Multiple primer sets and kits for detecting pathogens of acute lower respiratory tract infections

Abstract

The present application relates to the field of biochemistry, and discloses a multiple primer set and a kit for detecting pathogens of acute infection of the lower respiratory tract, including primer pairs for detecting Mycoplasma pneumoniae, primer pairs for detecting Chlamydia pneumoniae, primer pairs for detecting Staphylococcus aureus, primer pairs for detecting Haemophilus influenzae, primer pairs for detecting Streptococcus pneumoniae, and primer pairs for detecting Klebsiella pneumoniae. The multiple primer set for detecting pathogens of acute infection of the lower respiratory tract of the present application can realize simultaneous amplification and detection of 6 targets, and is suitable for screening of clinical cases of acute lower respiratory tract infection.

Description

Technical Field

[0001] The present application relates to the biochemical field, and mainly to a multiple primer set and a kit for detecting pathogens of acute infection of the lower respiratory tract. Background Art

[0002] Since the outbreak of the new coronavirus, people have paid more and more attention to respiratory nucleic acid testing. In addition to the new coronavirus, there are many other pathogens that can cause similar respiratory infection symptoms, and respiratory infections have a higher incidence rate in children and adolescents, and even in groups with weaker resistance such as young children and elderly infected people. Respiratory tract infections can be divided into upper and lower respiratory tract infections. The common pathogens of upper respiratory tract infections are viruses, while lower respiratory tract infections are mostly bacterial infections. The clinical features caused by infections with these pathogens are similar, and clinical diagnosis is difficult to distinguish, which can easily lead to misdiagnosis and abuse of antibiotics. Therefore, the development of rapid and accurate pathogen detection methods is of great significance for clinical diagnosis and medication guidance.

[0003] Traditional methods for detecting bacteria in lower respiratory tract infections include isolation culture and serological analysis. Although isolation culture is regarded as the "gold standard" for confirming respiratory tract infections, this method has poor specificity and sensitivity, and is prone to false negatives when testing samples from patients with early infections. At the same time, this method is time-consuming and cannot meet the clinical needs of rapid testing.

[0004] Serological testing based on immune response usually detects pathogen-related antigens or antibodies. Although this method greatly shortens the detection time, due to the obvious window period of antigen and antibody detection and insufficient sensitivity, false negatives are still prone to occur in clinical diagnosis.

[0005] In comparison, nucleic acid testing takes less time and has higher sensitivity. Even in the early stages of viral infection, it has a higher detection rate, so it is more suitable for screening of pathogens of clinical respiratory tract infections. However, conventional nucleic acid detection single-tube reactions can usually only detect one pathogen, and can only be screened through multiple reactions, which consumes a lot of samples, is time-consuming, and has higher detection costs. Therefore, multiple nucleic acid detection schemes have been born, and the main ones are: solid phase / liquid phase chip method, dissolution curve analysis method, mass spectrometry, fragment analysis method, etc. Compared with other multiple detection methods, fragment analysis is easier to operate, less expensive, and less dependent on instruments. At present, there is no detection method that can simultaneously detect multiple common lower respiratory tract infection bacteria through a single tube reaction.

[0006] Therefore, the prior art still needs to be improved and developed. Summary of the invention

[0007] In view of the above-mentioned deficiencies in the prior art, the purpose of the present application is to provide a multiple primer set and a kit for detecting pathogens of acute infection of the lower respiratory tract. The multiple primer set of the present application is designed based on the fragment analysis detection method for detecting pathogens of acute infection of the lower respiratory tract. It can simultaneously detect 6 common lower respiratory tract infection pathogens, and use the fragment analysis method to analyze multiple PCR products. It can realize the detection of samples infected with a single pathogen or a combination of pathogens through a one-tube reaction. The present application aims to provide a new multiple primer set and a kit for detecting pathogens of acute infection of the lower respiratory tract.

[0008] The technical solution of this application is as follows:

[0009] A multiplex primer set for detecting pathogens of acute infection of the lower respiratory tract, comprising a primer pair for detecting Mycoplasma pneumoniae, a primer pair for detecting Chlamydia pneumoniae, a primer pair for detecting Staphylococcus aureus, a primer pair for detecting Haemophilus influenzae, a primer pair for detecting Streptococcus pneumoniae and a primer pair for detecting Klebsiella pneumoniae.

