A kit and method for rapid detection of camel-derived nucleic acid

Abstract

The present invention provides a kit and method for rapid detection of camel-derived nucleic acids. The kit includes a primer-probe combination for detecting camel-derived nucleic acids, is low-cost, and requires a short detection time. The detection method has high accuracy, reduces the number of steps, and shortens the operation time. Both the kit and the detection method have excellent market value.

Description

Technical Field

[0001] The present invention relates to the detection of camel-derived nucleic acids. More specifically, the present invention relates to a primer set, probe, kit, and rapid detection method for detecting camel-derived nucleic acids; in particular, to a camel-derived nucleic acid detection kit and method for rapid, highly specific, highly precise, and highly instrument-suitable camel-derived nucleic acid detection. Background Art

[0002] Camels are large farmed animals, and a single camel produces a significant amount of meat. Besides being used for cargo transportation, camels are common carnivores worldwide. my country's camels are primarily produced in Inner Mongolia, Xinjiang, Gansu, Qinghai, and Ningxia, making it one of the world's largest camel producing areas. The entire camel's body is a treasure, and the development and utilization of its meat, milk, and hair are highly valuable, making it a promising way for farmers and herders to prosper. Camel meat is tender and palatable, and contains a high amount of glycogen, resulting in a sweet taste similar to horse meat and comparable to beef. Camel humps and paws have high medicinal value and are considered a premium food. They are sweet, warm, and non-toxic, with moisturizing properties, dispelling wind, promoting blood circulation, and reducing swelling. They are suitable for those suffering from chronic numbness and numbness caused by wind diseases. Modern scientific research indicates that camel milk is a protein-rich milk, with a much higher protein content than mare's and cow's milk, while having a lower fat content. It is a typical high-protein, low-fat milk. It is rich in lactose, vitamins C, A, B1, B2, and E, making it easily digestible and absorbable. In particular, the content of natural insulin, a highly biologically valuable food, is significantly higher than that of cow's and mare's milk. It is also low in cholesterol and rich in umami amino acids and various trace elements. Camel milk, known for its lung and intestinal cleansing properties, is considered a highly nutritious and health-promoting product, poised to become the second largest dairy industry after the cow's milk industry. Li Shizhen, a Ming Dynasty scholar, noted in his Compendium of Materia Medica: "Camel milk is sweet, warm, and non-toxic. It nourishes the middle and replenishes Qi, strengthens the bones, and alleviates hunger." Practice has shown that camel milk can stimulate appetite, promote metabolism, and offer therapeutic benefits for tuberculosis, peptic ulcers, hypertension, and diabetes.

[0003] Currently, there are two existing standards for camel-derived components: the Qualitative Detection of Camel-Derived Components in Animal Feed by PCR (GB / T 21100-2007) and the Real-Time Fluorescence PCR Method for the Detection of Camel-Derived Components in Exported Food (SN / T4418-2016). These standards utilize traditional manual methods for sample preparation and nucleic acid extraction, and the PCR testing process is relatively time-consuming and cumbersome. Summary of the Invention

[0004] To solve the above problems, the present invention aims to provide a kit and a detection method for camel-derived components in meat and dairy products based on a multiplex real-time fluorescence PCR method and a same-tube quality control system.

[0005] In order to achieve the above object, the technical solution adopted by the present invention is as follows:

[0006] The first object of the present invention is to provide a primer-probe combination for detecting camel-derived nucleic acid, wherein the primer-probe combination comprises a primer sequence for detecting camel-derived nucleic acid and a first probe sequence:

[0007] The first primer shown in SEQ ID NO. 1: 5'-GATTCTTYGCCTTCCAYTTCATCC-3';

[0008] The second primer shown in SEQ ID NO. 2: 5'-GGAATGGGATTTTRTCTATGTCTGAGGA-3';

[0009] The first probe shown in SEQ ID NO. 3: 5'-ACACGAAACAGGYTCTAATAACCCRACAGG-3', wherein the 5' portion of the first probe is labeled with a FAM fluorescent group and the 3' portion is labeled with a BHQ1 fluorescent quenching group;

[0010] The primer-probe combination also includes a primer sequence and a second probe sequence for detecting an internal standard:

[0011] The third primer shown in SEQ ID NO. 4: 5'-TCTGCCCTATCAACTTTCGATG-3';

[0012] The fourth primer shown in SEQ ID NO. 5: 5'-AATTTGCGCGCCTGCTG-3';

[0013] The second probe shown in SEQ ID NO. 6: 5'-CCGTTTCTCAGGCTCCCTCTCCG-3', wherein the 5' portion of the second probe is labeled with VIC fluorescein, and the 3' portion is labeled with a BHQ1 fluorescence quenching group.

