A monoclonal antibody capable of inducing macrophages to phagocytose cancer cells, and its preparation method and application

Abstract

The present invention, belonging to the field of biomedicine, provides a monoclonal antibody capable of inducing macrophages to phagocytose cancer cells. It also provides a nucleic acid molecule encoding the antibody, an expression vector, a host cell, and a method for preparing the antibody. It also provides a pharmaceutical composition comprising the antibody and its use. The anti-human CD47 monoclonal antibody of the present invention has a high affinity for human CD47 and, compared to existing anti-human CD47 monoclonal antibodies, exhibits a stronger effect in promoting tumor cell phagocytosis.

Description

Technical Field

[0001] The present invention relates to the technical field of biomedicine, and in particular to a CD47 monoclonal antibody capable of inducing macrophages to phagocytize cancer cells, and a preparation method and application thereof. Background Art

[0002] CD47 is a transmembrane protein expressed on nearly all human cells. Also known as integrin-associated protein (IAP), CD47 is a member of the immunoglobulin superfamily. CD47 is widely expressed on the cell surface and interacts with SIRPα, thrombospondin-1 (TSP-1), and integrins to mediate a range of responses, including apoptosis, proliferation, and immunity.

[0003] CD47, through its interaction with SIRPα, releases a "don't eat me" signal to macrophages. CD47 is a cytokine that is expressed in the blood vessels of the host and in the blood vessels of the tumor. It is involved in the proliferation of tumor cells and dendritic cells (DCs), protecting cells from the immune system. It also promotes the proliferation and growth of tumor cells by promoting the proliferation of blood vessels in the tumor and inhibiting the function of effector T cells. Cancer cells evade the host's immune surveillance through this pathway, and overexpression of CD47 has been found to be associated with poor clinical outcomes. CD47 has also been identified as a cancer stem cell marker in leukemia and solid tumors (Jaiswal, et al., (2009) Cell, 138(2):271-85; Chan, et al., (2009) Proc Natl Acad Sci USA, 106(33):14016-21; Chan, et al., (2010) Curr Opin Urol, 20(5):393-7; Majeti R, et al., (2011) Oncogene, 30(9):1009-19). Therefore, CD47 blocking antibodies have been used in tumor treatment and have shown anti-tumor activity in multiple in vivo tumor models. Furthermore, these antibodies have been shown to synergize with other therapeutic antibodies, including rituximab and Herceptin, in tumor models.

[0004] Researchers at the Stanford University School of Medicine reversed lung fibrosis in mutant mice by administering anti-CD47 antibodies, further identifying CD47 as a potential therapeutic target for treating pulmonary fibrosis, an incurable and life-threatening disease.

[0005] In recent years, drug development targeting the tumor escape mechanism mediated by the CD47 and its ligand SIRPα signaling axis has become a hot topic in tumor immunotherapy. However, currently developed anti-human CD47 monoclonal antibodies still have problems such as low affinity or unclear target epitopes.

[0006] Therefore, there is an urgent need for a therapeutic candidate CD47 antibody with high affinity that can induce macrophages to phagocytose cancer cells. Summary of the Invention

[0007] The purpose of the present invention is to address the deficiencies of the above-mentioned prior art and to provide a monoclonal antibody capable of inducing macrophages to phagocytose cancer cells, as well as a preparation method and application thereof. The monoclonal antibody has a high affinity for human CD47 and has a strong effect of promoting the phagocytosis of tumor cells.

[0008] The present invention provides a monoclonal antibody capable of inducing macrophages to phagocytose cancer cells, wherein the antibody comprises a heavy chain variable region and a light chain variable region;

[0009] The heavy chain variable region comprises CDR-H1, CDR-H2 and CDR-H3, and the light chain variable region comprises CDR-L1, CDR-L2 and CDR-L3;

[0010] The amino acid sequence of the CDR-H1 is shown in SEQ ID NO: 2;

[0011] The amino acid sequence of the CDR-H2 is shown in SEQ ID NO: 4;

[0012] The amino acid sequence of the CDR-H3 is shown in SEQ ID NO: 6;

[0013] The amino acid sequence of the CDR-L1 is shown in SEQ ID NO: 12;

[0014] The amino acid sequence of the CDR-L2 is shown in SEQ ID NO: 14;

[0015] The amino acid sequence of the CDR-L3 is shown in SEQ ID NO: 16.

[0016] Preferably, the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO: 8; and the amino acid sequence of the light chain variable region is shown in SEQ ID NO: 18.

[0017] Preferably, the heavy chain amino acid sequence is shown in SEQ ID NO: 10; and the light chain amino acid sequence is shown in SEQ ID NO: 20.

[0018] Preferably, both the heavy chain and the light chain further comprise a constant region, which is a constant region of mouse or human IgG, preferably a constant region of IgG4.

[0019] The present invention further provides a nucleotide molecule encoding the monoclonal antibody.

[0020] Preferably, the sequence of the nucleotide molecule is selected from SEQ ID NO: 7 and SEQ ID NO: 17;

[0021] The sequence SEQ ID NO: 7 encodes the heavy chain variable region of the antibody;

[0022] The sequence SEQ ID NO: 17 encodes the light chain variable region of the antibody.

[0023] The present invention further provides an expression vector containing the nucleotide molecule.

[0024] The present invention further provides a host cell containing the expression vector.

[0025] Preferably, the host cell is a eukaryotic cell, preferably a mammalian cell.

[0026] The present invention further provides a method for preparing a monoclonal antibody capable of inducing macrophages to phagocytose cancer cells, comprising the following steps:

[0027] (1) preparing an expression vector containing a nucleotide molecule for expressing the monoclonal antibody;

[0028] (2) transfecting eukaryotic host cells with the expression vector obtained in step (1) and culturing the cells;

[0029] (3) Isolate and purify to obtain monoclonal antibodies that can induce macrophages to phagocytize cancer cells.

[0030] The present invention further provides an antibody immunoconjugate, a bispecific molecule, a chimeric antigen receptor or a pharmaceutical composition comprising the monoclonal antibody capable of inducing macrophages to phagocytose cancer cells.

