Recombinant human fibronectin and its expression method in Pichia pastoris

Abstract

The present invention discloses a recombinant human fibronectin and a method for expressing the same in Pichia pastoris. The recombinant human fibronectin is obtained by rationally designing and optimizing the functional regions of human fibronectin that bind to collagen and cell integrins, and comprises one collagen binding region and two repeated cell integrin cooperative binding regions. The high-copy recombinant strain expressing the recombinant human fibronectin is obtained by transforming the recombinant human fibronectin sequence into Pichia pastoris after codon optimization, and then screening the strain through G418 resistance gradient. The recombinant human fibronectin of the present invention has broad application prospects in the fields of skin care products and medicine.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering and relates to a recombinant human fibronectin and an expression method thereof in Pichia pastoris. Background Art

[0002] Fibronectin (FN) is an extracellular matrix (ECM) glycoprotein involved in cell adhesion, proliferation, migration, proliferation and apoptosis. It mainly exists in three forms: soluble plasma fibronectin, insoluble cell fibronectin and fetal fibronectin. The physiological function of fibronectin is closely related to its amino acid composition. It is a dimeric glycoprotein with variable molecular conformation and splice variants. The total molecular weight is as high as 500kDa. Each FN monomer contains three types of repeating subunits: FNI, FNII, and FNIII. FNI and FNII subunits are β-pleated sheets fixed by disulfide bonds, while FNIII subunits are 7-stranded β-barrel structures that are susceptible to mechanical denaturation. Among them, the FNIII9-10 region contains the cooperative binding sites PHSRN and RGD that regulate the adhesion of fibronectin to cell integrins, which are the key functional domains of fibronectin for cell adhesion, migration and proliferation. In addition, FN also contains sequences that recognize and bind to other FN subunits, collagen, heparin, fibrin, matrix metalloproteinases (MMPs) and growth factors, which together perform the physiological functions of fibronectin in the extracellular matrix.

[0003] Fibronectin plays a key role in the four stages of wound healing (hemostasis, inflammation, proliferation and remodeling). In the hemostasis stage, plasma fibronectin helps platelets aggregate on the wound surface by forming a fibrous matrix with fibrin, accelerating the hemostasis of the wound; in the inflammation stage, plasma fibronectin enhances the phagocytosis of macrophages by forming a temporary extracellular matrix to purify the wound environment; in the proliferation stage, cell fibronectin interacts with type I collagen to assemble and remodel the extracellular matrix to promote the formation of new blood vessels and cell migration; in the final tissue remodeling stage, plasma fibronectin and cell fibronectin jointly regulate cell apoptosis and thus contribute to the homeostasis of the extracellular matrix. Studies have shown that in the process of wound healing, exogenous addition of complete fibronectin molecules or fibronectin fragments has a chemotactic effect on both fibroblasts and immune cells, promoting their rapid entry into the wound surface, and can also increase the expression of integrins, promote the proliferation and maturation of granulation tissue, thereby accelerating the repair of damaged tissue.

[0004] Traditionally, fibronectin is mainly obtained by step-by-step separation and purification from animal plasma, which is time-consuming, complicated, and has a very low final yield. It is also very susceptible to enzymatic hydrolysis during large-scale production, making it difficult to obtain full-length fibronectin, and there are safety issues. With the rapid development of synthetic biology, artificial design and construction of biological systems has become the mainstream trend in biology today, and de novo design of gene element modules is the basis of synthetic biology. Based on this concept, combined with the rational transformation strategy of protein engineering, the rational design of recombinant fibronectin fragments with certain physiological functions and their efficient expression in heterologous hosts will greatly contribute to the application of fibronectin in industrial production.

[0005] Pichia pastoris is the most common protein expression system after E. coli. Thousands of proteins have been successfully expressed in the Pichia pastoris system, and it has also been recognized as a GRAS (Generally Recognized As Safe) microorganism by the US FDA. In addition, Pichia pastoris also has a systematic gene editing system and a complete protein secretion expression mechanism, and is now widely used as a heterologous host in the food and pharmaceutical fields. Summary of the invention

[0006] The present invention provides a recombinant human fibronectin by designing and optimizing partial functional fragments of human fibronectin.

[0007] The recombinant human fibronectin described in the present invention contains one human fibronectin region I collagen binding domain as shown in SEQ ID No.4 and two repeated human fibronectin region III cell integrin synergistic binding domains as shown in SEQ ID No.5, and the two human fibronectin region III cell integrin synergistic binding domains are fused to the amino terminus and carboxyl terminus of the human fibronectin region I collagen binding domain, respectively, and the amino acid sequence is shown in SEQ ID No.6.

