A genetically engineered bacterium for high production of gibberellin GA3, its construction method and application

Abstract

The present invention relates to a genetically engineered bacterium with high gibberellin GA3 production, a construction method and an application. The present invention enhances the dissolved oxygen level in the gibberellin synthesis process and enhances the supply of the electron transport chain by enhancing the expression of a gene encoding cytochrome P450 reductase CPR and a gene encoding Vitreoscilla hemoglobin VHB in Fujikura Gibberella. The recombinant Fujikura Gibberella with high gibberellin GA3 production provided by the present invention has enhanced oxidation capacity in the late stage of metabolism compared with the wild type, improved synthesis capacity in the metabolic process, and increased accumulation of hyphae, and can better utilize nutrients for the production of gibberellin GA3. The strain with the best performance after the transformation has a level of gibberellin GA3 production in fermentation increased from 2g / L to 3.45g / L compared with the starting strain, significantly improving the gibberellin GA3 production capacity, and the increase in hyphae can increase the time-space yield of gibberellin GA3 synthesis, and can be applied to large-scale gibberellin GA3 production.

Description

Technical Field

[0001] The invention relates to a genetic engineering bacterium with high production of gibberellin GA3, a construction method and application thereof. Background Art

[0002] Gibberellin Acid (GA3) is a plant growth hormone synthesized by plants and some fungi. It is widely used in agriculture, horticulture and wine production because of its special ability to stimulate plant growth. Gibberellin was first discovered by Japanese plant pathologists in the study of rice seedling disease. Subsequent studies have confirmed that Gibberellin naturally has the ability to synthesize GA3. GA3 is a tetracyclic diterpene carboxylic acid with a molecular formula of C 19 H 22 O6, molecular weight 346.37, melting point 233 ~ 235 ℃, easily soluble in alcohols, acetone, ethyl acetate, sodium bicarbonate solution and phosphate buffer with a pH of 6.2, insoluble in water and ether. The synthesis site of GA3 in Gibberella fujikura is in the cytoplasm. Its biosynthesis starts from acetyl coenzyme A (Acetyl-CoA) synthesized by the TCA cycle, and synthesizes isopentenyl pyrophosphate (IPP) and its isomer dimethylallyl diphosphate (DMAPP) through the mevalonate pathway. Subsequently, the precursor dimethyl pyrophosphate (GGPP) is synthesized by synthase via pyrophosphate (GPP) and farnesyl pyrophosphate (FPP). Under the action of the gibberellin synthesis gene cluster, two molecules of GGPP are cyclized to synthesize copapyrophosphate (CPP), and then kaurene is produced. Kaurenoic acid is gradually oxidized by P450 monooxygenase at C-19, and GA is subsequently produced by oxidation at C-7α and C-6β. 12 -semialdehyde, oxidized by P450 monooxygenase at C-3β and C-7 to produce GA 14 , G.A. 14It is converted into GA4 by oxidation, GA7 is produced by desaturation, and GA3 is converted into GA3 by hydroxylation. GA3, as a secondary metabolite, is generally obtained by liquid fermentation, solid fermentation and plant extraction. At present, the production of GA3 mainly relies on liquid deep fermentation or solid fermentation. Chinese invention patents (publication numbers CN104892554A, CN201910304928.1 and CN201910438160.7) respectively describe the preparation method of GA3, the mutagenesis results and the mutagenesis technology of ARTP, and obtain strains with certain industrial production capacity. Chinese invention patents (publication number CN114517161A) have described that by enhancing the expression of the gene encoding the nitrogen source regulatory factor AreA and the gene of the global regulatory factor Lae1 in Fujikura Gibberella, the positive regulatory effect of the related genes (cps / ks, p450-1, p450-2, des, etc.) in the gibberellin synthesis metabolic pathway can be enhanced, and the transcription level of the related genes is improved to achieve the purpose of accumulating gibberellin GA3. This strategy improves the synthesis capacity of the metabolic process and weakens the transcriptional inhibition of genes related to GA3 synthesis by adjusting the overall transcription level of the GA gene cluster in the gibberellin synthesis metabolic pathway. It can better utilize carbon and nitrogen sources for the synthesis of GA3 and more efficiently produce GA3 by fermentation compared to the starting strain.