[0031] Furthermore, the pharmaceutical composition comprises a therapeutically effective amount of the monoclonal antibody and one or more pharmaceutically acceptable carriers, diluents or excipients.

[0032] The present invention further provides the use of the monoclonal antibody in the preparation of anti-tumor drugs or drugs for fibrotic diseases.

[0033] Preferably, the tumor is a hematological tumor or a solid tumor, including non-Hodgkin's lymphoma (NHL), acute lymphoblastic leukemia (ALL), acute myeloblastic leukemia (AML), ovarian cancer, fallopian tube cancer, colorectal cancer, bladder cancer, breast cancer, head and neck cancer, pancreatic cancer, lung cancer, glioma and glioblastoma.

[0034] Preferably, the fibrotic disease includes angina pectoris, osteoarthritis, pulmonary fibrosis, asthma and bronchitis.

[0035] Beneficial effects:

[0036] The monoclonal antibody provided by the present invention, which can induce macrophages to phagocytose cancer cells, has a high affinity for human CD47 and, compared with existing anti-human CD47 monoclonal antibodies, has a stronger effect of promoting tumor cell phagocytosis. In addition, the monoclonal antibody provided by the present invention also has good CD47-SIRPα blocking activity. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 Capture ELISA was used to determine the antibody's ability to bind to human CD47 protein;

[0038] Figure 2 The antibody's binding ability to cynomolgus monkey CD47 protein was determined by capture ELISA;

[0039] Figure 3 Flow cytometry was used to evaluate the binding of antibodies to 293F cells overexpressing human CD47.

[0040] Figure 4 for ligand binding blocking ELISA;

[0041] Figure 5 Blocking ELISA with reference antibody. DETAILED DESCRIPTION

[0042] the term

[0043] "Binding to CD47" or "binding to CD47" means being able to interact with human CD47.

[0044] "Antigen binding site" refers to a discrete, three-dimensional site on an antigen that is recognized by the antibodies or antigen-binding fragments herein.

[0045] "Monoclonal antibody" refers to a preparation of antibody molecules having a single amino acid composition, and does not refer to the method by which they are produced. Monoclonal antibodies or antigen-binding fragments thereof can be produced, for example, by hybridoma technology, recombinant technology, phage display technology, synthetic techniques such as CDR grafting, or a combination of these or other techniques known in the art.

[0046] "Affinity" refers to the strength of the sum of all non-covalent interactions between a single binding site of a molecule (e.g., an antibody) and its binding partner (e.g., an antigen). Unless otherwise indicated, herein, "binding affinity" refers to intrinsic binding affinity, which reflects a 1:1 interaction between an antibody and an antigen. Affinity can be measured by common methods known in the art, including those known in the art and described herein.

[0047] The term "competition" when used in the context of antigen-binding proteins (e.g., neutralizing antigen-binding proteins or neutralizing antibodies) that compete for the same epitope means competition between antigen-binding proteins, which is determined by an assay in which the antigen-binding protein to be tested (e.g., an antibody or immunologically functional fragment thereof) prevents or inhibits (e.g., reduces) specific binding of a reference antigen-binding protein (e.g., a ligand or reference antibody) to a common antigen (e.g., CD47 or a fragment thereof). Numerous types of competitive binding assays can be used to determine whether one antigen-binding protein competes with another. Competitive inhibition is measured by measuring the amount of label bound to a solid surface or cell in the presence of the antigen-binding protein being tested. Typically, the antigen-binding protein being tested is present in excess. Antigen-binding proteins identified by competitive assays (competing antigen-binding proteins) include: antigen-binding proteins that bind to the same epitope as the reference antigen-binding protein; and antigen-binding proteins that bind to a neighboring epitope sufficiently close to the binding epitope of the reference antigen-binding protein that the two epitopes sterically hinder each other from binding.

[0048] Methods for producing and purifying antibodies and antigen-binding fragments are well known and disclosed in the art, such as the Cold Spring Harbor Laboratory Manual of Antibody Laboratory Techniques. For example, mice can be immunized with human CD47 or fragments thereof, and the resulting antibodies can be renatured, purified, and subjected to amino acid sequencing using conventional methods. Antigen-binding fragments can also be prepared using conventional methods.

[0049] "Treatment" means administering a therapeutic agent, such as a composition comprising a CD47 antibody or antigen-binding fragment thereof, to a patient who has one or more symptoms of a disease. Generally, the therapeutic agent is administered in an amount effective to alleviate one or more symptoms of the disease in the patient or population being treated, whether by inducing regression of such symptoms or inhibiting the progression of such symptoms to any clinically measurable degree. The amount of therapeutic agent effective to alleviate any specific disease symptom (also referred to as a "therapeutically effective amount") can vary depending on a variety of factors, such as the patient's disease state, age, and weight, and the ability of the drug to produce the desired therapeutic effect on the patient. Whether a disease symptom has been alleviated can be assessed by any clinical test commonly used by a physician or other health care professional to assess the severity or progression of such symptoms.

[0050] An "effective amount" encompasses an amount sufficient to ameliorate or prevent the symptoms or conditions of a medical condition. An effective amount also means an amount sufficient to permit or facilitate diagnosis. The effective amount for a particular patient or veterinary subject may vary depending on factors such as the condition to be treated, the patient's overall health, the route and dosage of administration, and the severity of side effects. An effective amount can be the maximum dose or dosage regimen that avoids significant side effects or toxic effects.

[0051] A "pharmaceutical composition" refers to a mixture containing one or more CD47 antibodies or antigen-binding fragments thereof described herein and other pharmaceutical ingredients, such as physiologically / pharmaceutically acceptable carriers and excipients. The purpose of a pharmaceutical composition is to facilitate administration to an organism, promote absorption of the active ingredient, and thereby exert its biological activity.

[0052] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the invention. The experimental methods in the following examples, for which specific conditions are not specified, are generally performed under conventional conditions or according to the conditions recommended by the manufacturer. Reagents for which specific sources are not specified are conventional reagents purchased from the market.

