A kit for liver failure disease outcome prognosis evaluation and application and application method

Abstract

This invention discloses a kit, its application, and its method for evaluating the prognostic outcome of liver failure. The invention analyzes the correlation between high-throughput transcriptome sequencing and disease outcome (death, survival), and verifies the results using qPCR. The results show that VSIG4 is specifically highly expressed in patients with poor liver failure outcomes (death) and has a strong, stable, and reliable correlation with the outcome (death, survival). The kit's detection process is simple, reproducible, and can be performed by qualified technicians, making it highly feasible. It provides accurate early warning and prediction results for liver failure outcomes, promptly reflecting the disease status of liver failure patients. This allows for early warning and prediction of liver failure outcomes, guiding physicians in developing targeted treatment plans, enabling early treatment, and reducing short-term mortality.

Description

Technical Field

[0001] This invention relates to the fields of clinical medicine, biomedicine, and medical testing technology. Specifically, it relates to a reagent kit, its application, and its application method for evaluating the prognosis of liver failure. Background Technology

[0002] Liver failure is a complex syndrome caused by multiple factors (such as viruses, alcohol, and drugs) leading to massive hepatocyte necrosis, resulting in severe liver dysfunction or decompensation, and manifesting primarily as coagulation disorders, jaundice, hepatic encephalopathy, and ascites. Due to the lack of effective treatment, the short-term mortality rate with comprehensive medical treatment is as high as 50-90%. Currently, the clinical diagnosis of liver failure and assessment of disease prognosis involves a comprehensive analysis of the characteristics of various types of liver failure combined with biochemical indicators. For example, testing alanine aminotransferase (ALT), aspartate aminotransferase (AST), and total bilirubin is used to assess the degree of liver function impairment and the liver's reserve capacity; while testing the international normalized ratio (INR) and prothrombin activity is used to assess coagulation function. The prognosis of liver failure depends on the balance between the degree of hepatocyte necrosis and regenerative capacity. If hepatocyte regeneration exceeds necrosis, the disease gradually recovers; conversely, the condition worsens, and the prognosis is poor. However, due to the diversity and individual differences in the causes, etiologies, clinical types, course, complications, and clinical interventions of liver failure, there are currently no unified indicators for assessing prognosis. Therefore, finding biomarkers for early warning and prediction of liver failure outcomes is of great significance for enabling early treatment and reducing the high short-term mortality rate of liver failure.

[0003] With the development of biotechnology and molecular medicine, techniques using molecular biology methods to detect changes in the structure or expression levels of genetic material in patients to make disease diagnoses and predict prognoses have been widely used in clinical practice. These techniques include detecting various structural proteins, enzymes, antigens and antibodies, and immune-active molecular genes related to diseases, enabling early diagnosis and predictive warnings of disease progression, and improving treatment outcomes. Currently, molecular diagnostics mainly focuses on detecting specific, relatively short DNA or RNA fragments. Among these, the expression level of mRNA varies with individual pathophysiological changes, providing a more real-time reflection of the patient's current disease status and progression trend.

[0004] Our research group discovered that VSIG4 plays a crucial role in different stages of liver failure, including its occurrence, development, and outcome, participating in core functions related to disease progression and outcome, such as its close association with multiple biological pathways including immunity, apoptosis, and metabolism. We also found that VSIG4 is highly expressed in patients with poor short-term outcomes (death) of liver failure, and its expression level differs significantly from that in patients with good short-term outcomes (survival). Therefore, VSIG4 can serve as a specific indicator for predicting the outcome of liver failure and has potential application value. Summary of the Invention

[0005] This invention aims to address at least one of the technical problems existing in the prior art. To this end, it provides a molecular biomarker for liver failure, VSIG4, with good prognostic value, and a kit for quantitatively detecting VSIG4, which can be used for early warning and prediction of the outcome of liver failure.

[0006] To achieve the above objectives, high-throughput transcriptome sequencing was performed on clinical samples (peripheral blood mononuclear cells) from patients with liver failure, and its correlation with disease outcome (death, survival) was analyzed. The results showed that VSIG4 was highly expressed in patients with poor short-term outcomes (death) of liver failure, and its expression level differed significantly from that in patients with good short-term outcomes (survival). Real-time quantitative PCR (qRT-PCR) further confirmed that the expression level of VSIG4 molecule differed significantly among patients with different outcomes (death, survival) of liver failure, and it can serve as a molecular biomarker for prognostic evaluation of liver failure. This invention provides a molecular biomarker for liver failure with good prognostic value, the biomarker containing the VSIG4 molecule, and its specific real-time quantitative PCR primer pair sequence is shown below:

[0007] SEQ ID NO.1: Preprime TCCTGGAAGTGCCAGAGAGT;

[0008] SEQ ID NO.2: Back primer CTTTGCCTGCTGGATATGGT;

[0009] The technical solution adopted in this invention is as follows:

[0010] This invention discloses the application of the biomarker VSIG4 molecule in the preparation of a prognostic reagent for liver failure.