[0003] Dissolved oxygen is an important factor affecting the growth of mycelium and the late oxidation process of product synthesis. It is particularly important for the metabolism and growth of microorganisms. Appropriate oxygen supply is regarded as a prerequisite for the efficient production of terpenoids by engineered microorganisms. In addition, the effectiveness of the electron transport chain system is an important guarantee for achieving efficient synthesis. The metabolic process of gibberellins is mainly based on the gradual monooxygenation step mediated by the cytochrome P450 monooxygenase system. Too low dissolved oxygen will cause changes in the metabolic process in the mycelium. For example, anaerobic respiration will produce a large amount of acetic acid, ethanol, etc., which are toxic to cells. At present, in industry, large-scale fermentation production of GA3 uses a high-speed, long-cycle deep fermentation method to increase dissolved oxygen, which greatly increases production costs and electricity consumption. Summary of the invention

[0004] The purpose of the present invention is to provide a genetic engineering bacterium with high production of gibberellin GA3, a construction method and an application thereof through metabolic engineering technology.

[0005] The technical solution adopted by the present invention is:

[0006] The genetically engineered bacteria with high production of gibberellin GA3 are constructed by the following method: using Gibberella fujikuraensis as the base bacteria, enhancing the expression of the gene encoding cytochrome P450 reductase CPR and the gene encoding Vitreoscilla hemoglobin VHB in its genome, and enhancing the expression of the gene encoding the nitrogen source regulatory factor AreA and the gene encoding the global regulatory factor Lae1, to obtain the genetically engineered bacteria with high production of gibberellin GA3.

[0007] Preferably, the bottom plate fungus is Fusarium fujikuroi CCTCC NO: M 2019378 (disclosed in the prior application CN110527630A).

[0008] The present invention enhances the dissolved oxygen level and electron transfer efficiency of gibberellin synthesis by enhancing the gene expressing cytochrome P450 reductase CPR and the gene encoding Vitreoscilla hemoglobin VHB in Fujikura Gibberella, thereby improving the oxidation capacity of related genes. In addition, by enhancing the gene expressing nitrogen source regulatory factor AreA and the gene of global regulatory factor Lae1 in Fujikura Gibberella, the positive regulatory effect on related genes (cps / ks, p450-1, p450-2, des, etc.) in the gibberellin synthesis metabolic pathway is enhanced, the transcription level of related genes is improved, and the purpose of accumulating gibberellin GA3 is achieved. Through the combination of the above transformation strategies, the present invention successfully obtains a recombinant Fujikura Gibberella strain with high gibberellin GA3 production.

[0009] The present invention also relates to a method for constructing the genetically engineered bacteria, which comprises: constructing in vitro assembled complete gene expression cassettes of CPR and VHB genes respectively, and introducing them into the chassis fungus, i.e., Gibberella fujikura, to obtain the genetically engineered bacteria.

[0010] Preferably, the complete gene expression cassette of the CPR gene is connected to the coding gene sequence of cytochrome P450 reductase using the gpdA promoter and glaA terminator derived from the pAN7-1 plasmid.

[0011] Specifically, the coding gene sequence of the cytochrome P450 reductase is shown in SEQ ID No.3, the gpdA promoter nucleotide sequence is shown in SEQ ID No.4, and the glaA terminator nucleotide sequence is shown in SEQ ID No.5.

[0012] Preferably, the complete gene expression cassette of the VHB gene is connected to the coding gene of Vitreoscilla hemoglobin using the tef1 promoter and tef1 terminator derived from Aspergillus nidulans.