[0010] The multiplex primer set for detecting pathogens of acute lower respiratory tract infection of the present application can realize simultaneous amplification and detection of 6 targets, and is suitable for screening of clinical cases of acute lower respiratory tract infection.

[0011] The multiple primer set for detecting pathogens of acute infection of the lower respiratory tract, wherein the Mycoplasma pneumoniae detection primer pair includes a primer having a nucleotide sequence of GAGAAATGGCACAAATGGGA and a primer having a nucleotide sequence of ACCATCGGTAAACCATTCAC;

[0012] The Chlamydia pneumoniae detection primer pair includes a primer having a nucleotide sequence of CGAGCAACTTTTGATGCTGA and a primer having a nucleotide sequence of GTAGTAGACAATGCTGTGGC;

[0013] The Haemophilus influenzae detection primer pair includes a primer having a nucleotide sequence of AACAAGCRCAAGTTTATCC and a primer having a nucleotide sequence of AACCAAGGTGCTTTRATTTC;

[0014] The Streptococcus pneumoniae detection primer pair includes a primer having a nucleotide sequence of CTCGTAGTGGATGAGACCTT and a primer having a nucleotide sequence of GGGACATTATTGACCTGACC;

[0015] The Staphylococcus aureus detection primer pair includes a primer with a nucleotide sequence of TACACCTGAAACAAAGCATCC and a primer with a nucleotide sequence of TTYGCTTGTGCTTCACTTT;

[0016] The Klebsiella pneumoniae detection primer pair includes a primer with a nucleotide sequence of AAGTCATATCCCCACAGATG and a primer with a nucleotide sequence of GTTGCCGATTKACCTTTCA.

[0017] The multiple primer set for detecting pathogens of acute infection of the lower respiratory tract, wherein the 5' end of each primer can be provided with a modification mark.

[0018] The multiple primer set for detecting pathogens of acute infection of the lower respiratory tract, wherein the modification marker is fluorescein modification.

[0019] The multiple primer set for detecting pathogens of acute lower respiratory tract infection of the present application is designed with 6 pairs of specific primers for the conserved genome sequences of 6 common pathogens of lower respiratory tract infection, with strong specificity and high sensitivity.

[0020] The multiplex primer set for detecting pathogens of acute infection of the lower respiratory tract, wherein the fluorescein is modified to FAM, TET, HEX or TAMRA.

[0021] A kit, comprising the multiple primer set as described above for detecting pathogens of acute infection of the lower respiratory tract.

[0022] The kit, wherein the final concentration of each primer is 50-250 nM.

[0023] The kit further comprises a PCR reaction premix.

[0024] The kit further comprises a negative control, which is RNase-free ddH2O.

[0025] The kit further comprises a positive control, which is a recombinant plasmid comprising the target genes MP, CP, HI, SP, SA and KP.

[0026] Beneficial effects: The multiple primer set and kit for detecting pathogens of acute lower respiratory tract infection of the present application can realize the simultaneous amplification and detection of 6 targets, and is suitable for the screening of clinical cases of acute lower respiratory tract infection. A single test can realize the simultaneous screening of 6 possible infection types, which greatly reduces the detection cost and saves the detection time. It is suitable for routine clinical testing and emergency testing in response to public health emergencies. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 This is the fragment analysis result of the amplified product when the quality control product of 10^6 copies / ml MP is used as the test sample in Example 1 of the present application.

[0028] Figure 2 This is the fragment analysis result of the amplified product when the quality control product with 10^3 copies / ml CP is used as the test sample in Example 1 of the present application.

[0029] Figure 3 This is the fragment analysis result of the amplified product when the quality control product of 10^5 copies / ml HI is used as the test sample in Example 1 of the present application.

[0030] Figure 4 This is the fragment analysis result of the amplified product when the quality control product of 10^5 copies / ml SP is used as the test sample in Example 1 of the present application.

[0031] Figure 5 This is the fragment analysis result of the amplified product when the quality control product of 10^5 copies / ml SA is used as the test sample in Example 1 of the present application.

[0032] Figure 6 This is the fragment analysis result of the amplified product when the quality control product of 10^5 copies / ml KP is used as the test sample in Example 1 of the present application.

[0033] Figure 7 This is the fragment analysis result of the amplified product when the mixed sample of MP and HI is used as the test sample in Example 2 of the present application.