[0011] As a further improvement, the prognosis described in this invention includes predicting the short-term survival and mortality of patients with liver failure.

[0012] As a further improvement, the reagent of the present invention determines the prognostic effect of liver failure by detecting the content of the VSIG4 molecular marker for liver failure prognosis in clinical samples such as cells, tissues or body fluids.

[0013] As a further improvement, the reagents described in this invention can be used to quantitatively detect the expression level of VSIG4 molecules in clinical samples of cells, tissues or body fluids by sequencing and qRT-PCR.

[0014] The present invention also discloses a kit for evaluating the prognosis of liver failure, the kit containing a detection reagent for detecting the expression level of VSIG4 molecules.

[0015] As a further improvement, the detection reagent of the present invention is a real-time quantitative PCR primer. The primer has the sequence shown in SEQ ID NO. 1 (front primer) and SEQ ID NO. 2 (back primer); it also includes a threshold of 15 related to the expression level of VSIG4 molecules.

[0016] As a further improvement, the steps for predicting the prognosis of liver failure using the kit described in this invention are as follows:

[0017] 1) The patient kit detects the expression level of VSIG4 molecules in clinical samples such as cells, tissues, or body fluids;

[0018] 2) When the detected VSIG4 molecule expression level is greater than 15, the patient is predicted to be at high risk of short-term death.

[0019] As a further improvement, the detection reagent of the present invention comprises:

[0020] 1) Primer pairs for amplifying VSIG4 as shown in SEQ ID NO.1 (front primer) and SEQ ID NO.2 (back primer); and / or

[0021] 2) Reagents for reverse transcription of mRNA and reagents for specific PCR amplification of the reverse transcription products, including: 2.5 U / μL PolyA polymerase, reverse transcriptase, 5× reverse transcription buffer, RNase-free water; and / or

[0022] 3) Internal reference primer pairs as shown in SEQ ID NO. 3 (front primer) and SEQ ID NO. 4 (back primer); and / or

[0023] 4) Necessary solvents for PCR experiments and reagents for amplifying nucleic acids and extracting RNA, including: 2×qPCR mixture, serum lysis buffer, 70% ethanol, chloroform, washing buffer, and anhydrous ethanol.

[0024] This invention also discloses a method for applying a reagent kit for evaluating the prognostic outcome of liver failure, comprising:

[0025] 1) RNA extraction is performed on the required test samples;

[0026] 2) Mix 1 ng-100 μg of RNA sample with 0.01-10 μL of reverse transcriptase and 0.01-10 μL of RT mixture, and then perform reverse transcription;

[0027] 3) The obtained cDNA product is thoroughly mixed with 0.2 μL PolyA polymerase, 0.01-10 μL qPCR mixture, and then PCR amplification is performed.

[0028] As a further improvement, the PCR amplification conditions described in this invention are as follows: RNA extracted from the detection sample, 0.01-10 μL of reverse transcriptase, 0.01-10 μL of RT mixture, 0.01-10 μL of PolyA polymerase, and 0.01-100 μL of qPCR mixture; the detection sample for the disease is a cell sample, tissue sample, or body fluid sample. The cell sample for disease detection is a peripheral blood mononuclear cell sample; the tissue sample for disease detection is a liver tissue sample; the body fluid sample for disease detection is preferably a blood sample, and the blood sample for disease detection is a serum sample or a plasma sample.

[0029] This invention provides VSIG4, a prognostic biomarker for liver failure, and its applications. It includes a VSIG4 detection kit and its use for prognostic evaluation of liver failure outcomes. The detection method is characterized by high sensitivity, strong specificity, and low cost, and is simple and rapid to operate, providing a reliable basis for prognostic evaluation of liver failure patients. The detection kit of this invention was used to detect peripheral blood mononuclear cell samples collected from over eighty liver failure patients, and the relationship between VSIG4 expression levels in these peripheral blood mononuclear cells and prognosis was analyzed. The results showed that the mortality rate of patients with high VSIG4 expression was significantly higher than that of patients with low VSIG4 expression. The results indicate that the detection kit of this invention can predict the outcome of liver failure patients by detecting the VSIG4 expression level in samples, providing reference data for the formulation of further treatment plans.