[0053] Example 1 Obtaining a mouse monoclonal antibody specific for CD47 by fusion hybridoma technology

[0054] 1.1 Animal immunization

[0055] Mice were immunized according to the commonly used method in the literature (E Harlow, D. Lane, Antibody: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1998), using recombinant human CD47 protein (Sino biological inc., cat# 12283-H02H) as the immunogen.

[0056] To increase the immune response, Freund's complete adjuvant and Freund's incomplete adjuvant (Sigma, St. Louis, Mo., USA) were used for the first immunization and booster immunization, respectively. Briefly, the preparation of the adjuvant-antigen mixture first involves gently mixing the adjuvant in a vial using a vortex method. The required amount of adjuvant is removed from the vial and placed in an autoclaved 1.5 mL microcentrifuge tube. The antigen is prepared in PBS or normal saline at a concentration of 0.5-1.0 mg / ml. The calculated amount of antigen is added to the microcentrifuge tube together with the adjuvant, gently stirred for 2 minutes, and the emulsification mixture is repeated to form an oil-in-water solution. The adjuvant-antigen solution is then drawn into an appropriate syringe for animal injection. Each animal is immunized, and then 2 to 3 booster immunizations are performed depending on the antiserum titer. Animals with good titers are given a final immunization by intraperitoneal injection before fusion.

[0057] 1.2 Hybridoma fusion and screening

[0058] Prior to cell fusion, mouse myeloma cells (SP2 / 0-Ag14, ATCC #CRL-1581) were cultured in the logarithmic growth phase. Immunized mice were sacrificed and spleens were removed under sterile conditions and fused with myeloma cells according to the method described by Kohler G and Milstein C in "Continuous cultures of fused cells secreting antibodies of predefined specificity," Nature, 256:495-497 (1975).

[0059] The fused "hybrid cells" are then plated into 96-well cell plates containing HAT culture medium. Viable hybridoma cells can typically be observed under a microscope 7-10 days after fusion. Two weeks after plating, the culture supernatant from each well is collected and hybridoma screening is performed using an ELISA assay using recombinant human CD47-his protein antigen. Briefly, ELISA plates are coated with human CD47-his protein (ACRO biosystems, cat#CD7-H5227, 2.0 μg / ml in PBS) at 4°C overnight. The plates are washed four times with PBST and then blocked with blocking buffer (PBST containing 5% nonfat dry milk). Diluted mouse immune serum (for determination of mouse serum titer) or hybridoma supernatant is added to each well and incubated at 37°C for 40 minutes. The plate was washed four times with PBST and detected with horseradish peroxidase-goat anti-mouse IgG (Jackson Immuno Research, cat# 115-036-071) and the absorbance of each well was measured at 450 nm. Positive hybridomas secreting antibodies that bind to human CD47-his were then selected and transferred to a 24-well plate.

[0060] Hybridoma clones producing antibodies that bind to human CD47 with high specificity and exhibit CD47 / SIRPα ligand blocking activity were subcloned by limiting dilution to ensure clonality of the cell line, followed by purification. Hybridoma clones producing antibodies with high specific cell surface CD47 FACS binding and CD47 / SIRPα ligand blocking activity were subcloned to ensure clonality of the cell line, followed by purification of monoclonal antibodies.

[0061] Example 2 Determination of the affinity of mouse anti-CD47 monoclonal antibodies using BIACORE surface plasmon resonance technology

[0062] The anti-CD47 mouse monoclonal antibodies (mAbs) produced by the hybridoma clones in Example 1 were subjected to affinity kinetic characterization using the Biacore T200 system (GE healthcare, Pittsburgh, PA, USA).

[0063] Briefly, goat anti-mouse IgG was covalently linked to a CM5 chip (carboxymethyl dextran coated chip) via primary amines using a standard amine coupling kit provided by Biacore. Unreacted portions of the biosensor surface were blocked with ethanolamine. The mouse anti-CD47 antibody produced in Example 1 was purified, and the reference antibodies CC-9000 (Celgene) and Hu5F9-G4 (Forty Seven) were flowed onto the chip at a concentration of 66.7 nM and a flow rate of 10 μL / min. Subsequently, recombinant human CD47-his protein (Acro biosystems, cat#CD7-H5227, MW: 15.6 kDa) or cynomolgus monkey CD47-his protein (Acro biosystems, cat#CD7-C52H1, MW: 15.8 kDa) in HBS EP buffer (provided by Biacore) was flowed onto the chip at a flow rate of 30 μL / min. Antigen-antibody binding kinetics were observed for 2 minutes, and dissociation kinetics were observed for 10 minutes. The Langmuir binding model curve with a binding and dissociation ratio of 1:1 was fitted using BIA evaluation software.

[0064] where k a ,k d and K D The values ​​of are shown in Table 1.

[0065] Table 1. Kinetic parameters of mouse anti-CD47 monoclonal antibody binding to human or cynomolgus monkey CD47 determined by Biacore

[0066]

[0067] The binding K of the monoclonal antibody 1D2 of the present invention to human CD47 D The values ​​were similar to those of the reference antibody, indicating that it has high affinity for human CD47.

[0068] Example 3 Study on Binding Activity of Mouse Anti-CD47 Monoclonal Antibodies

[0069] The mouse anti-CD47 monoclonal antibodies (mAbs) produced by the hybridoma clones in Example 1 were further tested for their binding activity using the following method.