[0008] The present invention also provides the coding gene of the above-mentioned recombinant human fibronectin, which contains one human fibronectin region I collagen binding domain as shown in SEQ ID No.1 and two repeated human fibronectin region III cell integrin synergistic binding domains as shown in SEQ ID No.2, and the two human fibronectin region III cell integrin synergistic binding domains are fused to the amino terminus and carboxyl terminus of the human fibronectin region I collagen binding domain, respectively, and the nucleotide sequence is shown in SEQ ID No.3.

[0009] Furthermore, the present invention provides a genetically engineered Pichia pastoris that expresses the above-mentioned recombinant human fibronectin.

[0010] At the same time, the present invention provides a method for constructing the above-mentioned Pichia pastoris genetically engineered bacteria expressing recombinant human fibronectin, comprising the following steps:

[0011] The coding gene of recombinant human fibronectin was amplified by PCR and then cloned into the downstream of the α-factor secretion signal peptide of the pPIC9K plasmid. After verification, the plasmid was extracted, linearized with SalI enzyme, and then electroporated into Pichia pastoris competent cells. High-copy recombinants were screened by G418 resistance gradient to obtain Pichia pastoris genetically engineered bacteria expressing recombinant human fibronectin.

[0012] Furthermore, the present invention provides a method for culturing the above-mentioned Pichia pastoris genetically engineered bacteria expressing recombinant human fibronectin, comprising the following steps: inoculating the Pichia pastoris genetically engineered bacteria expressing recombinant human fibronectin into BMMY culture medium, inducing with methanol at 30±2°C, and collecting the recombinant human fibronectin in the supernatant.

[0013] The BMMY medium described in the present invention is a common medium suitable for Pichia pastoris in the art, and each L of the medium includes the following components: 20 g / L peptone, 10 g / L yeast extract, 10×YNB 100 mL, 10× potassium phosphate buffer pH 6.0 100 ml, and the balance is water.

[0014] In the culture method of the present invention, the methanol induction time is 72 to 120 hours.

[0015] The present invention facilitates the adhesion and aggregation of collagen at the wound site by fusing the collagen binding functional domain on the recombinant human fibronectin, and accelerates the hemostasis stage in the wound healing process; at the same time, the fusion of two cell integrin binding functional domains can not only induce the migration of inflammatory cells and fibroblasts to the wound surface to accelerate the acute inflammatory stage, but also activate the cell signal transduction reaction to promote the proliferation and differentiation of new tissue. The recombinant human fibronectin of the present invention has no potential cytotoxicity at a suitable concentration, and has good biological activity, can promote the growth and proliferation of cells, enhance the adhesion of cells, and promote the ability of cell migration. The recombinant human fibronectin constructed by the present invention can act on almost the entire process of wound healing, greatly alleviating the phenomenon of long-term wounds caused by external infection, low autoimmunity or coagulation dysfunction. At the same time, because it can activate the proliferation of tissues, the recombinant human fibronectin can also be used for tissue repair to a certain extent, improve the resistance of the skin, and has a wide range of application prospects in the fields of skin care products and medicine. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Schematic diagram of the structure of the recombinant plasmid expressing recombinant human fibronectin.

[0017] Figure 2This is the electrophoresis diagram of the recombinant plasmid expressing recombinant human fibronectin. Lane 1: 1kb DNA marker, Lane 2: pPIC9K linearized fragment; Lane 3: pPIC9K+recombinant human fibronectin linearized fragment; Lane 4: recombinant human fibronectin gene fragment.

[0018] Figure 3 This is an SDS-PAGE image of the culture supernatant of high-copy Pichia pastoris genetically engineered bacteria expressing recombinant human fibronectin (methanol induction for 72 hours), where 20, 24, 25, and 30 are different high-copy recombinants, each of which was fermented in parallel, and recombinant No. 30 is the highest-copy Pichia pastoris genetically engineered bacteria obtained by screening.

[0019] Figure 4 The figure shows the results of cytotoxicity test.

[0020] Figure 5 This is a graph showing the results of a cell proliferation assay.

[0021] Figure 6 The figure shows the results of cell adhesion test.