[0034] Figure 8 This is the fragment analysis result of the amplified product when the mixed sample of MP and SA is used as the test sample in Example 2 of the present application.

[0035] Fig. 9 This is the fragment analysis result of the amplified product when the mixed sample of MP, HI and SA is used as the test sample in Example 2 of the present application.

[0036] Fig.10 This is the fragment analysis result of the amplified product when the mixed sample of MP, SP and SA is used as the test sample in Example 2 of the present application.

[0037] Fig.11 This is the fragment analysis result of the amplified product when a mixed sample of 6 pathogens is used as the test sample in Example 3 of the present application.

[0038] Fig.12 This is the fragment analysis result of the amplified product when RNase-free ddH2O is used as the test sample in Example 3 of the present application.

[0039] Fig.13 This is the fragment analysis result of the amplified product when 10^2 copies / ml MP is used as the test sample in Example 4 of the present application.

[0040] Fig.14 This is the fragment analysis result of the amplified product when 10^2 copies / ml CP is used as the sample to be tested in Example 4 of the present application.

[0041] Fig.15 This is the fragment analysis result of the amplified product when 10^3 copies / ml HI is used as the test sample in Example 4 of the present application.

[0042] Fig.16 This is the fragment analysis result of the amplified product when 10^2 copies / ml SP is used as the sample to be tested in Example 4 of the present application.

[0043] Fig.17 This is the fragment analysis result of the amplified product when 10^2 copies / ml SA is used as the test sample in Example 4 of the present application.

[0044] Fig.18 This is the fragment analysis result of the amplified product when 10^2 copies / ml KP is used as the test sample in Example 4 of the present application.

[0045] Fig.19 This is the fragment analysis result of the amplified product when 10^5 copies / ml HSV1 is used as the test sample in Example 5 of the present application.

[0046] Fig. 20 This is the fragment analysis result of the amplified product when 10^5 copies / ml BP is used as the sample to be tested in Example 5 of the present application.

[0047] Fig.21 This is the fragment analysis result of the amplified product when 10^4 copies / ml HADV5 is used as the test sample in Example 5 of the present application.

[0048] Fig. 22 This is the fragment analysis result of the amplified product when 10^4 copies / ml HADV3 is used as the test sample in Example 5 of the present application.

[0049] Fig.23 This is the fragment analysis result of the amplified product when 10^4 copies / ml human genomic DNA is used as the test sample in Example 5 of the present application. DETAILED DESCRIPTION

[0050] The present application provides a multiple primer set and a kit for detecting pathogens of acute infection of the lower respiratory tract. In order to make the purpose, technical solution and effect of the present application clearer and more specific, the present application is further described in detail below. It should be understood that the specific embodiments described herein are only used to explain the present application and are not used to limit the present application.

[0051] The multiple primer set provided in the present application for detecting pathogens of acute lower respiratory tract infection has 6 pairs of specific primers designed for the conserved genomic sequences of 6 common pathogens of lower respiratory tract infection, including: Mycoplasma pneumoniae (MP), Chlamydia pneumoniae (CP), Staphylococcus aureus (SA), Haemophilus influenzae (HI), Streptococcus pneumoniae (SP) and Klebsiella pneumoniae (KP). The reference sequences of the target genes of each pathogen are shown in Table 1. The multiple primer set for detecting pathogens of acute lower respiratory tract infection in the present application can realize the simultaneous amplification and detection of 6 targets, and is suitable for the screening of clinical cases of acute lower respiratory tract infection. A single test can realize the simultaneous screening of 6 possible infection types, which greatly reduces the detection cost and saves the detection time. It is suitable for routine clinical detection and emergency detection in response to public health emergencies.

[0052] Table 1

[0053]

[0054] Specifically, the multiple primer set for detecting pathogens of acute infection of the lower respiratory tract of the present application includes a primer pair for detecting Mycoplasma pneumoniae, a primer pair for detecting Chlamydia pneumoniae, a primer pair for detecting Staphylococcus aureus, a primer pair for detecting Haemophilus influenzae, a primer pair for detecting Streptococcus pneumoniae, and a primer pair for detecting Klebsiella pneumoniae, and their nucleotide sequences are shown in Table 2.

