A selenium- and zinc-rich yeast and its application
Saccharomyces cerevisiae mei2101.1 is cultured in selenium-rich zinc culture medium, and the problem of poor absorption and utilization of zinc and selenium in animal feed is solved. It also resists high temperature damage during the granulation process, achieving safe and efficient selenium-zinc addition, replacing traditional additives with higher toxicity.
Patent Information
- Application Number
- CN202211534959.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-02
- Publication Date
- 2025-06-17
- Estimated Expiration
- 2042-12-02
AI Technical Summary
Zinc and selenium in existing animal feeds exist in the form of inorganic salts, resulting in poor absorption and utilization and poor synergistic compatibility. Microbial additives are susceptible to high temperature damage during granulation, reducing their functionality.
Saccharomyces cerevisiae mei2101.1 was used to culture in selenium-rich zinc culture medium to obtain selenium-rich zinc yeast, which was added to animal feed as a starter, selenium-enhancing agent and zinc-enhancing agent to resist high temperature damage and reduce the toxicity of inorganic selenium-enhancing additives.
It realizes efficient enrichment of selenium zinc in yeast, enhances its high temperature resistance, reduces the toxicity of inorganic selenium zinc additives, and allows it to be safely and efficiently absorbed and utilized by animals. It replaces traditional zinc oxide and sodium selenite, and has broad application prospects.
Smart Images

Figure CN115786146B_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the field of microbial fermentation, and in particular to selenium-zinc-enriched yeast and applications thereof. Background Art
[0002] Zinc and selenium are essential trace elements for the life activities of humans and animals, and are also important components of complete animal feed. Zinc has the functions of promoting growth and development, improving reproductive capacity, significantly increasing the average daily weight gain of animals, and improving wound repair ability; selenium has the functions of improving animal growth performance, improving immune function, improving antioxidant capacity, and improving meat quality. In traditional feeds, zinc and selenium exist in the form of inorganic salts, which have many disadvantages in application, such as being unfavorable for animal absorption and utilization, and poor synergistic compatibility with other additives. In recent years, organic zinc and selenium from different sources have been adopted due to their stability and effectiveness in animal nutrition. However, at present, due to the high cost and imperfect manufacturing process, it is still difficult to enrich metal elements in industrial production and widely use microorganisms. In the past decade, the use of microorganisms as carriers to enrich trace elements necessary for humans and animals to obtain organic and low-cost trace element additives has attracted increasing attention from various countries.
[0003] Selenium-enriched yeast and zinc-enriched yeast are produced by adding selenium and zinc respectively during the yeast cultivation process. The yeast absorbs and utilizes selenium and zinc during growth, and the selenium and zinc are organically combined with the amino acids and polysaccharides in the yeast body to be converted into organic selenium and zinc, thereby eliminating the toxic side effects and gastrointestinal irritation of inorganic selenium (such as sodium selenite) and inorganic zinc on the human body, so that selenium and zinc can be efficiently and safely absorbed and utilized by the human body. At present, researchers have isolated and cultivated a variety of trace element-enriched brewer's yeast, among which selenium-enriched brewer's yeast is the most common. There are few reports of brewer's yeast that are simultaneously enriched in selenium and zinc, two essential trace elements for the human body, and the ability of existing brewer's yeast to simultaneously enrich selenium and zinc still needs to be improved.
[0004] Most animal feeds that are finely divided, dusty, poorly palatable and difficult to transport often need to be granulated through the action of heat, moisture and pressure. In particular, the high temperature during the granulation process will destroy the activity of microorganisms, thereby greatly reducing the functional properties of microbial additives in animal feed. Therefore, in order to reduce the damage to the functional properties of microbial additives caused by granulation, this requires that the microorganisms in the feed have a certain resistance to high temperature.