[0022] Figure 7 This is a graph showing the results of a cell migration assay. DETAILED DESCRIPTION

[0023] The present invention is further described below by way of examples and drawings, but the present invention is not limited to the scope of the examples. Experimental methods without specific conditions in the following examples are carried out according to conventional methods and conditions, or selected according to the product specifications.

[0024] In the following examples, the culture medium involved is composed as follows:

[0025] BMGY medium: Each L of medium contains 20 g / L peptone, 10 g / L yeast extract, 10×YNB 100 ml, 10× potassium phosphate buffer pH 6.0 100 ml, 10× glycerol 100 ml, and the balance is water.

[0026] BMMY medium: Each L of medium contains 20 g / L peptone, 10 g / L yeast extract, 10×YNB 100 ml, 10× potassium phosphate buffer pH 6.0 100 ml, and the balance is water.

[0027] Example 1

[0028] 1. Structural design of recombinant human fibronectin

[0029] (1) Screening collagen binding regions and cell integrin cooperative binding regions from human fibronectin fragments;

[0030] (2) The integrin cooperating domain of human fibronectin region III (amino acid sequence as shown in SEQ ID NO.5) was fused to the amino acid and carboxyl termini of the collagen domain of human fibronectin region I (amino acid sequence as shown in SEQ ID NO.4) to obtain a recombinant human fibronectin having both collagen and integrin binding sites (amino acid sequence as shown in SEQ ID NO.6).

[0031] 2. Construction of Pichia pastoris genetically engineered bacteria expressing high-copy recombinant human fibronectin

[0032] (1) The amino acid sequence of the recombinant human fibronectin designed above was codon-optimized according to the codon preference of Pichia pastoris to obtain the optimized coding gene of the recombinant human fibronectin, the nucleotide sequence of which is shown in SEQ ID NO.3.

[0033] (2) Primer 1: AGAAAAGAGAGGCTGAAGCTGAGGGAAGAAGAGACAACAT (SEQ ID NO. 7) and primer 2: GTCATGTCTAAGGCGAATTAGAGCGGTTGGCAGTGCCATT (SEQ ID NO. 8) were used to PCR amplify the coding gene of recombinant human fibronectin. After purification, the gene was seamlessly cloned into the downstream of the α factor secretion signal peptide of the pPIC9K plasmid using the Gibson assembly technique. The recombinant plasmid structure is as follows: Figure 1 After verification by PCR and DNA sequencing, the plasmid was extracted, linearized by SalI digestion, and then electroporated into Pichia pastoris GS115 competent cells. High-copy recombinants were obtained by 1-6 g / LG418 resistance gradient replica plate screening.

[0034] 3. Expression of recombinant human fibronectin in genetically engineered Pichia pastoris

[0035] The high-copy Pichia yeast genetic engineering strain expressing recombinant human fibronectin was inoculated into 30 mL of BMGY medium and cultured for 16-20 hours. 600 The inoculum size was 1 and inoculated into 30 mL BMMY medium for cultivation. 300 μL of filtered and sterilized methanol was added every 24 hours. After 120 hours of methanol induction, 2 mL of medium was taken and the supernatant was collected by centrifugation. The recombinant human fibronectin was qualitatively analyzed by SDS-PAGE. The test results are shown in Figure 4 .Depend on Figure 4 It can be seen that the high-copy Pichia pastoris genetically engineered strain can successfully express recombinant human fibronectin.

[0036] Example 2

[0037] The MTT method was used to detect the effect of recombinant human fibronectin on cell activity and cell proliferation: the ultraviolet absorbance of the sample at 570 nm was measured, and the cell activity was calculated according to the formula: (OD 样品 / OD 空白 )×100% to calculate cell activity. The principle of this method is that the succinate dehydrogenase in the mitochondria of living cells can reduce exogenous MTT to water-insoluble blue-purple crystalline formazan and deposit it in the cells, while dead cells do not have this function. Dimethyl sulfoxide (DMSO) can dissolve the formazan in the cells, and its light absorption value is measured at a wavelength of 570nm using an enzyme marker. Within a certain range of cell numbers, the amount of MTT crystals formed is proportional to the number of cells. The number of living cells is determined based on the measured absorbance value (OD value). The larger the OD value, the stronger the cell activity.