[0014] The second object of the present invention is to provide the use of the aforementioned primer-probe combination in the preparation of a reagent for detecting camel-derived nucleic acid.

[0015] The third object of the present invention is to provide a kit for detecting camel-derived nucleic acids, the kit comprising a nucleic acid amplification reaction solution, a camel-derived detection solution, a positive control, and a blank control; the camel-derived detection solution includes the aforementioned primer-probe combination.

[0016] Furthermore, the nucleic acid amplification reaction solution includes: fluorescent PCR buffer, dNTP (U) s, Mg 2+ , hot start TaqDNA polymerase and UND enzyme;

[0017] Preferably, each 12.5 μL of the nucleic acid amplification reaction solution includes 4 μL of fluorescent PCR buffer, 0.2 mM dNTP(U)s, Mg 2+ 3mM, hot start Taq DNA polymerase 0.6U and UDG enzyme 0.15U.

[0018] Furthermore, the concentration of each primer in the camel-derived detection solution is 400 nM, the concentration of each probe is 400 nM, and the solvent of the camel-derived detection solution is TE.

[0019] Furthermore, the positive control includes the internal standard template nucleotide sequence shown in SEQ ID NO.7 and the camel-derived gene nucleotide sequence shown in SEQ ID NO.8.

[0020] The internal standard template described in SEQ ID NO.7 is the full-length mammalian 18s rRNA:

[0021] The nucleotide sequence of the internal standard template shown in SEQ ID NO.7:

[0022]

[0023] SEQ ID NO.8 camel-derived gene nucleotide sequence:

[0024]

[0025] Preferably, the concentrations of the internal standard template nucleotide shown in SEQ ID NO.7 and the camel-derived gene nucleotide sequence shown in SEQ ID NO.8 in the positive control are both 1E+5 copies / mL.

[0026] Preferably, the positive control is prepared by respectively connecting the internal standard template nucleotide sequence shown in SEQ ID NO.7 and the camel-derived gene nucleotide sequence shown in SEQ ID NO.8 into a plasmid and then diluting them with RNase-free water to the corresponding concentration. There is no limit to the type of plasmid.

[0027] Furthermore, the blank control is RNase-free water.

[0028] A fourth object of the present invention is to provide a method for detecting camel-derived nucleic acid, the method comprising the following steps:

[0029] Step 1, extracting genomic DNA of the sample to be tested;

[0030] Step 2: Perform real-time fluorescence PCR on the genomic DNA of the sample to be tested:

[0031] 2-1, Reagent preparation:

[0032] Calculate the number of preparations n, where n = the number of test samples + 1 positive control + 1 blank control; prepare a corresponding number of camel-derived nucleic acid detection reaction solutions, each of which includes a nucleic acid amplification reaction solution and a camel-derived detection solution;

[0033] Preferably, each camel-derived nucleic acid detection reaction solution includes 12.5 μL of nucleic acid amplification reaction solution and 7.5 μL of camel-derived detection solution;

[0034] 2-2, nucleic acid loading:

[0035] Add the test sample DNA, positive control, and blank control extracted in step 1 to the camel-derived nucleic acid detection reaction solution described in 2-1 respectively;

[0036] Preferably, the added amount of the test sample DNA, positive control, and blank control is 5 μL;

[0037] 2-3, PCR amplification detection:

[0038] The reaction system obtained in 2-2 was placed in a fluorescent quantitative PCR instrument for detection;

[0039] Step 3, result interpretation:

[0040] 3-1, Interpretation of test effectiveness:

[0041] When the positive control FAM channel test result is Ct≤30, and the internal standard VIC channel test result is Ct≤30; at the same time, the blank control FAM and VIC channels have no Ct value, it is a valid result;

[0042] 3-2, positive interpretation:

[0043] When the VIC channel test result of the sample to be tested is Ct≤40, the FAM channel test result is Ct≤40, and the curve is S-shaped with a clear exponential growth period, it is judged to be positive, and the sample to be tested contains camel-derived genes;

[0044] When the test result of the sample in the VIC channel is Ct≤40, and the FAM channel Ct>40 or not detected, it is judged as negative;

[0045] The sample to be tested does not contain camel-derived genes.