[0055] Multiple primer pairs designed for different target sequences in the multiplex PCR system can realize simultaneous amplification of multiple target nucleic acids in one reaction system. The multiplex primer set for detecting pathogens of acute infection of the lower respiratory tract of the present application is detected by multiplex PCR technology. When the above 6 pathogens of acute infection of the lower respiratory tract are present in the sample to be tested, after PCR amplification, the product fragment size of each primer pair is different, the product size corresponding to the Mycoplasma pneumoniae detection primer pair is 74 bp, the product size corresponding to the Chlamydia pneumoniae detection primer pair is 119 bp, the product size corresponding to the Haemophilus influenzae detection primer pair is 151 bp, the product size corresponding to the Streptococcus pneumoniae detection primer pair is 209 bp, the product size corresponding to the Staphylococcus aureus detection primer pair is 279 bp, and the product size corresponding to the Klebsiella pneumoniae detection primer pair is 363 bp. Therefore, after PCR amplification, the amplified product can be analyzed by a fragment analyzer, and the type of pathogen can be determined according to the fragment size of the amplified product.

[0056] Table 2

[0057]

[0058] Further, the multiple primer set for detecting pathogens of acute infection of the lower respiratory tract of the present application, the 5' end of each primer may be provided with a modification mark. The modification mark may be fluorescein modification or biotin modification, etc. Among them, the fluorescein modification may be FAM, TET, HEX or TAMRA, etc. When the 5' end of the primer is provided with a modification mark, the multiple primer set for detecting pathogens of acute infection of the lower respiratory tract of the present application may be applicable to a variety of nucleic acid detection methods, and the multiple PCR amplification system constructed by the present application may be combined with other different detection methods to achieve multiple detection of pathogen nucleic acids, for example, fluorescein labeling of primers may be used for capillary electrophoresis detection, biotin labeling of primers may be used for solid phase or liquid phase chip hybridization detection, and the corresponding single base extension system may be used in conjunction with a mass spectrometry detection platform.

[0059] The present application also provides a kit, which includes the above-mentioned multiple primer set for detecting pathogens of acute infection of the lower respiratory tract.

[0060] Furthermore, the kit of the present application may also include a PCR reaction premix. The PCR reaction premix can be prepared by yourself or purchased from the market. In the embodiment of the present application, the PCR reaction premix was purchased from Roche Pharmaceuticals, which includes the enzymes required for the PCR reaction, Mg 2+ , dNTP, etc.

[0061] Furthermore, the kit of the present application may also include a negative control, which is RNase-free ddH2O (double distilled water treated with DEPC, i.e. diethyl pyrocarbonate, and sterilized at high temperature and high pressure, and does not contain impurities RNA, DNA, and protein). The negative control can be prepared by yourself or purchased from the market. In the examples of the present application, RNase-free ddH2O was purchased from ThermoFisher Scientific.

[0062] Furthermore, the kit of the present application may also include a positive control, which is a recombinant plasmid containing the target genes of MP, CP, HI, SP, SA and KP. In the examples of the present application, the positive control was ordered from Sangon Biotech (Shanghai) Co., Ltd.

[0063] The detection method of the kit of the present application is to obtain a sample to be tested by collecting human respiratory samples and extracting nucleic acids, and then preparing an amplification reaction system to perform multiple PCR amplification, and then perform fragment analysis on the obtained amplified products, and determine the type of pathogen according to the fragment size of the amplified products. During fragment analysis, a preliminary analysis can be performed by agarose gel electrophoresis; fragment analysis can also be used for further analysis, and the type of pathogen infection can be determined based on the product fragment analysis map. Specifically, when the sample to be tested is amplified by PCR amplification, the configuration of the amplification system is shown in Table 3, and the PCR reaction conditions are shown in Table 4. Among them, the template can be a sample to be tested, a negative control, or a positive control.

[0064] Table 3

[0065]

[0066] Table 4

[0067]

[0068] The present application is further described below through specific embodiments.

[0069] In the following examples, the kit includes a PCR reaction premix, a primer set, a negative control, and a positive control, as shown in Table 5. The PCR reaction premix was purchased from Roche Pharmaceuticals; the positive control was a recombinant plasmid containing the target genes of MP, CP, HI, SP, SA, and KP; the primers and recombinant plasmid were ordered from Sangon Biotech (Shanghai) Co., Ltd.; and RNase-free ddH2O was purchased from ThermoFisher Scientific.

[0070] Table 5

[0071]

[0072] Among them, in the examples of the present application, the final concentration of each primer in the primer set mixture is shown in Table 6.