[0013] Specifically, the Vitreoscilla hemoglobin gene sequence is shown as SEQ ID No.1, the tef1 promoter nucleotide sequence is shown as SEQ ID No.6, and the tef1 terminator nucleotide sequence is shown as SEQ ID No.7.

[0014] The invention also relates to the application of the genetically engineered bacteria in preparing gibberellin GA3 by microbial fermentation.

[0015] Specifically, the application is: inoculating the genetically engineered bacterial strain into a fermentation medium, fermenting and culturing for 150 to 200 hours at 25 to 30° C. and 200 to 300 rpm to obtain a fermentation liquid containing gibberellin GA3, and separating and purifying the fermentation liquid to obtain the gibberellin GA3.

[0016] Preferably, the fermentation medium is composed of: 70-90 g / L corn starch, 70-90 g / L rice flour, 10-30 g / L soybean powder, 10-30 g / L peanut powder, 0.5-1.5 g / L potassium sulfate, 0.5-1.5 g / L potassium dihydrogen phosphate, the solvent is water, the pH is natural, and sterilization is carried out at 121 degrees for 30 minutes.

[0017] Usually, the genetically engineered strain is first activated on a slant before fermentation, then inoculated into a seed culture medium, and cultured at 25-30°C and 200-300rpm. The seed solution is then transferred to a fermentation medium, and cultured at 25-30°C and 200-300rpm. The culture solution is separated and purified to obtain gibberellin GA3.

[0018] The slant activation method is: inoculate the recombinant genetic engineering bacteria in the seed culture medium, culture it at 25-30°C and 200-300rpm for 2 days, spread it on the PDA slant, and culture it at 28°C for 4 days to obtain the seed slant.

[0019] The final concentration of the seed culture medium is as follows: 10-30 g / L corn starch, 10-30 g / L sucrose, 10-30 g / L peanut powder, 10-30 g / L soybean powder, 0.5-1.5 g / L potassium dihydrogen phosphate, and 0.5-1.5 g / L magnesium sulfate. The solvent is water, the pH is natural, and it is sterilized at 121° C. for 30 min.

[0020] The beneficial effects of the present invention are mainly reflected in: the recombinant Fujikura Gibberella with high gibberellin GA3 production provided by the present invention has enhanced dissolved oxygen level and electron transfer efficiency in oxidation during fermentation compared with the wild type, and can more efficiently and gradually oxidize intermediate products in the late fermentation period to produce gibberellin GA3; the strain with the best performance after the dissolved oxygen improvement and electron transfer chain enhancement modification has the gibberellin GA3 production level increased from 2 g / L to 2.61 g / L compared with the starting strain, and the gibberellin GA3 production capacity is significantly improved; on this basis, the enhanced expression of the gene encoding the nitrogen source regulatory factor AreA and the gene of the global regulatory factor Lae1 in the superimposed regulatory module can further enhance the GA3 synthesis capacity in Fujikura Gibberella, and the yield of the modified strain is increased from 2.61 g / L to 3.45 g / L, and at the same time has the potential to reduce the energy consumption of the bioreactor, and the productivity of the engineered strain can be applied to large-scale gibberellin GA3 production. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 The synthesis process of GA3 in the production strain;

[0022] Figure 2 Figure 1 is the structure diagram of the recombinant expression plasmid;

[0023] Figure 3 It is the fermentation yield diagram of the engineering strain and the starting strain;

[0024] Figure 4 It is the fermentation result after multiple rounds of subculture of the engineered strain;

[0025] Figure 5 NADP of the engineering strain and the starting strain + / NADPH concentration (A) and volume dissolved oxygen coefficient (B); in Figure A, the left is NADPH concentration and the right is NADP + concentration;

[0026] Figure 6 Results of RPM optimization for engineered strains. DETAILED DESCRIPTION

[0027] The present invention is further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto:

[0028] The experimental methods in the following examples are all conventional methods unless otherwise specified.