[0046] When the internal standard of the sample to be tested has a Ct>40 or is not detected in the VIC channel, it is considered an invalid result.

[0047] Furthermore, the genomic DNA of the test sample extracted in step 1 is extracted using a genomic DNA extraction reagent or a genomic DNA extraction kit. Preferably, the genomic DNA of the test sample extracted in step 1 is extracted using the SDKF60102 nucleic acid extraction kit of Jiangsu Shuoshi Biotechnology Co., Ltd., and the operation is performed according to the instructions.

[0048] Furthermore, the amplification procedure in steps 2-3 is:

[0049] Step ①: 95℃×30s; 1 cycle

[0050] Step ②: 95°C × 1s, 58°C × 10s; 40 cycles

[0051] In step ②, fluorescence detection was performed at 58°C, and fluorescence signals were collected through the FAM and VIC detection channels.

[0052] In the nucleotide sequence of the present invention, "R" refers to any purine in adenine or guanine, and "Y" refers to any pyrimidine in cytosine or thymine.

[0053] The technical solution of the present invention has the following beneficial effects compared with the prior art:

[0054] The present invention provides a camel-derived nucleic acid detection kit that is rapid, highly specific, has a low false-negative rate, has wide instrument applicability, and is highly precise, and a method for efficiently and quickly detecting camel-derived nucleic acids. The kit has low cost and a short detection time; the detection method has high accuracy, reduces the number of operating steps, and shortens the operation time. Both the kit and the detection method have excellent market value.

[0055] The General Administration of Quality Supervision, Inspection and Quarantine, the State Administration for Market Regulation, the General Administration of Customs, and the Inner Mongolia Autonomous Region Market Supervision Administration successively issued relevant standards for the detection of camel-derived components from 2016 to 2020. These standards were compared with this kit and method in terms of sample pretreatment, nucleic acid extraction, and PCR time. Specific data are shown in Table 1:

[0056] Table 1

[0057]

[0058] The above data analysis shows that from sample pretreatment, nucleic acid extraction to PCR time, this kit and method have obvious advantages over the current standard in terms of operational convenience and time. In addition, this kit uses mammalian 18srRNA as an internal standard, which can effectively monitor the entire process from sample collection, sample processing, nucleic acid extraction to PCR, ensuring the effectiveness of the experiment. BRIEF DESCRIPTION OF THE DRAWINGS

[0059] Figure 1 The amplification test results of the specific verification fluorescence PCR of milk powder samples; Figure 1 A is the test result of milk powder sample. Figure 1 B is the test result of goat milk powder sample. Figure 1 C is the camel milk powder sample test results. Figure 1 D is the positive control test result diagram, Figure 1 E is the blank control test result diagram;

[0060] Figure 2 Fluorescence PCR amplification test results of fresh pork, camel meat products and fresh camel meat samples; Figure 2 A is the test result of fresh pork sample. Figure 2 B is the test result of Qianju roasted camel meat sample. Figure 2 C is the test result of the desert grilled camel meat sample. Figure 2 D is the test result of camel meat sample. Figure 2 E is the positive control test result diagram, Figure 2 F is the blank control test result diagram;

[0061] Figure 3 The amplification test results of fluorescent PCR of camel milk powder samples with different mass concentrations are shown in the figure. Figure 3 A, B, C, D, E, F, G, H, I, and J are the result graphs of 30%, 20%, 10%, 8%, 5%, 3%, 1%, 0.5%, 0.1% mass concentration and blank control, respectively. DETAILED DESCRIPTION

[0062] The present invention is further explained below with reference to the following examples, but the examples do not limit the present invention in any form.