[0005] Therefore, a yeast strain that can simultaneously enrich selenium and zinc and has strong high temperature resistance is provided, and the selenium-zinc-enriched yeast is cultivated by the yeast and used as a fermentation agent, selenium supplement and zinc supplement to be added to animal feed that needs to be granulated. The yeast activity can be protected from the damage caused by high temperature during granulation, and the toxicity of inorganic selenium-zinc additives is greatly reduced, so that the yeast can gradually replace zinc oxide and sodium selenite as an antibiotic-free livestock and poultry feed additive, which has broad application prospects. Summary of the Invention
[0006] Therefore, the technical problem to be solved by the present invention is to provide a selenium and zinc-rich yeast, which is obtained by culturing Saccharomyces cerevisiae that can efficiently enrich selenium and zinc simultaneously and has strong high-temperature resistance, so as to resist the damage of high temperature to yeast activity during granulation and reduce the toxicity of inorganic selenium and zinc additives, thereby gradually replacing zinc oxide and sodium selenite as an antibiotic-free livestock and poultry feed additive.
[0007] To achieve the above object, the present invention provides the following technical solutions:
[0008] In the first aspect, the present invention provides a selenium and zinc-rich yeast, which is obtained by culturing Saccharomyces cerevisiae in a selenium and zinc-rich medium. The Saccharomyces cerevisiae is specifically Saccharomyces cerevisiae mei2101.1, with the preservation number CGMCC No. 25928, the preservation date: October 17, 2022, and the preservation address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.
[0009] Further, the selenium and zinc-rich medium is a yeast extract peptone dextrose medium containing 30 - 240 mg / L Se 4+ and 100 - 500 mg / L Zn 2+ .
[0010] Further, the selenium and zinc-rich medium is a yeast extract peptone dextrose medium containing 60 mg / L Se 4+ and 300 mg / L Zn 2+ .
[0011] In the second aspect, the present invention provides a preparation method of the selenium and zinc-rich yeast, including the following steps: under sterile conditions, inoculate the Saccharomyces cerevisiae into the selenium and zinc-rich medium, culture at 28 - 37 °C for 16 - 24 h, and collect the enriched cells by centrifuging at 8000 - 10000 rpm for 10 - 15 min.
[0012] In the third aspect, the present invention provides the application of the selenium and zinc-rich yeast or the selenium and zinc-rich yeast obtained by the preparation method in the preparation of feed.
[0013] In the fourth aspect, the present invention provides a piglet feed, including a basic feed and selenium and zinc-rich yeast. The basic feed includes the following raw material components in parts by weight: 15 - 20 parts of soybean meal powder, 50 - 60 parts of corn flour, 10 - 15 parts of wheat bran, 1 - 2 parts of fish meal, 0.5 - 1 part of salt, 0.5 - 1 part of bone meal. The viable count of the selenium and zinc-rich yeast added to each gram of the basic feed is 1×10 8 - 5×10 8 CFU.
[0014] Further, the piglet feed includes a basic feed and selenium-enriched zinc yeast. The basic feed includes the following raw material components in parts by weight: 20 parts of soybean meal powder, 60 parts of corn flour, 15 parts of wheat bran, 2 parts of fish meal, 0.5 part of salt, and 1 part of bone meal. The viable count of the selenium-enriched zinc yeast added to each gram of the basic feed is 1.5×10 8 CFU.
[0015] Fifthly, the present invention provides a preparation method of the piglet feed, comprising the following steps: after uniformly mixing the raw material components of the piglet feed, adding a binder, and granulating at 50-60°C to obtain the piglet feed.
[0016] Further, the binder is an aqueous solution of pregelatinized tapioca starch with a mass fraction of 10%. Further, the granulation temperature is 60°C.
[0017] Sixthly, the present invention provides a fish feed, including a basic feed and selenium-enriched zinc yeast. The basic feed includes the following raw material components in parts by weight: 35-40 parts of rice bran, 35-40 parts of wheat bran, 10-12 parts of soybean meal powder, 10-12 parts of fish meal. The viable count of the selenium-enriched zinc yeast added to each gram of the basic feed is 1×10 8 ~5×10 8 CFU.
[0018] Further, the fish feed includes a basic feed and selenium-enriched zinc yeast. The basic feed includes the following raw material components in parts by weight: 40 parts of rice bran, 38 parts of wheat bran, 10.5 parts of soybean meal powder, 10 parts of fish meal. The viable count of the selenium-enriched zinc yeast added to each gram of the basic feed is 1.5×10 8 CFU.