[0029] The test materials used in the following examples are all conventional biochemical reagents unless otherwise specified. The term "enhancement" used in the present invention refers to increasing the activity of an enzyme encoded by a corresponding polynucleotide by overexpression of a gene.

[0030] Example 1: Acquisition of F. fujikuroi-OE:CPR

[0031] The gpdA promoter fragment was amplified by PCR using primers 1 and 2 with pAN7-1 plasmid as template. The PCR reaction conditions were as follows: 98°C for 5 min; 98°C for 30 s, 60°C for 30 s, 72°C for 1 min, repeated for 30 cycles; 72°C for 5 min. The glaA terminator fragment was amplified using primers 3 and 4 in the same manner, and the hygromycin hyg fragment was amplified using primers 5 and 6. The PCR products were detected by 1.0% agarose gel electrophoresis and the purified fragments were recovered by gel excision (the nucleotide sequences of the gpdA promoter fragment, glaA terminator fragment and hygromycin hyg1 fragment are shown in SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.8, respectively).

[0032] The cpr gene fragment was amplified by PCR using primers 7 and 8, with the genome of Fusarium fujikuroi CCTCC NO: M2019378 (CN110527630A) as a template. The PCR reaction conditions were as follows: 98°C for 8 min; 98°C for 30 s, 60°C for 30 s, 72°C for 1 min, repeated for 30 cycles; 72°C for 8 min. The PCR product was detected by 1.0% agarose gel electrophoresis and the purified fragment was recovered by gel excision (the nucleotide sequence is shown in SEQ ID NO.3).

[0033] The three recovered DNA fragments (gpdA promoter, cpr gene, glaA terminator) were subjected to fusion PCR using primers 1 and 4. The PCR reaction conditions were as follows: 98°C for 8 min; 98°C for 30 s, 60°C for 30 s, 72°C for 5 min, repeated for 30 cycles; 72°C for another 8 min. The PCR products were detected by 1.0% agarose gel electrophoresis and the purified fragments were recovered by gel excision.

[0034] Using the pUC19 vector as a template, the pUC19-Hyg1-PgpdA-CPR-TglaA vector was constructed by ligation with the one-step cloning kit ClonExpressⅡOne Step CloningKit (purchased from Nanjing Vazyme), and the ligation product was transformed into the E. coli DH5α recipient bacteria, spread on an LB solid plate containing a final concentration of 100 mg / L ampicillin resistance, and cultured at 37°C for 12 hours. Single colonies were randomly picked to LB liquid medium containing a final concentration of 100 mg / L ampicillin resistance, cultured at 37°C for 12 hours, and the bacteria were collected and the plasmid was extracted to obtain the pUC19-Hyg1-PgpdA-CPR-TglaA vector.

[0035] The preparation of protoplasts of Fusarium fujikuroi, transformation of exogenous fragments, recovery culture scheme, and verification scheme are as described in CN113832041A. The transformed single colony was subjected to PCR with primers 1 and 4 to confirm that the exogenous fragment was integrated into the genome. The strain thus constructed was named Fusarium fujikuroi-OE:CPR, and the plasmid construction and transformation process were as described in Figure 2 shown.

[0036] Table 1: Primer sequences

[0037] Primer 1 tagtcatatggattgaattcggtaccgcttgtatctctacacacaggct Primer 2 tgtccagagtgtcgagttcagccattgtgatgtctgctcaagcgg Primer 3 aggaggatgtttggtcatagacaatcaatccatttcgctatag Primer 4 accggcatgcaagctgattacccttttccttgattctcgc Primer 5 gagaatcaaggaaaagggtaatcagcttgcatgccggt Primer 6 aagctttctagaggtaccatcatacatgagaattaaggg Primer 7 ccgcttgagcagacatcacaatggctgaactcgacactctggaca Primer 8 ctatagcgaaatggattgattgtctatgaccaaacatcctcct