[0063] Example 1

[0064] 1. Design primer sequences and a first probe sequence for detecting camel-derived nucleic acid, and artificially synthesize the designed primer sequences and first probe sequence:

[0065] First primer: 5'GATTCTTYGCCTTCCAYTTCATCC 3' (SEQ ID NO. 1);

[0066] Second primer: 5'GGAATGGGATTTTRTCTATGTCTGAGGA 3' (SEQ ID NO. 2);

[0067] The first probe: 5'ACACGAAACAGGYTCTAATAACCCRACAGG 3' (SEQ ID NO. 3), wherein the 5' portion of the first probe is labeled with a FAM fluorescent group, and the 3' portion is labeled with a BHQ1 fluorescent quenching group;

[0068] 2. Design the primer sequence and the second probe sequence for the internal standard, and artificially synthesize the primer sequence and the second probe sequence designed above:

[0069] The third primer: 5'TCTGCCCTATCAACTTTCGATG 3' (SEQ ID NO. 4);

[0070] Fourth primer: 5'AATTTGCGCGCCTGCTG 3' (SEQ ID NO. 5);

[0071] The second probe: 5'CCGTTTCTCAGGCTCCCTCTCCG 3' (SEQ ID NO. 6), the 5' end of the second probe is labeled with VIC fluorescein, and the 3' end is labeled with a BHQ1 fluorescence quenching group.

[0072] 3. Design the internal standard template sequence and artificially prepare the internal standard plasmid based on the internal standard template sequence:

[0073] 1) The internal standard template sequence is the full-length nucleotide sequence of mammalian 18s rRNA as shown in SEQ ID NO.7:

[0074] 2) Prepare an internal standard plasmid with reference to the nucleotide sequence shown in SEQ ID NO. 7, and then dilute the prepared internal standard plasmid to 1E+5 copies / mL with RNase-free water. Use the diluted liquid as a component of the positive control in the kit.

[0075] 4. Design the nucleotide sequence of the camel-derived gene and artificially prepare the camel-derived gene plasmid based on the sequence:

[0076] 1) The camel-derived gene sequence is the nucleotide sequence shown in SEQ ID NO.8:

[0077] 2) Prepare a camel-derived gene plasmid with reference to the nucleotide sequence shown in SEQ ID NO. 8, then dilute the prepared internal standard plasmid to 1E+5 copies / mL with RNase-free water, and use the diluted liquid as a component of the positive control in the kit.

[0078] 5. Preparation of the kit:

[0079] The kit comprises a nucleic acid amplification reaction solution, a camel-derived detection solution, a positive control and a blank control.

[0080] Each 12.5 μL of the nucleic acid amplification reaction solution includes 4 μL of fluorescent PCR buffer, 0.2 mM dNTP(U)s, Mg 2+ 3mM, hot start Taq DNA polymerase 0.6U and UDG enzyme 0.15U.

[0081] The camel-derived detection liquid includes the primer-probe combination of SEQ ID NO.1 to SEQ ID NO.6. The concentration of each primer in the camel-derived detection liquid is 400 nM, the concentration of each probe is 400 nM, and the solvent of the camel-derived detection liquid is TE.

[0082] The positive control is prepared as described in the above steps "3, 2)" and "4, 2)".

[0083] The blank control is RNase-free water

[0084] The above reagents were stored at -20℃.

[0085] 6. Extract genomic DNA of the sample to be tested

[0086] The samples to be tested in this embodiment are commercially available camel milk and milk powder or commercially available camel meat and meat products.

[0087] 6-1 Sample pre-treatment:

[0088] 1) Milk powder sample processing:

[0089] Weigh 100 mg of milk powder, add 600 μL of distilled water to dissolve and mix thoroughly for later use.

[0090] 2) Processing of meat and meat product samples:

[0091] Weigh 25 mg of fresh meat or meat products, cut into small pieces, and set aside.

[0092] 6-2 Extraction of camel-derived nucleic acid samples:

[0093] After the pre-treatment in step 6-1, nucleic acid was extracted using the SDKF60102 nucleic acid extraction kit (Jiangsu Shuoshi Biotechnology Co., Ltd.). The specific steps were carried out according to the instructions to obtain genomic DNA of the sample to be tested.