[0073] Table 6

[0074]

[0075] Example 1

[0076] In this embodiment, a multiplex detection system is used to detect a single pathogen to verify the detection capability of the multiplex detection system for samples infected with a single pathogen.

[0077] The quality control products of 6 pathogens MP, CP, HI, SP, SA, and KP (the nominal nucleic acid concentrations of the quality control products of MP, CP, HI, SP, SA, and KP are 10^6, 10^3, 10^5, 10^5, 10^5, and 10^5 copies / ml, respectively) were taken as 6 groups of samples to be tested for nucleic acid extraction and detection. The amplification reaction system was prepared according to Table 3, and multiple PCR amplification was performed according to the PCR reaction conditions in Table 4. The obtained amplification products were analyzed by a fragment analyzer (Houze Biology, Qsep1), and the test results were output. The type of pathogen can be determined according to the fragment size of the amplification product. The specific operation method of the fragment analyzer can be found in the Qsep1 operating manual.

[0078] The results are as follows Figure 1 to Figure 6 As shown, it is confirmed that the multiplex primer set and kit proposed in this application can achieve single-plex detection of each pathogen.

[0079] Example 2

[0080] In this example, a multiplex detection system was used to detect mixed pathogens to verify the multiplex detection capability of the primer set and kit proposed in this application.

[0081] Mixed samples of quality control products of each pathogen were taken as test samples, and were subjected to multiple PCR amplification and product fragment analysis. Among them, the mixed samples of pathogen quality control products were mixed samples of MP and HI, mixed samples of MP and SA, mixed samples of MP, HI and SA, and mixed samples of MP, SP and SA. The nominal nucleic acid concentration of the quality control products of each pathogen was 10^5 copies / ml. The mixed samples of the first two groups were mixed with the quality control products of each pathogen in a volume ratio of 1:1 and then nucleic acid was extracted. The mixed samples of the pathogen nucleic acid of the latter two groups were mixed with the quality control products of each pathogen in a volume ratio of 1:1:1 and then nucleic acid was extracted. The amplification reaction system was prepared according to Table 3, and the multiple PCR amplification was performed according to the PCR reaction conditions in Table 4. The obtained amplification products were analyzed by a fragment analyzer (Houze Biology, Qsep1) and the test results were output.

[0082] The results are as follows Figure 7~Figure 10 As shown, the results confirm that the multiple primer set and kit proposed in the present application have multiple detection capabilities and can realize the detection of complex infection samples.

[0083] Example 3

[0084] In this example, a multiplex detection system was used to detect infection with six pathogens. The quality control products of the six pathogens MP, CP, HI, SP, SA, and KP in Example 1 were mixed in equal volumes, nucleic acid was extracted, multiplex PCR amplification was performed on the extracted products, and the PCR products were analyzed by electrophoresis in a fragment analyzer to distinguish different pathogens based on the product fragment size. The results are shown in FIG. Fig.11 As shown, the results confirmed that the multiple primer set and kit proposed in this application can indeed detect the corresponding 6 pathogens at the same time.

[0085] In addition, RNase-free ddH2O was used as the negative control for the test sample, and the same nucleic acid extraction and PCR amplification were performed and analyzed by electrophoresis in a fragment analyzer. Fig.12 This is the detection result of the negative control amplification product.

[0086] Example 4

[0087] In this example, a multiplex detection system was used to detect six pathogen samples respectively to verify the detection sensitivity of the primer set and the kit proposed in this application.

[0088] The quality control samples of the six pathogens were gradiently diluted to lower concentrations. The nucleic acid concentration of MP was 10^2 copies / ml, the nucleic acid concentration of CP was 10^2 copies / ml, the nucleic acid concentration of HI was 10^3 copies / ml, the nucleic acid concentration of SP was 10^2 copies / ml, the nucleic acid concentration of SA was 10^2 copies / ml, and the nucleic acid concentration of KP was 10^2 copies / ml. In this way, the nucleic acid concentration in the subsequent reaction was about 10-100 copies / reaction, and the nucleic acid sample to be tested was obtained after nucleic acid extraction, followed by multiple PCR amplification and product fragment analysis. The results are as follows Figure 13-18 As shown, the detection effect of the kit of the present application when detecting low-concentration samples is respectively demonstrated. The results confirm that the multiple primer set and kit proposed in the present application can realize low-concentration sample detection, and the sensitivity can reach 10 copies / reaction. At this stage, the approved multiple detection reagents for lower respiratory tract pathogen nucleic acid mainly include: Shengxiang Bio (fluorescence quantitative method), Bio Jingdian (constant temperature amplification chip method) and Bioconxin (constant temperature amplification chip method). The nominal detection sensitivity of each brand of kit is: 500 copies / ml, 500 copies / reaction and 500 CFU / μl. The comparison shows that the detection effect of the kit of the present application is better than or equivalent to other similar lower respiratory tract infection pathogen detection kits. Example 5