[0038] 1. Cytotoxicity

[0039] (1) Add 10 4 Mouse fibroblasts (L929 cells) in good culture state were incubated at 37°C for 24 h;

[0040] (2) Discard the supernatant, set up different concentrations of recombinant human fibronectin solution prepared in 10% serum culture medium as the experimental group, 10% serum culture medium as the blank control group, and 10% zinc diethyldithiocarbamate (ZDEC) solution prepared in 10% serum culture medium as the positive control group. Set up 6 replicates for each group. Add 100 μL of different concentrations of recombinant human fibronectin solution, culture medium or ZDEC solution to each well and incubate at 37°C for 24 h.

[0041] (3) Discard the supernatant and add 50 μL of MTT-complete medium solution to each well;

[0042] (4) Discard the supernatant, add 100 μL of DMSO to each well and shake on a decolorizing shaker for 10 min;

[0043] (5) The detection wavelength is 570 nm, and the OD value is the OD value at 570 nm. According to the formula, cell activity = (OD 样品 / OD 空白 )×100%, and the cell activity was calculated.

[0044] The results are as follows Figure 4 As shown, it can be seen that the recombinant human fibronectin of the present invention has no potential cytotoxicity.

[0045] 2. Cell Proliferation

[0046] (1) Add 8000 well-cultured human immortalized epidermal cells (HaCaT cells) or 4000 well-cultured human skin fibroblasts (HFF-1 cells) to each well of a 96-well plate and incubate at 37°C for 24 h;

[0047] (2) Discard the supernatant, set up different concentrations of recombinant human fibronectin solution prepared in 10% serum culture medium as the experimental group and 10% serum culture medium as the blank control group, with 6 replicates in each group, add 100 μL of different concentrations of recombinant human fibronectin solution or culture medium to each well, and incubate at 37°C for 48 h;

[0048] (3) Discard the supernatant, add 50 μL of MTT-complete medium solution to each well, and incubate at 37°C for 2 h;

[0049] (4) Discard the supernatant, add 100 μL of DMSO to each well and shake on a decolorizing shaker for 10 min;

[0050] (5) The detection wavelength is 490nm, with 630nm as the reference wavelength. The OD value is the OD value at 490nm minus the OD value at 630nm. According to the formula, the relative cell proliferation rate = OD 样品 / OD 空白 × 100%, and the relative cell proliferation rate was calculated.

[0051] The results are as follows Figure 5 As shown, it can be seen that at a concentration of 0.01%, the cell proliferation ability of the recombinant human fibronectin of the present invention on epidermal cells and fibroblasts is higher than that of the blank control group, and has excellent ability to promote cell proliferation.

[0052] Example 3

[0053] The centrifugation method is used to detect the cell adhesion of the protein sample to be tested. The principle of this method is to quantitatively determine the force required for collagen to separate after adhesion with cells by centrifugation. The specific method is to culture the cell suspension in a culture dish coated with recombinant human fibronectin for a certain period of time, label the cells with fluorescence, wash out the non-adherent cells at the optimal relative centrifugal force, determine the cell separation percentage before and after centrifugation, evaluate the relative cell adhesion of the recombinant fibronectin sample to be tested, and calculate the relative cell adhesion rate according to the formula adhesion percentage = number of cells after centrifugation / number of cells before centrifugation × 100%, cell relative adhesion rate = average adhesion percentage of the sample / average adhesion percentage of the blank control group. The details are as follows:

[0054] (1) Different concentrations of recombinant human fibronectin solution prepared in serum-free medium were set as the experimental group and the blank control group with the same amount of PBS solution was added. Each group was set up with 6 replicates. 100 μL of different concentrations of recombinant human fibronectin solution or PBS solution was added to each well of a 96-well plate and incubated at 37°C for 1 to 4 h.

[0055] (2) Discard the supernatant, add 100 μL of 1% BSA to each well, and incubate at 37°C for 48 h;

[0056] (3) Wash three times with PBS, seal with sealing film and place at 4°C for later use;

[0057] (4) Add 5000 human immortalized epidermal cells (HaCaT cells) or human skin fibroblasts (HFF-1 cells) in good culture status to each well, add 10% Hoechst33342 fluorescent dye, and incubate at 37°C for 1 h;

[0058] (5) using an inverted microscope to capture fluorescent tile images of each of the three wells;

[0059] (6) Each well was filled with D-PBS to form a “reverse meniscus”, bubbles were blown out and covered with sealing film, and centrifuged (inverted) at 350 g for 5 min;

[0060] (7) After centrifugation, the sealing film was discarded, the supernatant was removed from the wells, and the wells were washed once with D-PBS. Then, 100 μL of D-PBS was added and each of the three wells was photographed;

[0061] (8) Use Image J cell counting program to count the number of fluorescently labeled cell nuclei and determine the number of cells before and after centrifugation.