[0094] 7. Perform real-time fluorescence PCR detection on the genomic DNA of the sample to be tested:

[0095] 7-1 Reagent Preparation

[0096] Calculate the number of preparations, n, where n = number of test samples + 1 positive control + 1 blank control. Take out the "Camel-derived Nucleic Acid Detection Kit (Fluorescence PCR Method)" prepared in step 5, thaw and oscillate at room temperature, then centrifuge at low speed for 10 seconds. Calculate the number of reaction reagents required (n = number of samples + 2 tubes of controls). Prepare the camel-derived nucleic acid detection reaction solution according to Table 2 below:

[0097] Table 2

[0098] Reaction liquid components Addition volume (μL) / reaction Nucleic acid amplification reaction solution 12.5 Camel-derived testing fluid 7.5 Total volume 20

[0099] 7-2 Nucleic acid loading

[0100] Take n PCR reaction tubes and dispense 20 μL of the camel-derived nucleic acid detection reaction solution described in Table 1 into n PCR reaction tubes.

[0101] For the test sample tubes, add 5 μL of the processed sample nucleic acid to the PCR reaction tube, add 5 μL of the positive control to one positive control tube, and add 5 μL of the blank control to one blank control tube. The final volume is 25 μL / tube. Close the tube cap tightly and centrifuge at low speed.

[0102] 7-3PCR amplification detection

[0103] The fluorescence quantitative PCR instrument used was Quantstudio TM 5. Set up the amplification program according to Table 3 below:

[0104] Table 3

[0105]

[0106] 7-4 Result Interpretation

[0107] Analyze the results when the instrument is normal and the positive control and blank control are normal. Interpret the results according to the following:

[0108] Interpretation of test effectiveness:

[0109] When the positive control FAM channel test result is Ct≤30, and the internal standard VIC channel test result is Ct≤30; at the same time, the blank control FAM and VIC channels have no Ct value, it is a valid result;

[0110] Positive interpretation:

[0111] When the internal standard of the sample to be tested has a Ct≤40 in the VIC channel and a Ct≤40 in the FAM channel, and the curve is S-shaped with a clear exponential growth period, it is judged to be positive, and the sample to be tested contains camel-derived genes;

[0112] When the internal standard of the sample to be tested has a detection result of Ct≤40 in the VIC channel and Ct>40 in the FAM channel or is not detected, it is judged as negative; the sample to be tested does not contain camel-derived genes.

[0113] When the internal standard of the sample to be tested has a Ct>40 or is not detected in the VIC channel, it is considered an invalid result.

[0114] The implementation methods in the following examples where specific conditions are not specified are generally carried out according to conventional conditions or methods recommended by the kit manufacturer.

[0115] Example 2: Specificity of the kit for detecting camel-derived nucleic acids containing an internal standard according to the present invention

[0116] 1. Milk powder samples

[0117] Royal Friso milk powder (purchased from FrieslandCampina Food Trading Co., Ltd.), Kabrita goat milk powder (purchased from HiPP Nutrients Co., Ltd.), and Original Gold camel milk powder (purchased from Xinjiang Original Gold Dairy Co., Ltd.) were purchased from the market and tested using the method described in Example 1 to verify the specificity of the detection reagent. The results are as follows: Figure 1 As shown:

[0118] The Ct value of the positive control's FAM channel was 22, and the Ct value of the VIC channel was 23. The blank control had no Ct value in both the FAM and VIC channels, indicating that the test was effective. No Ct was detected in the FAM channel (camel-derived gene) of cow and sheep milk powder, and the Ct values ​​of the VIC channel were 34 and 29, respectively. The Ct value of the FAM channel detection of camel milk powder was 22, and the Ct value of the VIC channel detection was 27. The curve was S-shaped and had an obvious exponential growth period. The results showed that the camel-derived nucleic acid test kit can specifically detect the nucleic acid of camel-derived milk powder samples.

[0119] 2. Fresh camel meat samples

[0120] Commercially available fresh pork, camel meat products (trade names: Qianju Roasted Camel Meat, Desert Roasted Camel Meat) and fresh camel meat were randomly selected, cut into small pieces and directly placed into a nucleic acid extraction kit for nucleic acid extraction (each sample was set up for 3 replicates), and then tested using the method established in this study as described in Example 1. The results are as follows: Figure 2 As shown:

[0121] The Ct value of the FAM channel of the positive control was 22, and the Ct value of the VIC channel was 23. The blank control had no Ct value in both the FAM and VIC channels, indicating that the test was effective; the FAM channel (camel-derived gene) of fresh pork was not detected, and the Ct value of the VIC channel was around 29. The FAM channel Ct values ​​of Qianju and Damao grilled camel meat samples were around 26 and 20, respectively, and the Ct values ​​of the VIC channel were around 27 and 30, respectively. The FAM channel Ct value of fresh camel meat was around 19, and the VIC channel Ct value was around 31. The curves of each channel were S-shaped and had an obvious exponential growth period. Among them, the Ct values ​​of the three samples of camel meat products were quite different, which may be affected by the seasonings in the samples. The results show that the detection method of this study can directly and specifically detect camel-derived nucleic acids in camel meat products and fresh meat through the camel-derived nucleic acid kit.