[0038] Example 2: Acquisition of F. fujikuroi-OE:VHB

[0039] The tef1 promoter fragment was amplified by PCR using primers 9 and 10 with the Aspergillus nidulans (Aspergillus nidulans CCTCC M 2010275) genome as a template. The PCR reaction conditions were as follows: 98°C for 5 min; 98°C for 30 s, 60°C for 30 s, 72°C for 1 min, repeated for 30 cycles; 72°C for 5 min. The tef1 terminator fragment was amplified using primers 11 and 12 in the same way, and the hygromycin hyg2 fragment was amplified using primers 13 and 14 with the pAN7-1 plasmid as a template. The PCR products were detected by 1.0% agarose gel electrophoresis and the purified fragments were recovered by gel excision (the nucleotide sequences of the tef1 promoter fragment, the tef1 terminator fragment and the hygromycin hyg2 fragment are shown in SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO.9, respectively).

[0040] The two recovered DNA fragments (tef1 promoter, tef2 terminator) and the vhb gene (nucleotide sequence as shown in SEQ ID NO.1, encoded amino acid sequence as shown in SEQ ID NO.2) were subjected to fusion PCR using primers 9 and 12. The PCR reaction conditions were as follows: 98°C for 8 min; 98°C for 30 s, 60°C for 30 s, 72°C for 3 min, repeated for 30 cycles; 72°C for another 8 min. The PCR products were detected by 1.0% agarose gel electrophoresis and the purified fragments were recovered by gel excision.

[0041] Using the pUC19 vector as a template, the pUC19-Hyg2-Ptef1-VHB-Ttef1 vector was constructed by ligation with the one-step cloning kit ClonExpressⅡOne Step CloningKit (purchased from Nanjing Vazyme), and the ligation product was transformed into the E. coli DH5α recipient bacteria, coated on an LB solid plate containing a final concentration of 100 mg / L ampicillin resistance, and cultured at 37°C for 12 hours. Single colonies were randomly picked into LB liquid culture medium containing a final concentration of 100 mg / L ampicillin resistance, cultured at 37°C for 12 hours, and the bacteria were collected and the plasmid was extracted to obtain the pUC19-Hyg2-Ptef1-VHB-Ttef1 vector.

[0042] A single colony of Fusarium fujikuroi transformed with the vector was subjected to PCR with primers 9 and 12 to confirm that the exogenous fragment was integrated into the genome. The strain thus constructed was named Fusarium fujikuroi-OE:VHB.

[0043] Table 2: Primer sequences

[0044] Primer 9 ccttaattctcatgtatgatcgagacagcagaatcaccgc Primer 10 atggtctgctggtccagcatggtgaaggttgtgttatgtt Primer 11 tgtatgctcaggccgtggaggcggacattcgatttatgcc Primer 12 aagctttctagaggtaccgtattgggatgaattttgt Primer 13 tatggattgaattcggtaccatcagcttgcatgccggtcg Primer 14 gcggtgattctgctgtctcgatcatacatgagaattaagg Primer 15 aacataacacaaccttcaccatgctggaccagcagaccat Primer 16 ggcataaatcgaatgtccgcctccacggcctgagcataca

[0045] Example 3: Obtaining F. fujikuroi-OE:CPR OE:VHB

[0046] The complete VHB expression cassette was amplified by PCR using primers 17 and 18, with the pUC19-Hyg2-Ptef1-VHB-Ttef1 vector in Example 2 as a template. The PCR reaction conditions were as follows: 98°C for 8 min; 98°C for 30 s, 60°C for 30 s, 72°C for 4 min, repeated for 30 cycles; 72°C for another 8 min. The PCR product was detected by 1.0% agarose gel electrophoresis and the purified fragment was recovered by gel excision.

