial amplification culture: Two 50 mL volume flasks are labeled hycE and BL21, respectively, and 20 mL of LB medium is added (100 μg / mL ampicillin is added to the hycE group, and no antibiotic is added to the E. coli BL21 group). Single colonies are picked from the bacterial plates obtained in step (1) and added to the respective flasks, which are placed in a 37°C 180 r / min shaker for overnight shaking culture.

[0053] (3) Pre-culture: Prepare a 250 mL flask and add 180 mL of LB medium to the flask in a clean bench. Then, according to a 10% inoculation ratio, add the overnight culture of bacteria, and continue to shake culture for about 1 h.

[0054] (4) Induction culture: when the bacteria concentration reaches OD600=0.6, add IPTG inducer with a final concentration of 0.2 mM (for inducing protein expression) and continue to shake culture for 2 hours. Then add glucose with a final concentration of 1% (m / V) into the flask, and culture to produce hydrogen.

[0055] Put the flask into a 37℃ water bath, seal the mouth of the flask with a rubber stopper with holes, connect the gas in the flask with a graduated gas collection bottle through a pipe, and use the drainage gas collection method to observe the gas production within 24 hours (the anaerobic fermentation hydrogen production device used for measuring hydrogen production is shown in Figure 4

[0056] (5) Gas phase component determination: extract the gas sample, measure the content of H2 by gas chromatography, and calculate the hydrogen production. The results are shown in Figure 5 Figure 5 The unit of the middle ordinate value is mL H2 / mol Glucose, i.e. the hydrogen volume produced per mol of glucose. Compared with the control group, the hydrogen production of the E. coli transformed by pET32a-hycE is significantly improved. It is shown that the recombinant plasmid pET32a-hycE constructed in the application can be used to modify E. coli, so that the hydrogen production capacity of the E. coli which almost does not produce hydrogen is significantly improved.

[0057] The above only describes the preferred embodiments of the application, and it should be noted that for those skilled in the art, several improvements and refinements can be made without departing from the principles of the application, and these improvements and refinements should also be considered as the protection scope of the application.​​

Claims

1. A high-hydrogen-producing transforming bacterium, characterized in that, The transformed bacteria are prepared by transforming a recombinant plasmid into E. coli BL21; the recombinant plasmid is a recombinant plasmid capable of expressing hydrogenase gene hycE, the nucleotide sequence of the hydrogenase gene hycE is shown as SEQ ID NO. 1; and the recombinant plasmid is pET32a-hycE.

2. Use of the transformed bacteria in claim 1 in the preparation of hydrogen.

3. A method of producing hydrogen gas, characterized by, The method comprises the following steps: The hydrogenase gene hycE with the nucleotide sequence shown as SEQ ID NO. 1 is connected with plasmid pET32a to obtain recombinant plasmid pET32a-hycE; the recombinant plasmid pET32a-hycE is transformed into E. coli BL21 to obtain transformed bacteria; and the transformed bacteria are amplified and cultured, and then an inducing agent is added into the culture medium to induce the culture to produce hydrogen.

4. The method of claim 3, wherein, The preparation method of the hydrogenase gene hycE comprises the following steps: The genome of Enterobacter cloacae with strain number CMCC43501 is used as a template, and the upper and lower primers with the nucleotide sequences shown as SEQ ID NO. 2 and SEQ ID NO. 3, respectively, are used to perform PCR amplification to obtain the hydrogenase gene hycE.

5. The method of claim 3, wherein, The inducing agent is IPTG inducing agent.

Images