[0122] Example 3: Sensitivity of the kit for detecting camel-derived nucleic acids containing an internal standard according to the present invention for milk powder samples

[0123] The camel milk products are mixed with other source ingredients of milk powder to greatly reduce their cost. This kind of bad behavior of counterfeiting and adulteration will not only damage the economic interests of consumers, but also cause varying degrees of damage to the body. If consumers are allergic to the mixed milk powder ingredients, they may have allergic reactions and even endanger their lives if they accidentally eat very small amounts without knowing it. Therefore, the sensitivity of the detection method is of great significance for the determination of adulteration of milk and dairy products. In this study, camel milk powder was mixed into 10g of cow milk powder at a mass concentration of 30%, 20%, 10%, 8%, 5%, 3%, 1%, 0.5%, and 0.1%, and 60mL of water was added to mix. After nucleic acid extraction (8 replicates for each sample), the method described in Example 1 was used for detection. The results are shown in Table 4. Figure 3 As shown:

[0124] Table 4

[0125] Mass concentration (%) Ct mean (FAM) Ct mean (VIC) 100 22.86 27.55 30 29.52 32.32 20 30.04 32.04 10 30.93 32.55 8 32.45 32.86 5 32.79 32.62 3 33.12 33.18 1 35.79 32.67 0.5 37.21 32.82

[0126] When camel milk powder was spiked into cow milk powder at concentrations of 30%, 20%, 10%, 8%, 5%, 3%, 1%, and 0.5%, the FAM channel (detecting camel-derived genes) was able to detect the gene with a detection rate of 100%. The FAM channel detection rate for samples spiked with 0.1% concentration was 12.5%, and the FAM channel detection rate for samples spiked with 0.05% concentration was 0%. Table 5 clearly shows that the Ct value for the FAM channel gradually decreases with increasing camel milk concentration. The VIC channel (detecting the internal standard) was able to detect the gene at all concentrations, with Ct values ​​<34. These results demonstrate that the sensitivity of the method developed in this study for detecting milk powder samples is limited to a camel milk powder concentration of 0.5%.

[0127] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A primer-probe combination for detecting camel-derived nucleic acid, characterized in that: The primer-probe combination includes a primer sequence for detecting camel-derived nucleic acid and a first probe sequence: The first primer shown in SEQ ID NO. 1: 5'-GATTCTTYGCCTTCCAYTTCATCC-3'; The second primer shown in SEQ ID NO. 2: 5'-GGAATGGGATTTTRTCTATGTCTGAGGA-3'; The first probe shown in SEQ ID NO. 3: 5'-ACACGAAACAGGYTCTAATAACCCRACAGG-3', wherein the 5' portion of the first probe is labeled with a FAM fluorescent group and the 3' portion is labeled with a BHQ1 fluorescent quenching group; The primer-probe combination also includes a primer sequence and a second probe sequence for detecting an internal standard: The third primer shown in SEQ ID NO. 4: 5'-TCTGCCCTATCAACTTTCGATG-3'; The fourth primer shown in SEQ ID NO. 5: 5'-AATTTGCGCGCCTGCTG-3'; The second probe shown in SEQ ID NO. 6: 5'-CCGTTTCTCAGGCTCCCTCTCCG-3', wherein the 5' portion of the second probe is labeled with VIC fluorescein, and the 3' portion is labeled with a BHQ1 fluorescence quenching group.

2. Use of the primer-probe combination according to claim 1 in the preparation of a reagent for detecting camel-derived nucleic acids.

3. A kit for detecting camel-derived nucleic acid, characterized in that: The kit comprises a nucleic acid amplification reaction solution, a camel-derived detection solution, a positive control and a blank control; the camel-derived detection solution comprises the primer-probe combination according to claim 1.