[0019] Seventhly, the present invention provides a preparation method of the fish feed, comprising the following steps: after uniformly mixing the raw material components of the fish feed, adding a binder, and granulating at 50-60°C to obtain the fish feed.
[0020] Further, the binder is an aqueous solution of pregelatinized tapioca starch with a mass fraction of 10%. Further, the granulation temperature is 60°C.
[0021] Eighthly, the present invention provides a feed for egg-laying chicks, including a basic feed and selenium-enriched zinc yeast. The basic feed includes the following raw material components in parts by weight: 50-60 parts of corn flour, 20-25 parts of soybean meal powder, 5-8 parts of wheat bran, 1-3 parts of fish meal, 3-5 parts of rapeseed meal powder, 1-3 parts of stone powder, 0.5-1 part of salt. The viable count of the selenium-enriched zinc yeast added to each gram of the basic feed is 1×10 8 ~5×10 8CFU.
[0022] Furthermore, the feed for egg chicks includes a basic feed and selenium-zinc-enriched yeast. The basic feed comprises the following raw material components in parts by weight: 60 parts of corn flour, 24 parts of soybean meal powder, 6.5 parts of wheat bran, 2 parts of fish meal, 4 parts of rapeseed meal powder, 1.5 parts of stone powder, and 0.5 part of table salt.
[0023] In a ninth aspect, the present invention provides a method for preparing the feed for egg chicks, comprising the following steps: after uniformly mixing the raw material components of the feed for egg chicks, adding a binder and granulating at 50-60°C to obtain the feed for egg chicks.
[0024] Furthermore, the binder is an aqueous solution of pregelatinized tapioca starch with a mass fraction of 10%. Further, the granulation temperature is 60°C.
[0025] The technical solution of the present invention has the following advantages:
[0026] 1. The selenium-zinc-enriched yeast provided by the present invention is obtained by culturing Saccharomyces cerevisiae mei2101.1 in a selenium-zinc-enriched medium. Saccharomyces cerevisiae mei2101.1 can not only convert inorganic selenium and zinc into organic selenium and zinc simultaneously, but also has high temperature resistance and acid and alkali resistance. Specifically, when Saccharomyces cerevisiae mei2101.1 simultaneously enriches selenium and zinc, the biomass is 2.58 mg / L, the selenium enrichment amount is 1.99 mg / g, and the zinc enrichment amount is 48.80 mg / g. It has strong selenium and zinc enrichment ability, can reduce the consumption of the culture medium, and save production costs. Saccharomyces cerevisiae mei2101.1 has excellent stress resistance and can tolerate high temperatures of 50-60°C, acidity with a pH of 4.5-5.6, and alkalinity with a pH of 11-12.
[0027] 2. The selenium-zinc-enriched yeast provided by the present invention, when added to animal feed that needs to be granulated as a fermentation agent, selenium supplement, and zinc supplement, can resist the damage of high temperature during granulation to the yeast activity, greatly reduce the toxicity of inorganic selenium and zinc additives, and gradually replace zinc oxide and sodium selenite as an antibiotic-free livestock and poultry breeding feed additive, with broad application prospects. Description of the Drawings
[0028] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following will briefly introduce the drawings required for the description of the specific embodiments or the prior art. Obviously, the following drawings are some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.