[0070] 3.1 Determination of Antibody Binding Capacity Based on Capture ELSIA

[0071] A 96-well ELISA plate was coated with goat anti-mouse IgG Fcγ fragment-specific antibody (Jackson ImmunoResearch, #115-006-071, 100 μl / well) in PBS at a final concentration of 2 μg / ml and incubated overnight at 4°C. The plate was washed four times with elution buffer (PBS + 0.05% v / v Tween-20, PBST) and then blocked with 200 μl / well of 5% w / v skim milk powder in PBST at 37°C for 2 hours. The plate was washed again and incubated with 100 μl / well of various concentrations of CD47 mouse monoclonal antibody at 37°C for 40 minutes, followed by four additional washes. The microtiter plate containing the capture CD47 antibody was incubated with biotinylated human CD47 protein (ACRO Biosystems, cat#CD7-H5227) or monkey CYNO-CD47-HIS-BIO (ACROBiosystems, cat#CD7-C52H1) (60 nM, 2.5% nonfat dry milk in PBST buffer, 100 μl / well) at 37°C for 40 minutes. The plate was then washed four times and incubated with streptavidin-conjugated horseradish peroxidase (1:10,000 dilution in PBST, Jackson Immuno Research, #016-030-084, 100 μl / well) at 37°C for 40 minutes. After the final wash, the plate was incubated with 100 μl / well of the ELISA substrate TMB (Innoreagents, #TMB-S-002). The reaction was terminated within 15 minutes with 50 μl / well 1MH2SO4 at 25°C and the absorbance at 450 nm was measured. Figure 1-2 and Table 2.

[0072] Figure 1 and Figure 2 The results showed that the antibody 1D2 of the present invention has good binding ability to both human and cynomolgus monkey CD47 proteins.

[0073] 3.2 Flow cytometry (FACS) was used to determine the binding of CD47 monoclonal antibodies to 293F cells overexpressing human CD47

[0074] The stable cell line 293F, which overexpresses human CD47 on its surface, was collected from the cell culture flask, washed twice, and resuspended in PBS phosphate buffered saline (FACS buffer) containing 2% v / v fetal bovine serum. 2×10 5The cells were incubated on ice for 40 minutes with FACS buffer containing different concentrations of CD47 antibodies. The cells were washed three times with FACS buffer and 100 μL / well of R-Phycoerythrin affinity purified F(ab')2 fragment goat anti-mouse IgG specific F(ab')2 fragment (diluted 1:1000 with FACS buffer, Jackson Immunoresearch, cat#115-116-072) secondary antibody was added. After incubation at 4°C in the dark for 40 minutes, the cells were washed three times and then resuspended in FACS buffer. Fluorescence was measured using a Becton Dickinson FACS CantoII-HTS device. The data were analyzed using Graphpad Prism software to obtain the EC value of the antibody-bound cells. 50 The concentration value is the antibody concentration value corresponding to the maximum fluorescence binding signal of 50% when CD47 antibody binds to cells overexpressing CD47. The measurement results are shown in Figure 3 and Table 2.

[0075] Figure 3 The results showed that the antibody 1D2 of the present invention has a stronger ability to bind to 293F cells that overexpress human CD47 on their surface.

[0076] Table 2. Binding activity of mouse anti-CD47 antibodies

[0077]

[0078] Example 4 Competitive Functional Blockade of CD47-SIRPα Interaction by Mouse Anti-CD47 Monoclonal Antibodies

[0079] Competitive ELISA was used to detect the blocking ability of antibodies on CD47-SIRPα interaction.

[0080] 4.1 Ligand blocking ELISA

[0081] The ability of the anti-CD47 antibodies of the present invention to block the CD47-SIRPα interaction was tested using a competition ELISA. Briefly, human SIRPα-his protein (Sino Biological Inc., cat#11612-H08H) was added to a 96-well microplate at 200 ng / well and incubated overnight at 4°C. The next day, the plates were washed with wash buffer (PBS + 0.05% Tween-20, PBST) and blocked with PBST containing 5% w / v skim milk powder at 37°C for 2 hours. The plates were then washed again with wash buffer.

[0082] Dilute the CD47 antibody or reference antibody (antibody starts at 66.7nM and is diluted 4-fold continuously) with human CD47-biotin (ACRO biosystems, cat#CD7-H5227) solution, incubate at room temperature for 40 minutes, and then add the antibody / CD47-biotin mixture to the SIRPα-coated plate. After incubation at 37°C for 40 minutes, wash the plate 4 times with washing buffer. Then add streptavidin-conjugated HRP and incubate at 37°C for 40 minutes to detect the binding of biotin-labeled human CD47 to the bottom plate SIRPα. Wash the plate again with washing buffer. Finally, add TMB, stop the reaction with 1M H2SO4, and measure the absorbance at 450nm. Use GraphpadPrism software to analyze the data and obtain IC 50 For specific results, see Figure 4 and Table 3.

[0083] 4.2 Reference Antibody Blocking ELISA

[0084] The ability of the anti-CD47 antibodies of the present invention to block the binding of a reference antibody (Hu5F9-G4, Forty Seven) to human CD47 protein was determined using a competitive ELISA. Briefly, the CD47 reference antibody was coated onto a 96-well microplate with 1 μg / mL of PBS and incubated overnight at 4°C. The next day, the plate was washed with wash buffer and blocked with PBST containing 5% nonfat dry milk for 2 hours at 37°C. For blocking, biotinylated human CD47 (ACRO biosystems, cat#CD7-H5227) (10 nM in PBST containing 2.5% nonfat dry milk) was mixed with the antibody (1.2 pM to 100 nM, serially diluted 5-fold) and incubated at 25°C for 40 minutes. After washing, the antibody / human CD47-biotin mixture (100 μl / well) was added to the Hu5F9-G4 plate and incubated at 37°C for 40 minutes. The plate was washed again with wash buffer, and 100 μl / well of SA-HRP was added. The plate was then incubated at 37°C for 40 minutes to detect biotinylated human CD47 bound to the plate. A final wash was performed with wash buffer. TMB was added, and the reaction was terminated with 1 M H2SO4. The absorbance at 450 nm was measured. The data were analyzed using Graphpad Prism software to obtain the IC 50 For specific results, see Figure 5 and Table 3.

[0085] As can be seen from Table 3, the antibodies of the present invention are able to block the human CD47-SIRPα interaction, and also indicate that the antibodies of the present invention have similar antigen binding epitopes as the reference antibody. Compared with the reference antibody, the antibody 1D2 of the present invention has better CD47-SIRPα blocking activity.