[0030] Specifically, the beneficial effects of the present invention are as follows:

[0031] 1. This invention analyzed the correlation between high-throughput transcriptome sequencing and disease outcome (death, survival), and verified the results using qPCR. The results showed that VSIG4 was specifically highly expressed in patients with poor outcomes (death) of liver failure, and had a strong and reliable correlation with the disease outcome (death, survival) of liver failure.

[0032] 2. The VSIG4 detection kit of the present invention for evaluating the prognosis of liver failure can detect various samples, such as cell samples, tissue samples, body fluid samples, etc. It is easy to extract, minimally invasive, and highly operable.

[0033] 3. The VSIG4 detection kit method for evaluating the prognosis of liver failure is simple, the detection process is simple and easy to repeat, and it can be completed by qualified technical personnel, making it highly feasible.

[0034] 4. The VSIG4 detection kit for evaluating the prognosis of liver failure can provide accurate early warning and prediction results of liver failure, reflect the disease status of liver failure patients in a timely manner, realize early warning and prediction of the disease outcome of liver failure patients, and guide doctors to formulate targeted treatment plans, achieve early treatment, and reduce short-term mortality. Attached Figure Description

[0035] Figure 1 This is a graph showing the expression of VSIG4 mRNA in peripheral blood mononuclear cell transcriptome sequencing data in the short-term poor outcome (death) group (n=8) and the short-term good outcome (survival) group (n=12) of liver failure.

[0036] Figure 2 This is the differentiation of patients with different outcomes (death, survival) in liver failure based on VSIG4 mRNA peripheral blood mononuclear cell transcriptome sequencing data;

[0037] Figure 3 This is a comparison chart showing the results of qRT-PCR validation of VSIG4 mRNA in peripheral blood mononuclear cells in the group with poor short-term outcome (death) of liver failure (n=26) and the group with good short-term outcome (survival) of liver failure (n=57).

[0038] Figure 4 This is the differentiation of patients with different outcomes (death, survival) in liver failure based on VSIG4 mRNA peripheral blood mononuclear cell qRT-PCR data;

[0039] Figure 5 This is a distribution map of VSIG4 mRNA peripheral blood mononuclear cell qRT-PCR data in patients with different outcomes (death, survival) of liver failure;

[0040] Figure 6 This is a comparison chart of VSIG4 detection results in the liver failure group, cirrhosis group, and normal control group in a rat model. Detailed Implementation

[0041] The present invention will be further described below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Furthermore, it should be understood that after reading the description of this invention, those skilled in the art can make various alterations or modifications to the invention, and these equivalent forms also fall within the scope defined by the appended claims.

[0042] The experimental method of this invention includes:

[0043] 1. Based on a multicenter, prospective cohort study of liver failure, peripheral blood mononuclear cells were collected from patients with different outcomes (death, survival) of liver failure. Transcriptome data were established using high-throughput transcriptome sequencing, and the correlation between transcriptome data and disease outcome (death, survival) was analyzed. The results showed that VSIG4, a molecule with significantly different expression levels, was found in patients with different outcomes of liver failure.

[0044] 2. qPCR validation was performed on peripheral blood mononuclear cells from patients with different short-term outcomes (death and survival) of liver failure, confirming that VSIG4 was specifically highly expressed in the group with poor short-term outcomes (death) of liver failure.

[0045] 3. The manufacturing process and operation procedure of the VSIG4 molecular quantitative detection kit are mainly based on PCR technology. Through Experiments 1 and 2, VSIG4 molecules were screened as a specific indicator for predicting different outcomes (death, survival) in patients with liver failure. Through Experiment 2, the primer pairs for VSIG4 amplification were selected as shown in SEQ ID NO.1 (front primer) and SEQ ID NO.2 (back primer), and the internal control primer pairs were shown in SEQ ID NO.7 (front primer) and SEQ ID NO.8 (back primer).

[0046] The technical solution of the present invention will be further described below through specific embodiments:

[0047] Example 1

[0048] Experimental methods

[0049] I. Isolation of peripheral blood mononuclear cells

[0050] 1. Draw 8 mL of whole blood from the patient, let it stand for about 30 minutes, and then pre-cool it to 4°C using a centrifuge.