[0029] Figure 1This is the growth curve of Saccharomyces cerevisiae mei2101.1 in Example 2 of the present invention. Among them, (a) is the growth curve of selenium tolerance, and (b) is the growth curve of zinc tolerance;
[0030] Figure 2 This is the growth curve of Saccharomyces cerevisiae mei2101.1 and commercial Saccharomyces cerevisiae under different temperature conditions in Example 3 of the present invention. Among them, (a) is the growth curve at a temperature of 50 °C; (b) is the growth curve at a temperature of 60 °C;
[0031] Figure 3 This is the growth curve of Saccharomyces cerevisiae mei2101.1 and commercial Saccharomyces cerevisiae under different pH value conditions in Example 3 of the present invention. Among them, (a) is the growth curve at pH = 4.5; (b) is the growth curve at pH = 5.6; (c) is the growth curve at pH = 11; (d) is the growth curve at pH = 12;
[0032] Figure 4 These are the photos and optical micrographs of the piglet feed prepared in Example 5 of the present invention. Among them, a is the photo of the piglet feed, b is the optical micrograph of the piglet feed added with selenium-zinc-rich yeast, and c is the optical micrograph of the piglet feed added with commercial Saccharomyces cerevisiae;
[0033] Figure 5 These are the energy spectrum scanning results of the piglet feed added with selenium-zinc-rich yeast prepared in Example 5 of the present invention. Among them, a is the energy spectrum scanning area, and b is the energy spectrum scanning map;
[0034] Figure 6 These are the photos and optical micrographs of the fish feed prepared in Example 6 of the present invention. Among them, a is the photo of the fish feed, b is the optical micrograph of the fish feed added with selenium-zinc-rich yeast, and c is the optical micrograph of the fish feed added with commercial Saccharomyces cerevisiae;
[0035] Figure 7 These are the energy spectrum scanning results of the fish feed added with selenium-zinc-rich yeast prepared in Example 6 of the present invention. Among them, a is the energy spectrum scanning area, and b is the energy spectrum scanning map;
[0036] Figure 8 These are the photos and optical micrographs of the layer chick feed prepared in Example 7 of the present invention. Among them, a is the photo of the layer chick feed, b is the optical micrograph of the layer chick feed added with selenium-zinc-rich yeast, and c is the optical micrograph of the layer chick feed added with commercial Saccharomyces cerevisiae;
[0037] Figure 9 These are the energy spectrum scanning results of the layer chick feed added with selenium-zinc-rich yeast prepared in Example 7 of the present invention. Among them, a is the energy spectrum scanning area, and b is the energy spectrum scanning map. Detailed implementation mode
[0038] The following embodiments are provided to better further understand the present invention, which is not limited to the described optimal embodiment, and does not limit the content and protection scope of the present invention. Any product identical or similar to the present invention obtained by anyone under the inspiration of the present invention or by combining the features of the present invention with those of other prior arts falls within the protection scope of the present invention.
[0039] In the embodiment of the present invention, the yeast extract peptone dextrose medium (Haibo Biotechnology Co., Ltd., HB5193-1) consists of the following components: peptone 20g, dextrose 20g, yeast extract powder 10g, pH 6.5±0.2. The preparation method is as follows: Weigh 50.0g of this product, heat and dissolve it in 1000mL of distilled water, and autoclave at 121°C for 15 minutes for later use.
[0040] In the embodiment of the present invention, the potato dextrose agar medium (Solarbio Co., P8931-250g) consists of the following components: potato extract powder 6g, agar 20g, dextrose 20g, pH 5.6±0.2. The preparation method is as follows: Weigh 46g of this product, heat and dissolve it in 1000mL of distilled water, and autoclave at 115°C for 20 minutes for later use.
[0041] In the embodiment of the present invention, the rose bengal medium (Shanghai ShengSi Biochemical Technology Co., Ltd., MSS009) consists of the following components: peptone 5g, dextrose 10g, potassium dihydrogen phosphate 1g, magnesium sulfate 0.5g, rose bengal 0.033g, agar 20g, chloramphenicol 0.1g, pH 7.0-7.4. The preparation method is as follows: Take 36.6g of this product, add 1000mL of distilled water, soak for several minutes, heat and boil until completely dissolved, dispense, and autoclave at 121°C for 15 minutes for later use.
[0042] In the embodiment of the present invention, the commercial Saccharomyces cerevisiae is Angel high-activity dry yeast, produced by Angel Yeast Co., Ltd.
[0043] For those embodiments where specific experimental steps or conditions are not specified, the operations or conditions of the conventional experimental steps described in the literature in this field can be followed. The raw materials or instruments used are all conventional products that can be obtained through commercial purchase, including but not limited to the raw materials or instruments used in the embodiments of this application.