[0086] Table 3. Ability of anti-CD47 antibodies to block CD47-SIRPα and CD47 reference antibody interactions

[0087]

[0088] Example 5 Mouse anti-CD47 monoclonal antibody induces macrophages to phagocytose tumor cells

[0089] An in vitro cell assay was used to detect the biological activity of anti-CD47 antibodies in inducing macrophage phagocytosis of tumor cells. Human peripheral blood mononuclear cells (PBMCs) were extracted from fresh human blood using Ficoll (GE Healthcare, 17-1440-02). To differentiate PBMCs into monocyte-derived macrophages (MDMs), monocytes were inoculated with RPMI 1640 + 10% FBS + 1% penicillin-streptomycin (Peprotech, 300-25-100) in the presence of human M-CSF. On days 2 and 4, cells were washed and replaced with fresh culture medium containing cytokines. On day 6, adherent cells were detached and washed twice with PBS.

[0090] MDMs were separated from the plate and placed in a 96-well plate overnight. Jurkat cells were collected for CFSE (5(6)-carboxyfluorescein N-hydroxysuccinimide ester) (Sigma, 87444) labeling. Anti-CD47 monoclonal antibody was diluted accordingly. 100uL of CFSE-labeled Jurkat tumor cells and diluted CD47 monoclonal antibody mixture were added to MDM and incubated at 37°C for 4h. All cells were separated and washed once with FACS buffer. Cells were stained with anti-human CD14 APC (eBioscience, 17-0149-42) and CD14+CFSE+ cells were detected by flow cytometry (FACS). Data (percentage of CD14+CFSE+ cells) were analyzed using Graphpad Prism software to obtain EC 50 The measurement results are shown in Table 4.

[0091] The results in Table 4 show that the antibodies of the present invention can induce macrophages to phagocytize tumor cells. 50 The values ​​were lower than those of the two reference antibodies, indicating a stronger tumor cell phagocytosis-promoting effect than the reference antibodies.

[0092] Table 4. Ability of anti-CD47 antibodies to induce macrophage phagocytosis of tumor cells

[0093]

[0094] Example 6 DNA cloning and sequencing, sequence analysis of anti-CD47 antibodies

[0095] Total RNA was extracted from the hybridoma cells of Example 1 using Trizol reagent (Invitrogen, catalog #15596-018).

[0096] The process is briefly described as follows: 5×10 6 Place the cells in a 1.5ml centrifuge tube and aspirate the supernatant. Add 1ml of Trizol reagent and pipette repeatedly several times, then place at 25℃ for 5 minutes to lyse the cells. Next, add 0.2ml of chloroform solution to each tube, shake vigorously for 15 seconds, and place at room temperature for 3 minutes. Then, centrifuge the tube at 4℃ and 12000g for 10 minutes, remove the centrifuge tube, aspirate the upper aqueous phase solution into a new 1.5ml centrifuge tube, and add 0.4ml of isopropanol to precipitate RNA from the aqueous phase. Manually mix the EP tube and place it at 25℃ for 10 minutes, then centrifuge at 4℃ and 12000g for 10 minutes, and discard the supernatant. Add 1ml of 75% ethanol, centrifuge again at 4℃ and 7500rpm for 5 minutes, and discard the supernatant. After the RNA precipitate at the bottom of the tube is dried at room temperature for 10 minutes, add 30 to 50ul of sterile DEPC-treated water to dissolve the RNA sample.

[0097] Next, total RNA was converted to cDNA using Taraka's Reverse Transcription cDNA Kit (catalog #6110A). The experimental system was prepared as follows: 5 μl of total RNA, 0.5 μl of Oligo(dT), and 8.5 μl of RNase-free water (14 μl total) were pre-denatured at 65°C for 5 minutes, followed by 2 minutes on ice. 4 μl of 5× buffer, 1 μl of dNTP mix, 0.5 μl of RNase inhibitor, and 1 μl of reverse transcriptase (20.5 μl total) were added, mixed, and incubated at 40°C for 50 minutes, followed by 70°C for 10 minutes to complete cDNA synthesis. The cDNA was further added with poly-G at the 3' end. The reaction system was prepared as follows: 5μl of cDNA sample + 33.5μl of ddH2O + 5μl of 10×TdT buffer + 5μl of CoCl2 + 1μl of dGTP + 0.5μl of terminal deoxynucleotidyl transferase (total volume 50ul), incubated at 37°C for 30 minutes, and then at 70°C for 10 minutes to complete the poly-G tailing.

[0098] Furthermore, the tailed cDNA was used as a template for gene amplification of the antibody variable region. For amplifying the antibody heavy chain variable region sequence, the PCR reaction system was prepared: 5 μl of 10× Taq enzyme buffer + 0.5 μl of universal poly C primer (forward primer) + 0.5 μl of mouse IgG1 reverse primer + 1 μl of dNTP + 1 μl of Taq polymerase + 1 μl of cDNA + 41 μl of ddH2O. For amplifying the antibody light chain variable region sequence, the PCR reaction system was prepared: 5 μl of 10× Taq enzyme buffer + 0.5 μl of universal poly C primer (forward primer) + 0.5 μl of mouse IgG kappa chain reverse primer + 1 μl of dNTP + 1 μl of Taq polymerase + 1 μl of cDNA + 41 μl of ddH2O. The temperature cycle for PCR amplification of the antibody heavy and light chain variable regions is as follows (steps 2 to 4 are repeated 25 cycles):

[0099] 1) Pre-denaturation at 95°C for 5 min;

[0100] 2) Denaturation at 95°C for 20 seconds;

[0101] 3) Annealing at 56°C for 20 seconds;

[0102] 4) Extension at 72°C for 30 seconds;

[0103] 5) Store at 25°C for 60 minutes.

[0104] The PCR products were analyzed by 1% agarose gel electrophoresis, and DNA segments of corresponding sizes were cut out (VH approximately 600 bp, VK approximately 500 bp). DNA was extracted using the QIAquick Gel DNA Recovery Kit (catalog #28704). The procedure is as follows: the gel was weighed, 3 times the volume of QG buffer was added, and then incubated at 50°C for 10 minutes until the gel was completely dissolved. After adding 1 times the volume of isopropanol to mix, the sample was transferred to a QIA purification column and centrifuged at 13,000 rpm for 1 minute. 750 μl of PE buffer was added to the column, and then centrifuged at 13,000 rpm for 1 minute. The residual liquid in the column was removed by centrifugation again at 13,000 rpm. 30 μl of water was added and centrifuged at 13,000 rpm for 1 minute for elution to obtain the prepared DNA sample. The purified PCR product was sequenced to obtain the variable region sequence of the antibody.