4. The kit for detecting camel-derived nucleic acid according to claim 3, characterized in that: The nucleic acid amplification reaction solution includes: fluorescent PCR buffer, dNTP (U) s, Mg 2+ , hot-start Taq DNA polymerase and UND enzyme.

5. The kit for detecting camel-derived nucleic acid according to claim 4, characterized in that: Each 12.5 μL of the nucleic acid amplification reaction solution includes 4 μL of fluorescent PCR buffer, 0.2 mM dNTP (U)s, Mg 2+ 3 mM, Hot Start Taq DNA Polymerase 0.6 U and UDG enzyme 0.15 U.

6. The kit for detecting camel-derived nucleic acid according to claim 3, characterized in that: The concentration of each primer in the camel-derived detection solution is 400 nM, and the concentration of each probe is 400 nM.

7. The kit for detecting camel-derived nucleic acid according to claim 3, characterized in that: The positive control includes an internal standard template whose nucleotide sequence is shown as SEQ ID NO.7, and a camel-derived gene whose nucleotide sequence is shown as SEQ ID NO.

8.

8. The kit for detecting camel-derived nucleic acid according to claim 7, characterized in that: The concentration of the internal standard template in the positive control is 1E+5 copies / mL; the concentration of the camel-derived gene is 1E+5 copies / mL.

9. The kit for detecting camel-derived nucleic acid according to claim 7, characterized in that: The positive control is prepared by respectively connecting the internal standard template and the camel-derived gene into plasmids and then diluting them.

10. The kit for detecting camel-derived nucleic acid according to claim 3, characterized in that: The blank control was RNase-free water.

11. A method for detecting camel-derived nucleic acid, characterized in that: The method comprises the following steps: Step 1, extracting genomic DNA of the sample to be tested; Step 2: Perform real-time fluorescence PCR on the genomic DNA of the sample to be tested: 2-1, Reagent preparation: Calculate the number of preparations n, where n = the number of test samples + 1 positive control + 1 blank control; prepare a corresponding number of camel-derived nucleic acid detection reaction solutions, each camel-derived nucleic acid detection reaction solution including a nucleic acid amplification reaction solution and a camel-derived detection solution; The camel-derived detection solution includes the primer-probe combination of claim 1; 2-2, nucleic acid loading: Add the test sample DNA, positive control, and blank control extracted in step 1 to the camel-derived nucleic acid detection reaction solution described in 2-1 respectively; 2-3, PCR amplification detection: The reaction system obtained in 2-2 was placed in a fluorescent quantitative PCR instrument for detection; The amplification procedure in steps 2-3 is: Step ①: 95℃×30 s; 1 cycle; Step ②: 95°C × 1s, 58°C × 10s; 40 cycles; In step ②, fluorescence detection was performed at 58°C, and the FAM and VIC detection channels collected fluorescence signals; Step 3, result interpretation: 3-1, Interpretation of test effectiveness: When the positive control FAM channel test result is Ct≤30, and the internal standard VIC channel test result is Ct≤30; at the same time, the blank control FAM and VIC channels have no Ct value, it is a valid result; 3-2, positive interpretation: When the VIC channel test result of the sample to be tested is Ct≤40, the FAM channel test result is Ct≤40, and the curve is S-shaped with a clear exponential growth period, it is judged to be positive, and the sample to be tested contains camel-derived genes; When the test sample has a Ct≤40 in the VIC channel and a Ct>40 in the FAM channel or no detection, it is judged as negative; the test sample does not contain camel-derived genes; When the internal standard of the sample to be tested has a Ct>40 or is not detected in the VIC channel, it is considered an invalid result.

12. The method for detecting camel-derived nucleic acid according to claim 11, characterized in that: The genomic DNA of the sample to be tested is extracted in step 1 using a genomic DNA extraction reagent or a genomic DNA extraction kit.

13. The method for detecting camel-derived nucleic acid according to claim 11, characterized in that: Each portion of camel-derived nucleic acid detection reaction solution in step 2-1 includes 12.5 μL of nucleic acid amplification reaction solution and 7.5 μL of camel-derived detection solution.

14. The method for detecting camel-derived nucleic acid according to claim 11, characterized in that: The added amount of the test sample DNA, positive control, and blank control in step 2-2 is 5 μL.

Images