[0047] Using the pUC19-Hyg1-PgpdA-CPR-TglaA vector as a template, the pUC19-Hyg1-PgpdA-CPR-TglaA-Ptef1-VHB-Ttef1 vector was constructed by ligation with the one-step cloning kit ClonExpressⅡOne Step Cloning Kit (purchased from Nanjing Vazyme), and the ligation product was transformed into the E. coli DH5α recipient bacteria, spread on the LB solid plate containing a final concentration of 100 mg / L ampicillin resistance, and cultured at 37°C for 12 hours. Single colonies were randomly picked to LB liquid medium containing a final concentration of 100 mg / L ampicillin resistance, cultured at 37°C for 12 hours, and the bacteria were collected and the plasmid was extracted to obtain the pUC19-Hyg1-PgpdA-CPR-TglaA-Ptef1-VHB-Ttef1 vector.

[0048] A single colony of Fusarium fujikuroi transformed with the vector was subjected to PCR with primers 19 and 20 to confirm that the exogenous fragment was integrated into the genome. The strain thus constructed was named Fusarium fujikuroi-OE:CPR OE:VHB.

[0049] Table 3: Primer sequences

[0050] Primer 17 CGAGACAGCAGAATCACCGCCCAAGTTAAG Primer 18 GTATTGGGATGAATTTTGTATGCACGCGCT Primer 19 GCATGCCATTAACCTAGGTA Primer 20 GCGTTGGGGTGGACGAGAAA

[0051] Example 4: Obtaining F. fujikuroi-OE:CPR OE:VHB OE:AreA OE:Lae1

[0052] Using the pUC19-Hyg1-PgpdA-AreA-TtrpC-Ptef1-Lae1-Ttef1 vector in patent CN114517161A as a template, the pUC19-G418-PgpdA-AreA-TtrpC-Ptef1-Lae1-Ttef1 vector was constructed by connection with the one-step cloning kit ClonExpressⅡOne Step Cloning Kit (purchased from Nanjing Vazyme). The connection product was transformed into E. coli DH5α recipient bacteria, spread on an LB solid plate containing a final concentration of 100 mg / L ampicillin resistance, and cultured at 37°C for 12 h. Single colonies were randomly picked and placed in LB liquid medium containing ampicillin resistance at a final concentration of 100 mg / L, cultured at 37°C for 12 h, the bacteria were collected and the plasmid was extracted to obtain the pUC19-G418-PgpdA-AreA-TtrpC-Ptef1-Lae1-Ttef1 vector.

[0053] The expression cassette fragments of AreA and Lae1 were amplified by PCR using primers 21 and 22, with the pUC19-G418-PgpdA-AreA-TtrpC-Ptef1-Lae1-Ttef1 vector as a template. The PCR reaction conditions were as follows: 98°C for 8 min; 98°C for 30 s, 60°C for 30 s, 72°C for 4 min, repeated for 30 cycles; 72°C for another 8 min. The PCR product was detected by 1.0% agarose gel electrophoresis and the purified fragment was recovered by gel excision.

[0054] Using Fusarium fujikuroi-OE:CPR OE:VHB as the starting strain, a single colony of Fusarium fujikuroi after transformation was subjected to PCR with primers 23 and 24 to confirm that the exogenous fragment was integrated into the genome. The strain thus constructed was named Fusarium fujikuroi-OE:CPR OE:VHB OE:AreA OE:Lae1.

[0055] Table 4: Primer sequences

[0056] Primer 21 GCTTGTATCTCTACACACAGGCTCA Primer 22 GTATTGGGATGAATTTTGTATGCACGCGC Primer 23 TCTGGCGCTGTGGGTGGTAAAGGGGTTGTA Primer 24 CCAGATACCTGTGCCCGTACCAATATCCATGAT

[0057] Example 5: Shake flask fermentation verification of different genotypes of gibberellin GA3-producing engineered bacteria

[0058] The modified strains and the starting strain constructed in Examples 1, 2, 3 and 4 were inoculated into 25 mL of seed culture medium, respectively, and cultured at 28°C and 250 rpm as pre-culture. After 48 hours, 2.8 mL of pre-culture was inoculated into a 500 mL shake flask containing 40 mL of fermentation medium, and then cultured at 28°C and 250 rpm for 7 days. The GA3 content was detected according to the HPLC detection method of Example 7 of Patent CN113832041A. During the fermentation process, the GA3 content in the fermentation broth changed as follows: Figure 3 shown.