[0062] The cell adhesion rate can reflect the activity of fibronectin. The higher the activity of the protein, the better the external environment it can provide to the cells in a short time, helping the cells to adhere to the wall. Figure 6 It can be seen that under the experimental concentration, the recombinant human fibronectin of the present invention can promote cell adhesion, and the adhesion increases with the increase of the concentration of the protein solution, showing excellent cell adhesion promoting activity.

[0063] Example 4

[0064] The cell migration movement is measured by the cell scratch method. On the monolayer adherent cells cultured in vitro in a culture dish or plate, use a micropipette tip or other hard object to scratch the central area of ​​cell growth, remove the cells in the central part, and then continue to culture the cells until the experimental set time of 24 hours, observe whether the surrounding cells migrate to the central scratch area, and judge the growth and migration ability of the cells. Calculate the cell migration rate according to the formula: Cell migration rate = total area of ​​migrating cells in the fixed scratch area / initial scratch area × 100%. The specific steps are as follows:

[0065] (1) Use a marker pen to draw three horizontal lines on the bottom of the 6-well plate. The concentration of human immortalized epidermal cells (HaCaT cells) was adjusted to 5×10 5 The concentration of human skin fibroblasts (HFF-1 cells) was adjusted to 2.5×10 5 100 cells / well, inoculated into 6-well plates, 2 ml per well, cultured for 24 h (the specific inoculation quantity can be adjusted according to different cells, the goal is to reach 95% to 100% confluence after 24 hours of culture);

[0066] (2) Use a 20 μL pipette tip to align vertically with the well plate (or a scratch-specific cell culture dish) with a ruler, and gently push down to create a scratch;

[0067] (3) Rinse the cells three times with PBS to remove the scratched cells;

[0068] (4) 2 mL of serum-free medium was added to the experimental group, and only 2 mL of serum-free medium was added to the blank control group. The cells were cultured in a 37°C, 5% CO2 incubator. After 0 h and 24 h, the intersection of the horizontal and vertical scratches was taken as the core and photographed under a 40x microscope. Nine photos of each well were obtained, and 27 data were collected for each group.

[0069] (4) Image J software was used to measure the scratch area and calculate the cell migration rate of each cell group.

[0070] The results are as follows Figure 7 As shown, it can be seen that at the current experimental concentration, the recombinant human fibronectin of the present invention exhibits excellent ability to promote cell migration.

[0071] In summary, the recombinant human fibronectin of the present invention has no potential cytotoxicity at an appropriate concentration and has good biological activity, and can promote cell growth and proliferation, enhance cell adhesion, and promote cell migration.

[0072] The above are only preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be regarded as limiting the present invention, and the protection scope of the present invention should be based on the scope defined by the claims. For ordinary technicians in this technical field, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be regarded as the protection scope of the present invention.

Claims

1. Recombinant human fibronectin, characterized in that: The amino acid sequence is shown in SEQ ID No.

6.

2. A gene encoding recombinant human fibronectin, characterized in that: The nucleotide sequence is shown in SEQ ID No.

3.

3. The genetically engineered Pichia pastoris expressing the recombinant human fibronectin according to claim 1, characterized in that: Build it with the following steps: The coding gene of the recombinant human fibronectin was first amplified by PCR, and then cloned into the downstream of the α factor secretion signal peptide of the pPIC9K plasmid. After verification, the plasmid was extracted, linearized by SalI digestion, and then electro-transformed into the competent Pichia pastoris. High-copy recombinants were screened by G418 resistance gradient to obtain Pichia pastoris genetically engineered bacteria expressing the recombinant human fibronectin.

4. The method for culturing the genetically engineered Pichia pastoris according to claim 3, characterized in that: The following steps are involved: The genetically engineered Pichia pastoris was inoculated into BMMY culture medium, induced with methanol at 30±2° C., and the recombinant human fibronectin in the supernatant was collected.

5. The culture method according to claim 4, characterized in that In the BMMY medium, each L of the medium includes the following components: 20 g / L peptone, 10 g / L yeast extract, 10×YNB 100 mL, 10× potassium phosphate buffer pH 6.0 100 ml, and the balance is water.

6. The culture method according to claim 4, characterized in that The methanol induction time is 72~120 hours.

Images