[0044] Example 1 Isolation and Identification of Saccharomyces cerevisiae mei2101.1
[0045] 1. Strain Isolation
[0046] Saccharomyces cerevisiae mei2101.1 was screened from soil samples collected from a high selenium-rich area where fruits and vegetables are planted in Luoshi Town, Fengcheng City, Jiangxi Province. The method for screening this strain is as follows: The collected soil samples were sieved, crushed, and mixed evenly. 20 g was weighed and added to 180 mL of yeast extract peptone dextrose medium containing 1 mg / L sodium selenite (Na2SeO3). It was placed in a shaker incubator at 28 °C and 180 r / min for 4 h, and then left standing for 30 min; 1 mL of the soil suspension was added to 9 mL of sterilized 0.85% physiological saline, and it was diluted to 10 -1 and 10 -2 . 100 μL of the diluted solution was respectively spread on solid plates of potato dextrose agar medium containing 150 mg / L sodium selenite, and it was placed upside down and cultured at 30 °C until colonies grew out. Single colonies with different colony morphological characteristics and white or pink colors were picked, and the plate streaking method was used for repeated isolation and purification to obtain a pure culture of the strain; One loop of the single colony screened was picked and added to 10 mL of yeast extract peptone dextrose medium to make a seed solution. 50 μL of the obtained seed solution was inoculated in gradient potato dextrose agar solid media with sodium selenite concentrations of 0, 30, 60, 120, and 240 mg / L respectively. Under the condition of 28 °C, it was cultured for 12 h, and its growth condition and colony color were observed, so as to screen a strain with strong growth vigor and selenium tolerance, that is, the target strain.
[0047] 2. Strain identification
[0048] The DNA of the screened strain was extracted using a kit, and PCR amplification was carried out, and then it was sent to Sangon Biotech (Shanghai) Co., Ltd. for gene sequencing. The sequencing results were compared with homologous sequences in NCBI through the BLAST tool to clarify the genus and species relationship of the strain. This strain was identified as Saccharomyces cerevisiae.
[0049] The 16S rDNA sequence of this strain is shown in SEQ ID NO.1:
[0050] TATGCAGCATCCTTGACTTACGTCGCAGTCCTCAGTCCCAGCTGGCAGTATTCCCACAGGCTATAATACTTACCGAGGCAAGCTACATTCCTATGGATTTATCCTGCCACCAAAACTGATGCTGGCCCAGTGAAATGCGAGATTCCCCTACCCACAAGGAGCAGAGGGCACAAAACACCATGTCTGATCAAATGCCCTTCCCTTTCAACAATTTCACGTACTTTTTCACTCTCTTTTCAAAGTTCTTTTCATCTTTCCATCACTGTACTTGTTCGCTATCGGTCTCTCGCCAATATTTAGCTTTAGATGGAATTTACCACCCACTTAGAGCTGCATTCCCAAACAACTCGACTCTTCGAAGGCACTTTACAAAGAACCGCACTCCTCGCCACACGGGATTCTCACCCTCTATGACGTCCTGTTCCAAGGAACATAGACAAGGAACGGCCCCAAAGTTGCCCTCTCCAAATTACAACTCGGGCACCGAAGGTACCAGATTTCAAATTTGAGCTTTTGCCGCTTCACTCGCCGTTACTAAGGCAATCCCGGTTGGTTTCTTTTCCTCCGCTCCC
[0051] Example 2: Determination of Selenium-Zinc Tolerance and Selenium-Zinc Enrichment Ability of Saccharomyces cerevisiae mei2101.1
[0052] 1. Determination of Selenium-Zinc Concentration Range Tolerated by Saccharomyces cerevisiae mei2101.1
[0053] (1) Method for Determining Selenium Concentration Range Tolerated
[0054] As described in Example 1, the target strain was obtained by inoculating the seed solution in gradient potato dextrose agar solid media with sodium selenite concentrations of 0, 30, 60, 120, and 240 mg / L for culture and screening. Its selenium tolerance is shown in Table 1.