[0059] The seed culture medium was prepared as follows: 20 g / L corn starch, 20 g / L sucrose, 20 g / L peanut powder, 20 g / L soybean powder, 1.0 g / L potassium dihydrogen phosphate, 1.0 g / L magnesium sulfate, natural pH, sterilized at 121°C for 30 min.

[0060] Fermentation medium composition: corn starch 80g / L, rice flour 80g / L, soybean powder 20g / L, peanut powder 20g / L, potassium sulfate 1.0g / L, potassium dihydrogen phosphate 1.0g / L, solvent is tap water, pH is natural, sterilized at 121 degrees for 30 minutes.

[0061] The fermentation yields of strains with different genotypes are shown in Table 5.

[0062] Table 5

[0063]

[0064] Example 6: Verification of the subculture of high-yield gibberellin GA3 engineering bacteria

[0065] According to the slant medium composition and culture conditions of patent CN113832041A, the modified strains constructed in Examples 3 and 4 were selected and subcultured for 5 consecutive times. The culture method and HPLC analysis were the same as those in Example 4. The subculture verification results were as follows: Figure 4 The results showed that the production of gibberellin GA3 was stable, the overexpression of CPR and VHB increased by more than 30% compared with the starting strain, and the biomass was significantly increased compared with the starting strain. Combined with the effects of AreA and Lae1 on gibberellin production reported in patent CN114517161A, the maximum production of the modified strain can reach 3.45g / L.

[0066] Example 7: Dissolved oxygen level and electron transfer efficiency of high-yield gibberellin GA3 engineering bacteria

[0067] In the biosynthesis of gibberellin GA3, the oxidation step catalyzed by the P450 enzyme system in the pathway occupies the main process, so the mycelium has a huge demand for oxygen during the fermentation process. By enhancing the expression of the gene encoding cytochrome P450 reductase CPR and the gene encoding Vitreoscilla hemoglobin VHB, the ability and efficiency of oxygen uptake and electron transfer in the engineered bacteria are significantly improved. + / NADPH detection kit to measure NADPH Total and NADP + / NADPH ratio is used to compare the electron transfer efficiency of the engineered bacteria and the starting strain. + / NADPH concentration and volume dissolved oxygen coefficient Figure 5 shown.

[0068] The results showed that compared with the starting strain, the NADP total Levels increased by 14%, NADP + / NADPH increased by 5%. This indicates that the electron transfer efficiency in the bacteria has been significantly improved and used in the oxidation process. The volume oxygen transfer coefficient (k l a) Used to compare the oxygen uptake capacity of the engineered bacteria and the starting strain. Compared with the starting strain, the volume oxygen transfer coefficient of the engineered bacteria CVAL increased by 64%, indicating that the dissolved oxygen level in the bacteria was significantly increased.

[0069] Example 8: Optimization of the rotation speed of high-yield gibberellin GA3 engineering bacteria

[0070] The biosynthesis of gibberellin GA3 requires high rotation speed and high aeration volume to maintain mycelial growth and dissolved oxygen demand in the fermentation system. In large-scale industrial fermentation applications, in order to maintain high dissolved oxygen levels in the bioreactor, long-term high-speed stirring and high ventilation volume will also significantly increase production costs. The ability and efficiency of oxygen uptake and electron transfer of the engineered bacteria CVAL have been significantly improved compared to the starting strain. Therefore, it is necessary to investigate whether the synthesis of GA3 will be affected at different rotation speeds, so as to achieve the purpose of reducing costs in actual production. The fermentation verification was carried out at 250rpm, 220rpm, 200rpm, and 180rpm. The results are as follows: Figure 6 The results show that when the rotation speed is lowered to 220 rpm, the GA3 production remains stable, and a lower rotation speed will affect the accumulation of GA3.