[0051] 2. Centrifuge using a density gradient centrifuge at 4°C and 3500 rpm for 10 minutes. Resuspend the blood cell pellet thoroughly in 5 mL of sterile 0.1M PBS buffer, mix well, and slowly add the resulting blood cell suspension to a centrifuge tube containing Ficoll-paque™ PLUS medium lymphocyte separation medium, allowing it to naturally separate into layers. Set the centrifuge temperature to 20°C, the rotation speed to 2500 rpm, with an acceleration of 9 and a deceleration of 1, and centrifuge for 20 minutes.

[0052] 3. Aspirate the middle white membrane layer, add 10 mL of PBS buffer, centrifuge at 1400 rpm for 4 minutes at 4°C, and discard the supernatant. Repeat this step 3 times.

[0053] 4. Use a pipette to remove any remaining PBS buffer, and add 1 mL of TRIzol cell lysis buffer to completely lyse the cells.

[0054] II. Total mRNA Extraction

[0055] 1. Centrifuge the PBMCs-TRIzol sample at 3000 rpm for 3 minutes at 4℃, then add 200 μL of chloroform, shake vigorously to mix, and let stand for 5 minutes to allow it to separate into layers naturally.

[0056] 2. Centrifuge the above sample at 12,000 rpm for 15 minutes at 4°C, then remove it and aspirate approximately 400 μL of the supernatant into another clean 1.5 mL centrifuge tube. Add 500 μL of isopropanol, slowly invert to mix until a clear liquid is obtained, and let stand for 10 minutes.

[0057] 3. Centrifuge the above sample at 12,000 rpm for 10 minutes at 4°C, then remove and discard the supernatant. Add 1 mL of 75% ethanol solution and gently blow away the white, feathery precipitate.

[0058] 4. Centrifuge the above sample at 4℃ and 7500 rpm for 5 minutes, then remove it and discard the supernatant.

[0059] 5. After centrifuging the above sample at 4℃ and 7500 rpm for 5 minutes, remove it and aspirate the supernatant with a pipette.

[0060] 7. Add 30 μL of DEPC aqueous solution to mRNA.

[0061] III. High-throughput transcriptome sequencing

[0062] 1. RNA quality control: Take 1 μL of RNA solution and quantify it using a Nanodrop instrument.

[0063] 2. Based on the quantitative results from the Nanodrop instrument, take 500 ng of 1% agarose gel electrophoresis for detection.

[0064] 3. Perform ds cDNA synthesis, end completion, A addition, adapter addition, PCR enrichment, and Qubit quantification sequentially.

[0065] 4. Cluster generation: After diluting to 10 nM, take 4 μL of the 10 nM library, add 1 μL of 2N NaOH, add 15 μL of Tris.Cl, mix well, and let stand at room temperature for 5 min; take 6 μL of the above solution and add 994 μL of cold hybridization buffer; take 140 μL of the above solution, place it in an 8-tube strip, and put it in the template section of cBot; start the cBot instrument to begin cluster generation.

[0066] 5. Illumina Hiseq2500 sequencing

[0067] Figure 1This is a comparison chart of peripheral blood mononuclear cell sequencing data from the group with poor short-term prognosis (death) of liver failure (n=8) and the group with good short-term prognosis (survival) of liver failure (n=12); the VSIG4 mRNA that was characteristically highly expressed in the group with poor short-term prognosis (death) of liver failure was obtained through analysis. Figure 2 This is the differentiation of patients with different outcomes (death, survival) in liver failure based on VSIG4 mRNA peripheral blood mononuclear cell transcriptome sequencing data;

[0068] Example 2

[0069] The expression of VSIG4 molecules was detected by real-time quantitative PCR (qRT-PCR) in the group with poor short-term outcome (death) and the group with good short-term outcome (survival) of liver failure.

[0070] VSIG4 primer pair sequence design and screening: Based on the principles that the homology between the primer and the non-specific amplification sequence does not exceed 70% or there are 8 consecutive complementary base homologs; avoiding the secondary structure region of the product; the oligonucleotide primer length is 15-30 bp; and the G+C content is 40%-60%, the following primer pairs were designed: SEQ ID NO.1 front primer and SEQ ID NO.2 back primer; SEQ ID NO.3 front primer and SEQ ID NO.4 back primer; SEQ ID NO.5 front primer and SEQ ID NO.6 back primer; SEQ ID NO.7 front primer and SEQ ID NO.8 back primer; and SEQ ID NO.9 front primer and SEQ ID NO.10 back primer.