[0105] The sequence information of the clones of the present invention is shown in Table 5.

[0106] Table 5. Sequence information of anti-CD47 antibodies

[0107]

[0108] NA: nucleotide; AA: amino acid Sequence Listing <110> BioScience Biotechnology (Nanjing) Co., Ltd. <120> A monoclonal antibody capable of inducing macrophages to phagocytose cancer cells, and its preparation method and application <160> 20 <170> SIPOSequenceListing 1.0 <210> 1 <211> twenty four <212> DNA <213> Artificial Sequence <400> 1 ggatataaat tcactgacta caat 24 <210> 2 <211> 8 <212> PRT <213> Artificial Sequence <400> 2 Gly Tyr Lys Phe Thr Asp Tyr Asn 1 5 <210> 3 <211> twenty four <212> DNA <213> Artificial Sequence <400> 3 atttatcctt ataatattag tagt 24 <210> 4 <211> 8 <212> PRT <213> Artificial Sequence <400> 4 Ile Tyr Pro Tyr Asn Ile Ser Ser 1 5 <210> 5 <211> 30 <212> DNA <213> Artificial Sequence <400> 5 gcaagggggg gctggagggc tatggactac 30 <210> 6 <211> 10 <212> PRT <213> Artificial Sequence <400> 6 Ala Arg Gly Gly Trp Arg Ala Met Asp Tyr 1 5 10 <210> 7 <211> 351 <212> DNA <213> Artificial Sequence <400> 7 gaggtccagc ttcagcagtc aggacctgag ctggtgaaac ctggggcctc agtgaggata 60 tcctgcaaga cttctggata taaattcact gactacaata tacactgggt gaagcagagc 120 catggaaaga gccttgaata tattggatat atttatcctt ataatattag tagtgcctac 180 aaccagaagt tcaagagcaa ggccacagtg actgtagaca attcctccag cacatcctac 240 atggaactcc gcagcctgac atctgaggac tctgcagtct attactgtgc aagggggggc 300 tggagggcta tggactactg gggtcaagga acctcagtca ccgtctcctc a 351 <210> 8 <211> 117 <212> PRT <213> Artificial Sequence <400> 8 Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala 1 5 10 15 Ser Val Arg Ile Ser Cys Lys Thr Ser Gly Tyr Lys Phe Thr Asp Tyr 20 25 30 Asn Ile His Trp Val Lys Gln Ser His Gly Lys Ser Leu Glu Tyr Ile 35 40 45 Gly Tyr Ile Tyr Pro Tyr Asn Ile Ser Ser Ala Tyr Asn Gln Lys Phe 50 55 60 Light Ser Light Ala Thr Val Thr Val Asp Asn Ser Ser Ser Thr Ser Tyr 65 70 75 80 Met Glu Leu Arg Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Gly Gly Trp Arg Ala Met Asp Tyr Trp Gly Gln Gly Thr Ser 100 105 110 Val Thr Val Ser Ser 115 <210> 9 <211> 1323 <212> DNA <213> Artificial Sequence(Artificial Sequence) <400> 9 gaggtccagc ttcagcagtc aggacctgag ctggtgaaac ctggggcctc agtgaggata 60 tcctgcaaga cttctggata taaattcact gactacaata tacactgggt gaagcagagc 120 catggaaaga gccttgaata tattggatat atttatcctt ataatattag tagtgcctac 180 aaccagaagt tcaagagcaa ggccacagtg actgtagaca attcctccag cacatcctac 240 atggaactcc gcagcctgac atctgaggac tctgcagtct attactgtgc aagggggggc 300 tggagggcta tggactactg gggtcaagga acctcagtca ccgtctcctc agccaaaacg 360 acacccccat ctgtctatcc actggcccct ggatctgctg cccaaactaa ctccatggtg 420 accctgggat gcctggtcaa gggctatttc cctgagccag tgacagtgac ctggaactct 480 ggatccctgt ccagcggtgt gcacaccttc ccagctgtcc tgcagtctga cctctacact 540 ctgagcagct cagtgactgt cccctccagc acctggccca gcgagaccgt cacctgcaac 600 gttgcccacc cggccagcag caccaaggtg gacaagaaaa ttgtgcccag ggattgtggt 660 tgtaagcctt gcatatgtac agtcccagaa gtatcatctg tcttcatctt ccccccaaag 720 cccaaggatg tgctcaccat tactctgact cctaaggtca cgtgtgttgt ggtagacatc 780 agcaaggatg atcccgaggt ccagttcagc tggtttgtag atgatgtgga ggtgcacaca 840 gctcagacgc aaccccggga ggagcagttc aacagcactt tccgctcagt cagtgaactt 900 cccatcatgc accaggactg gctcaatggc aaggagttca aatgcagggt caacagtgca 960 gctttccctg cccccatcga gaaaaccatc tccaaaacca aaggcagacc gaaggctcca 1020 caggtgtaca ccattccacc tcccaaggag cagatggcca aggataaagt cagtctgacc 1080 tgcatgataa cagacttctt ccctgaagac attactgtgg agtggcagtg gaatgggcag 1140 ccagcggaga actacaagaa cactcagccc atcatggaca cagatggctc ttacttcgtc 1200 tacagcaagc tcaatgtgca gaagagcaac tgggaggcag gaaatacttt cacctgctct 1260 gtgttacatg agggcctgca caaccaccat actgagaaga gcctctccca ctctcctggt 1320 aaa 1323 <210> 10 <211> 441 <212> PRT <213> Artificial Sequence <400> 10 Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala 1 5 10 15 Ser Val Arg Ile Ser Cys Lys Thr Ser Gly Tyr Lys Phe Thr Asp Tyr 20 25 30 Asn Ile His Trp Val Lys Gln Ser His Gly Lys Ser Leu Glu Tyr Ile 35 40 45 Gly Tyr Ile Tyr Pro Tyr Asn Ile Ser Ser Ala Tyr Asn Gln Lys Phe 50 55 60 Light Ser Light Ala Thr Val Thr Val Asp Asn Ser Ser Ser Thr Ser Tyr 65 70 75 80 Met Glu Leu Arg Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Gly Gly Trp Arg Ala Met Asp Tyr Trp Gly Gln Gly Thr Ser 100 105 110 Val Thr Val Ser Ser Ala Lys Thr Thr Pro Pro Ser Val Tyr Pro Leu 115 120 125 Ala Pro Gly Ser Ala Ala Gln Thr Asn Ser Met Val Thr Leu Gly Cys 130 135 140 Leu Val Lys Gly Tyr Phe Pro Glu Pro Val Thr Val Thr Trp Asn Ser 145 150 155 160 Gly Ser Leu Ser Ser Gly Val His Thr Phe Pro Ala Val Leu Gln Ser 165 170 175 Asp Leu Tyr Thr Leu Ser Ser Ser Val Thr Val Pro Ser Ser Thr Trp 180 185 190 Pro Ser Glu Thr Val Thr Cys Asn Val Ala His Pro Ala Ser Ser Thr 195 200 205 Lys Val Asp Lys Lys Ile Val Pro Arg Asp Cys Gly Cys Lys Pro Cys 210 215 220 Ile Cys Thr Val Pro Glu Val Ser Ser Val Phe Ile Phe Pro Pro Lys 225 230 235 240 Pro Lys Asp Val Leu Thr Ile Thr Leu Thr Pro Lys Val Thr Cys Val 245 250 255 Val Val Asp Ile Ser Lys Asp Asp Pro Glu Val Gln Phe Ser Trp Phe 260 265 270 Val Asp Asp Val Glu Val His Thr