[0071] Example 9: Optimization of culture conditions for high-yield gibberellin GA3 engineering bacteria

[0072] Surfactant can not only affect the mass transfer process in the fermentation liquid, but also can adjust the surface properties of the cell by adsorption on the cell surface. Adding a small amount of surfactant during the fermentation process can achieve the purpose of defoaming, and will not be toxic to the cells. The engineered bacteria CVAL was used as the starting strain for fermentation optimization, and a nonionic surfactant Tween 80 (Table 6) was added in a gradient during the fermentation process. The fermentation results showed that adding a small amount of Tween 80 (0.5g / L) can improve the fermentation efficiency, and the mycelial growth is not affected. A large amount of addition will produce cytotoxicity, thereby affecting product accumulation, and the final gibberellin GA3 output is 3.5-3.7g / L.

[0073] Table 6

[0074] Tween 80 addition amount <![CDATA[GA3 production g / L]]> 0 3.4-3.5 0.25 3.4-3.6 0.5 3.5-3.7 0.75 3.1-3.3 1.0 2.6-2.8

Claims

1. A genetically engineered bacterium producing gibberellin GA3 is constructed by the following method: using Gibberella fujikura CCTCC NO: M 2019378 as the base bacterium, enhancing the expression of the gene encoding cytochrome P450 reductase CPR and the gene encoding Vitreoscilla hemoglobin VHB in its genome, and enhancing the expression of the gene encoding the nitrogen source regulatory factor AreA and the gene encoding the global regulatory factor Lae1, to obtain the genetically engineered bacterium producing gibberellin GA3; The method for enhancing the expression of the gene encoding cytochrome P450 reductase CPR and the gene encoding Vitreoscilla hemoglobin VHB in the genome is as follows: constructing in vitro assembled complete gene expression cassettes of the CPR and VHB genes respectively, and introducing them into the chassis fungus Fusarium fujikuragi CCTCC NO: M 2019378; The complete gene expression cassette of the CPR gene was derived from the pAN7-1 plasmid. gpd Promoter and glaA The terminator is connected to the coding gene sequence of cytochrome P450 reductase, and the coding gene sequence of cytochrome P450 reductase is shown in SEQ ID No.

3. gpd The promoter nucleotide sequence is shown in SEQ ID No.

4. glaA The terminator nucleotide sequence is shown in SEQ ID No.5; The complete gene expression cassette of the VHB gene is derived from Aspergillus nidulans tef1 Promoter and tef1 The terminator is connected to the coding gene sequence of Vitreoscilla hemoglobin, the Vitreoscilla hemoglobin gene sequence is shown in SEQ ID No.1, tef1 The promoter nucleotide sequence is shown in SEQ ID No.

6. tef1 The terminator nucleotide sequence is shown in SEQ ID No.

7.

2. Use of the genetically engineered bacteria according to claim 1 in the preparation of gibberellin GA3 by microbial fermentation.

3. The use according to claim 2, characterized in that The application is: inoculating the genetically engineered bacterial strain into a fermentation medium, fermenting and culturing for 150-200 h at 25-30°C and 200-300 rpm to obtain a fermentation liquid containing gibberellin GA3, and separating and purifying the fermentation liquid to obtain the gibberellin GA3.

4. The use according to claim 3, characterized in that The fermentation medium is composed of: 70-90 g / L corn starch, 70-90 g / L rice flour, 10-30 g / L soybean flour, 10-30 g / L peanut flour, 0.5-1.5 g / L potassium sulfate, 0.5-1.5 g / L potassium dihydrogen phosphate, water as solvent, natural pH, and sterilized at 121 degrees for 30 min.

Images