[0071] The kit contains: primer pairs for VSIG4 amplification, namely the front primer of SEQ ID NO.1 and the back primer of SEQ ID NO.2, or the front primer of SEQ ID NO.3 and the back primer of SEQ ID NO.4, or the front primer of SEQ ID NO.5 and the back primer of SEQ ID NO.6. Based on the specificity, sensitivity, experimental repeatability, observed amplification curves, and observed melting curves of each primer pair, the primer pair shown in SEQ ID NO.1 and the back primer of SEQ ID NO.2 was selected as the optimal primer sequence pair for VSIG4 amplification. The primer pair shown in SEQ ID NO.1 (front primer) and SEQ ID NO.2 (back primer) is used as a specific example; the internal control is shown in the primer pair shown in SEQ ID NO.11 (front primer) and SEQ ID NO.12 (back primer); 2.5 U / μL PolyA polymerase, reverse transcriptase, 5× reverse transcription buffer, RT mixture, 5 ml of RNase-free water, 2× qPCR mixture, serum lysis buffer, 70% ethanol, chloroform, wash buffer, and anhydrous ethanol.

[0072] Experimental steps

[0073] qRT-PCR was performed using a two-step method. Peripheral blood mononuclear cells were isolated and total RNA was extracted, following the same procedure as in Example 1. After mRNA concentration testing, the next experimental step was performed.

[0074] 1. Reverse Transcription: 1000 ng of total RNA sample was thoroughly mixed with 1 μL of reverse transcriptase, 5 μL of 5× reverse transcription buffer, 1 μL of RT mixture, and RNase-free water for reverse transcription. Reverse transcription was performed using the QuantiTect Reverse Transcription kit (Qiagen, CA, USA) according to the kit instructions to obtain cDNA.

[0075] 2. Perform PCR amplification using the above cDNA template: Mix 2 μL of cDNA sample with 0.2 μL of PolyA polymerase and 7.8 mL of qPCR buffer thoroughly before performing PCR amplification. Use Takara TB Green reagent as the PCR reagent, following the kit instructions.

[0076] PCR amplification conditions: RNA extracted from the sample, 0.01-10 μL of reverse transcriptase, 0.01-10 μL of RT mixture, 0.01-10 μL of PolyA polymerase, and 0.01-100 μL of qPCR mixture.

[0077] Figure 3This is a comparison chart of peripheral blood mononuclear cell qRT-PCR validation results between the group with poor short-term outcomes (death) of liver failure (n=26) and the group with good short-term outcomes (survival) of liver failure (n=57). It shows that the expression level of VSIG4 in patients with poor short-term outcomes (death) of liver failure is significantly higher than that in patients with good short-term outcomes (survival). Figure 4 This study examines the differentiation of different outcomes (death and survival) in patients with liver failure using peripheral blood mononuclear cell qRT-PCR data of VSIG4 mRNA. Analysis shows that VSIG4 mRNA expression level is specifically high in patients with poor short-term outcomes (death) of liver failure, and can be used as an indicator to differentiate patients with poor short-term outcomes (death) of liver failure. Figure 5 This is a distribution map of VSIG4 mRNA peripheral blood mononuclear cell qRT-PCR data in patients with different outcomes (death, survival) of liver failure, indicating that when the VSIG4 mRNA expression level is greater than 15, the patient is predicted to be a high-risk group for short-term death.

[0078] Example 3

[0079] The kit contains: VSIG4 amplification primers as shown in the primer pair of SEQ ID NO.1 (front primer) and SEQ ID NO.2 (back primer), or the primer pair of SEQ ID NO.3 (front primer) and SEQ ID NO.4 (back primer), or the primer pair of SEQ ID NO.5 (front primer) and SEQ ID NO.6 (back primer), with the primer pair of SEQ ID NO.1 (front primer) and SEQ ID NO.2 (back primer) being a specific example; internal control as shown in the primer pair of SEQ ID NO.7 (front primer) and SEQ ID NO.8 (back primer); 2.5 U / μL PolyA polymerase, reverse transcriptase, 5× reverse transcription buffer, RT mixture, 5 ml RNase-free water, 2× qPCR mixture, serum lysis buffer, 70% ethanol, chloroform, wash buffer, and anhydrous ethanol.

[0080] Animal model: 60 male SD rats (60-80g) were randomly divided into three groups of 20 each.

[0081] Liver failure group: Each rat was intraperitoneally injected with D-gal 800 mg / kg and LPS 100 μg / kg to induce a liver failure model.

[0082] Liver cirrhosis group: Each rat was injected intraperitoneally with 2 ml / kg of porcine serum twice a week for 12 weeks to create a liver cirrhosis model.