Ala Gln Thr Gln Pro Arg Glu Glu 275 280 285 Gln Phe Asn Ser Thr Phe Arg Ser Val Ser Glu Leu Pro Ile Met His 290 295 300 Gln Asp Trp Leu Asn Gly Lys Glu Phe Lys Cys Arg Val Asn Ser Ala 305 310 315 320 Ala Phe Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Thr Lys Gly Arg 325 330 335 Pro Lys Ala Pro Gln Val Tyr Thr Ile Pro Pro Pro Lys Glu Gln Met 340 345 350 Ala Lys Asp Lys Val Ser Leu Thr Cys Met Ile Thr Asp Phe Phe Pro 355 360 365 Glu Asp Ile Thr Val Glu Trp Gln Trp Asn Gly Gln Pro Ala Glu Asn 370 375 380 Tyr Lys Asn Thr Gln Pro Ile Met Asp Thr Asp Gly Ser Tyr Phe Val 385 390 395 400 Tyr Ser Lys Leu Asn Val Gln Lys Ser Asn Trp Glu Ala Gly Asn Thr 405 410 415 Phe Thr Cys Ser Val Leu His Glu Gly Leu His Asn His His Thr Glu 420 425 430 Lys Ser Leu Ser His Ser Pro Gly Lys 435 440 [[ID= 29]]<210> 11 <211> 48 <212> DNA <213> Artificial Sequence <400> 11 agatctagtc agaacattgt ccatactaat ggatacacct atttagcg 48 <210> 12 <211> 16 <212> PRT <213> Artificial Sequence <400> 12 Arg Ser Ser Gln Asn Ile Val His Thr Asn Gly Tyr Thr Tyr Leu Ala 1 5 10 15 <210> 13 <211> twenty one <212> DNA <213> Artificial Sequence <400> 13 aaggtttcca accgattttc t 21 <210> 14 <211> 7 <212> PRT <213> Artificial Sequence <400> 14 Lys Val Ser Asn Arg Phe Ser 1 5 <210> 15 <211> 27 <212> DNA <213> Artificial Sequence <400> 15 tttcaaggtt cacatgttcc gtggacg 27 <210> 16 <211> 9 <212> PRT <213> Artificial Sequence <400> 16 Phe Gln Gly Ser His Val Pro Trp Thr 1 5 <210> 17 <211> 336 <212> DNA <213> Artificial Sequence <400> 17 gctgttttga tgacccaaag tccactctcc ctgcctgtca gtcttggaga tcaagcctcc 60 ctgttttgatgacccaaagtccactctccctgcctgtcagtcttggagatcaagcctcc 60 ctctcttgca gatctagtca gaacattgtc catactaatg gatacaccta tttagcgtgg 120 ctctcttgca gatctagtca gaacattgtc catactaatg gatacaccta tttagcgtgg 120 tacctgcaga ggccaggcca gtctccaaag ctcctgatct acaaggtttc caaccgattt 180 tacctgcagaggccaggccagtctccaaagctcctgatctacaaggtttc caaccgattt 180 tctggggtcc cagacaggtt cagtggcagt ggatcaggga cagatttcac actcaggatc 240 tctggggtcc cagacaggtt cagtggcagt ggatcaggga cagatttcac actcaggatc 240 agcagagtgg aggctgagga tctgggagtt tattactgct ttcaaggttc acatgttccg 300 agcagagtggaggctgaggatctgggagtttattactgctttcaaggttcacatgttccg 300 tggacgttcg gtggaggcac caagctggaa atcaaa 336 tggacgttcg gtggaggcaccaagctggaaatcaaa 336 <210> 18 <211> 112 <212> PRT <213> Artificial Sequence <400> 18 Ala Val Leu Met Thr Gln Ser Pro Leu Ser Leu Pro Val Ser Leu Gly Ala Val Leu Met Thr Gln Ser Pro Leu Ser Leu Pro Val Ser Leu Gly 1 5 10 15 Asp Gln Ala Ser Leu Ser Cys Arg Ser Ser Gln Asn Ile Val His Thr Asp Gln Ala Ser Leu Ser Cys Arg Ser Ser Gln Asn Ile Val His Thr 20 25 30 Asn Gly Tyr Thr Tyr Leu Ala Trp Tyr Leu Gln Arg Pro Gly Gln Ser Asn Gly Tyr Thr Tyr Leu Ala Trp Tyr Leu Gln Arg Pro Gly Gln Ser 35 40 45 Pro Lys Leu Leu Ile Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro Pro Lys Leu Leu Ile Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro 50 55 60 Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Arg Ile 65 70 75 80 Ser Arg Val Glu Ala Glu Asp Leu Gly Val Tyr Tyr Cys Phe Gln Gly 85 90 95 Ser His Val Pro Trp Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys 100 105 110 <210> 19 <211> 657 <212> DNA <213> Artificial Sequence <400> 19 gctgttttga tgacccaaag tccactctcc ctgcctgtca gtcttggaga tcaagcctcc 60 ctctcttgca gatctagtca gaacattgtc catactaatg gatacaccta tttagcgtgg 120 tacctgcaga ggccaggcca gtctccaaag ctcctgatct acaaggtttc caaccgattt 180 tctggggtcc cagacaggtt cagtggcagt ggatcaggga cagatttcac actcaggatc 240 agcagagtgg aggctgagga tctgggagtt tattactgct ttcaaggttc acatgttccg 300 tggacgttcg gtggaggcac caagctggaa atcaaacggg ctgatgctgc accaactgta 360 tccatcttcc caccatccag tgagcagtta acatctggag gtgcctcagt cgtgtgcttc 420 ttgaacaact tctaccccaa agacatcaat gtcaagtgga agattgatgg cagtgaacga 480 caaaatggcg tcctgaacag ttggactgat caggacagca aagacagcac ctacagcatg 540 agcagcaccc tcacgttgac taaggacgag tatgaacgac ataacagcta tacctgtgag 600 gccactcaca agacatcaac ttcacccatt gtcaagagct tcaacagggg agagtgt 657 <210> 20 <211> 219 <212> PRT <213> Artificial Sequence <400> 20 Ala Val Leu Met Thr Gln Ser Pro Leu Ser Leu Pro Val Ser Leu Gly 1 5 10 15 Asp Gln Ala Ser Leu Ser Cys Arg Ser Ser Gln Asn Ile Val His Thr 20 25 30 Asn Gly Tyr Thr Tyr Leu Ala Trp Tyr Leu Gln Arg Pro Gly Gln Ser 35 40 45 Pro Lys Leu Leu Ile Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro 50 55 60 Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Arg Ile 65 70 75 80 Ser Arg Val Glu Ala Glu Asp Leu Gly Val Tyr Tyr Cys Phe Gln Gly 85 90 95 Ser His Val Pro Trp Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys 100 105 110 Arg Ala Asp Ala Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu 115 120 125 Gln Leu Thr Ser Gly Gly Ala Ser Val Val Cys Phe Leu Asn Asn Phe 130 135 140 Tyr Pro Lys Asp Ile Asn Val Lys Trp Lys Ile Asp Gly Ser Glu Arg 145 150 155 160 Gln Asn Gly Val Leu Asn Ser Trp Thr Asp Gln Asp Ser Lys Asp Ser 165 170 175 Thr Tyr Ser Met Ser Ser Thr Leu Thr Leu Thr Lys Asp Glu Tyr Glu 180 185 190 Arg His Asn Ser Tyr Thr Cys Glu Ala Thr His Lys Thr Ser Thr Ser 195 200 205 Pro Ile Val Lys Ser Phe Asn Arg Gly Glu Cys 210 215