[0089] In this example, a multiplex detection system is used to detect other samples that are not within the detection range of the kit to verify the specificity of the primer set and kit proposed in this application.

[0090] This example selects common virus / bacteria samples collected from clinical respiratory tract for testing. The quality control products (nominal nucleic acid concentrations of 10^4 copies / ml of HADV3, 10^4 copies / ml of HADV5, 10^5 copies / ml of HSV1, 10^5 copies / ml of BP and 10^4 copies / ml of human genomic DNA) are subjected to multiple PCR amplification after nucleic acid extraction, and the PCR products are subjected to electrophoresis analysis in a fragment analyzer to distinguish different pathogens based on product size. The results are shown in the figure. Figure 19-23 As shown, the multiplex detection system did not report false positive results and showed good specificity.

[0091] It should be understood that the application of the present application is not limited to the above examples. For ordinary technicians in this field, improvements or changes can be made according to the above description, and all these improvements and changes should fall within the scope of protection of the present application.

Claims

1. A multiplex primer set for detecting pathogens of acute infection of the lower respiratory tract, characterized in that: Including primer pairs for detecting Mycoplasma pneumoniae, primer pairs for detecting Chlamydia pneumoniae, primer pairs for detecting Staphylococcus aureus, primer pairs for detecting Haemophilus influenzae, primer pairs for detecting Streptococcus pneumoniae and primer pairs for detecting Klebsiella pneumoniae; The Mycoplasma pneumoniae detection primer pair includes a primer having a nucleotide sequence of GAGAAATGGCACAAATGGGA and a primer having a nucleotide sequence of ACCATCGGTAAACCATTCAC; The Chlamydia pneumoniae detection primer pair includes a primer having a nucleotide sequence of CGAGCAACTTTTGATGCTGA and a primer having a nucleotide sequence of GTAGTAGACAATGCTGTGGC; The Haemophilus influenzae detection primer pair includes a primer having a nucleotide sequence of AACAAGCRCAAGTTTATCC and a primer having a nucleotide sequence of AACCAAGGTGCTTTRATTTC; The Streptococcus pneumoniae detection primer pair includes a primer having a nucleotide sequence of CTCGTAGTGGATGAGACCTT and a primer having a nucleotide sequence of GGGACATTATTGACCTGACC; The Staphylococcus aureus detection primer pair includes a primer with a nucleotide sequence of TACACCTGAAACAAAGCATCC and a primer with a nucleotide sequence of TTYGCTTGTGCTTCACTTT; The Klebsiella pneumoniae detection primer pair includes a primer with a nucleotide sequence of AAGTCATATCCCCACAGATG and a primer with a nucleotide sequence of GTTGCCGATTKACCTTTCA.

2. The multiplex primer set for detecting pathogens of acute infection of the lower respiratory tract according to claim 1, characterized in that: The 5' end of each primer is provided with a modification tag.

3. The multiplex primer set for detecting pathogens of acute infection of the lower respiratory tract according to claim 2, characterized in that: The modification marker is fluorescein modification.

4. The multiplex primer set for detecting pathogens of acute infection of the lower respiratory tract according to claim 3, characterized in that: The fluorescein is modified to FAM, TET, HEX or TAMRA.

5. A kit, characterized in that: It comprises a multiple primer set for detecting pathogens of acute infection of the lower respiratory tract as described in any one of claims 1 to 4.

6. The kit according to claim 5, characterized in that The kit also includes a PCR reaction premix.

7. The kit according to claim 5, characterized in that The kit also includes a negative control, which is RNase-free ddH2O.

8. The kit according to claim 5, characterized in that The kit also includes a positive control, which is a recombinant plasmid containing target genes of Mycoplasma pneumoniae, Chlamydia pneumoniae, Haemophilus influenzae, Streptococcus pneumoniae, Staphylococcus aureus and Klebsiella pneumoniae.

Images