[0083] Control group: Each rat was injected intraperitoneally with an equal volume of physiological saline.

[0084] Peripheral blood samples were separated from the liver failure group, liver cirrhosis group and control group, and total RNA was extracted after plasma separation.

[0085] The total RNA sample of 1000 ng was thoroughly mixed with 1 μL of reverse transcriptase, 5 μL of 5× reverse transcription buffer, 1 μL of RT mixture and RNase-free water, and then reverse transcription was performed to form cDNA.

[0086] The above cDNA sample (2 μL) was thoroughly mixed with 0.2 μL of PolyA polymerase and 7.8 mL of qPCR solution before PCR amplification.

[0087] The PCR amplification conditions were as follows: RNA extracted from the test sample, 0.01-10 μL of reverse transcriptase, 0.01-10 μL of RT mixture, 0.01-10 μL of PolyA polymerase, and 0.01-100 μL of qPCR mixture.

[0088] Figure 6 This is a comparison chart of VSIG4 detection results in a rat model, showing the results in the liver failure group, cirrhosis group, and normal control group. Liver tissue was taken from each group 12 hours after modeling to detect VSIG4 mRNA levels. The results showed that the expression level of VSIG4 mRNA in the liver tissue of the liver failure group was significantly higher than that in the cirrhosis group and the control group.

[0089] The above experimental results indicate that the expression level of VSIG4 mRNA in patients with poor short-term outcomes (death) of liver failure is significantly higher than that in patients with good short-term outcomes (survival). Detecting VSIG4 expression levels can identify high-risk patients with poor short-term outcomes (death) of liver failure, thus helping to facilitate timely treatment and early warning prediction, demonstrating promising clinical application prospects. The VSIG4 detection kit developed in this invention for early warning prediction of liver failure outcomes provides accurate assessment results and can promptly and accurately reflect the disease status of liver failure patients, enabling early warning prediction of patient prognosis, facilitating timely diagnosis by clinicians, and allowing for timely and effective treatment.

[0090] The above description is only a preferred embodiment of the present invention. It should be noted that those skilled in the art can make several improvements and additions without departing from the principle of the present invention, and these improvements and additions should also be considered within the scope of protection of the present invention.

[0091] VSIG4 primer pair sequence: SEQ ID NO.1: front primer TCCTGGAAGTGCCAGAGAGT;

[0092] SEQ ID NO.2: Back primer CTTTGCCTGCTGGATATGGT

[0093] VSIG4 primer pair sequence: SEQ ID NO.3: front primer TCCGTGTCCAGAAACACTCC;

[0094] SEQ ID NO.4: Back primer CATGTCAGTGGTCCAGTCCC

[0095] VSIG4 primer pair sequence: SEQ ID NO.5: front primer TCCGTGTCCAGAAACACTCC;

[0096] SEQ ID NO.6: Post-primer CCATGTCAGTGGTCCAGTCC

[0097] VSIG4 primer pair sequence: SEQ ID NO.7: front primer TCCGTGTCCAGAAACACTCC;

[0098] SEQ ID NO.8: Post-primer CAGCACTGGTCTCTCCAAGG

[0099] VSIG4 primer pair sequence: SEQ ID NO.9: front primer TCCGTGTCCAGAAACACTCC;

[0100] SEQ ID NO.10: Back primer CCAGCACTGGTCTCTCCAAG

[0101] Internal reference primer pair sequence: SEQ ID NO.11: front primer CTCTCTGCTCCTCCTGTTCG;

[0102] SEQ ID NO.12: Back primer ACGACCAAATCCGTTGACTC.

Claims

1. Application of a reagent for detecting the expression level of the biomarker VSIG4 in the preparation of a prognostic reagent for liver failure, wherein the outcome is death or survival.

2. The application according to claim 1, characterized in that, The reagent for detecting the expression level of the biomarker VSIG4 molecule determines the prognosis of liver failure by detecting the expression level of VSIG4 in peripheral blood mononuclear cells.

3. The application according to claim 2, characterized in that, The reagent for detecting the expression level of the biomarker VSIG4 molecule quantifies the expression level of VSIG4 molecule in peripheral blood mononuclear cells by sequencing or qRT-PCR.

4. The application according to claim 1, characterized in that, The reagent used to detect the expression level of the biomarker VSIG4 is a real-time quantitative PCR primer, which is a front primer with the sequence shown in SEQ ID NO.1 and a back primer with the sequence shown in SEQ ID NO.2.

Images