Claims

1. A monoclonal antibody capable of inducing macrophages to phagocytose cancer cells, characterized in that: The antibody comprises a heavy chain variable region and a light chain variable region; The heavy chain variable region comprises CDR-H1, CDR-H2 and CDR-H3, and the light chain variable region comprises CDR-L1, CDR-L2 and CDR-L3; The amino acid sequence of the CDR-H1 is shown in SEQ ID NO: 2; The amino acid sequence of the CDR-H2 is shown in SEQ ID NO: 4; The amino acid sequence of the CDR-H3 is shown in SEQ ID NO: 6; The amino acid sequence of the CDR-L1 is shown in SEQ ID NO: 12; The amino acid sequence of the CDR-L2 is shown in SEQ ID NO: 14; The amino acid sequence of the CDR-L3 is shown in SEQ ID NO:

16.

2. The monoclonal antibody capable of inducing macrophages to phagocytose cancer cells according to claim 1, wherein: The amino acid sequence of the heavy chain variable region is shown in SEQ ID NO: 8; the amino acid sequence of the light chain variable region is shown in SEQ ID NO:

18.

3. The monoclonal antibody capable of inducing macrophages to phagocytose cancer cells according to claim 1, wherein: The heavy chain amino acid sequence is shown in SEQ ID NO: 10; the light chain amino acid sequence is shown in SEQ ID NO:

20.

4. A nucleic acid molecule, characterized in that The nucleic acid molecule encodes the monoclonal antibody according to any one of claims 1 to 3.

5. The nucleic acid molecule according to claim 4, wherein The sequence of the nucleic acid molecule includes SEQ ID NO: 7 and SEQ ID NO: 17; The sequence SEQ ID NO: 7 encodes the heavy chain variable region of the antibody; The sequence SEQ ID NO: 17 encodes the light chain variable region of the antibody.

6. An expression vector, characterized in that The expression vector contains the nucleic acid molecule according to claim 4 or 5.

7. A host cell, characterized in that The host cell contains the expression vector according to claim 6.

8. The method for preparing the monoclonal antibody capable of inducing macrophages to phagocytose cancer cells according to any one of claims 1 to 3, wherein: The following steps are included: preparing an expression vector containing a nucleic acid molecule expressing the monoclonal antibody; The obtained expression vector is transfected into eukaryotic host cells and cultured; The monoclonal antibody that can induce macrophages to phagocytize cancer cells is isolated and purified.

9. A pharmaceutical composition comprising the monoclonal antibody according to any one of claims 1 to 3.

Images