[0055] (2) Method for Determining Zinc Concentration Range Tolerated
[0056] The Saccharomyces cerevisiae mei2101.1 screened in Example 1 was inoculated into 10 mL of yeast extract peptone dextrose medium to prepare a seed solution, which was cultured at 28 °C for 12 h. Then, 50 μL of the obtained seed solution was inoculated into potato dextrose agar solid media with zinc chloride concentrations of 0, 200, 300, 400, and 500 mg / L, and cultured at 28 °C for 12 h. The growth condition was observed, and the results are shown in Table 1.
[0057] (3) Results
[0058] Table 1 Tolerance of Saccharomyces cerevisiae mei2101.1 to selenium and zinc
[0059]
[0060]
[0061] Note: + represents the growth condition of the strain, and the more +, the better the growth.
[0062] As shown in Table 1, Saccharomyces cerevisiae mei2101.1 can tolerate sodium selenite concentrations of 0 - 240 mg / L, has strong selenium tolerance, and this strain can tolerate zinc chloride concentrations of 0 - 500 mg / L, with strong zinc tolerance.
[0063] 2. Determination of the growth curves of Saccharomyces cerevisiae mei2101.1 with selenium and zinc tolerance
[0064] (1) Method for determining the growth curve with selenium tolerance
[0065] The Saccharomyces cerevisiae mei2101.1 screened in Example 1 was inoculated into yeast extract peptone dextrose medium for activation for 12 h, and then subjected to 10 -1 - 10 -10 gradient serial dilution and coating. The plate with evenly dispersed single colonies was selected for counting, and then the viable bacteria count in the medium was estimated based on the number of formed colonies and the dilution factor. The activated bacterial solution was diluted to a viable bacteria count of approximately 1×10 5 CFU / mL, and then 200 μL of the bacterial solution was added to the well plates with sodium selenite concentrations of 0, 30, 60, 120, and 240 mg / L respectively. The growth curve was determined using a microplate reader at a detection wavelength of 600 nm, and the results are as Figure 1 shown in a.
[0066] (2) Method for determining the growth curve with zinc tolerance
[0067] The Saccharomyces cerevisiae mei2101.1 screened in Example 1 was inoculated into yeast extract peptone dextrose medium for activation for 12 h, and then subjected to 10 -1 - 10 -10Gradient serial dilution coating was performed, and plates with evenly dispersed single colonies were selected for counting. Single cells grew and reproduced to form colonies visible to the naked eye, and then the viable cell count in the medium was estimated based on the number of colonies formed and the dilution factor. The activated bacterial solution was diluted to a viable cell count of approximately 1×10 5 CFU / mL, and then 200 μL of the bacterial solution was added to wells with zinc chloride concentrations of 0, 200, 300, 400, and 500 mg / L respectively. The growth curve was measured using a microplate reader, and the results are shown in Figure 1 Figure b.
[0068] (3) Results
[0069] As Figure 1 shown, Saccharomyces cerevisiae mei2101.1 can grow in an environment with sodium selenite concentrations ranging from 0 to 240 mg / L, and this strain can grow in an environment with zinc chloride concentrations ranging from 0 to 500 mg / L.
[0070] 3. Determination of zinc and selenium enrichment amounts in Saccharomyces cerevisiae mei2101.1
[0071] (1) Method for determining the enrichment amount during selenium enrichment
[0072] ① Preparation of selenium-enriched medium: Sodium selenite was added to the yeast extract peptone dextrose medium to a concentration of 60 mg / L. The medium was sterilized and cooled for later use;
[0073] ② Inoculation and cultivation: Under sterile conditions, Saccharomyces cerevisiae mei2101.1 was inoculated into the selenium-enriched medium and cultured at 28 °C for 24 h;
[0074] ③ Collection of mycelia: The cultured cells were centrifuged at 8000 rpm for 10 min, collected, washed 3 times with physiological saline, and dried and weighed;
[0075] ④ Determination of selenium enrichment amount: According to the national food safety standard "GB 5009.93-2017" Determination of selenium in foods by hydride generation atomic fluorescence spectrometry, the results are shown in Table 2.
[0076] (2) Method for determining the enrichment amount during zinc enrichment
[0077] ① Preparation of zinc-enriched medium: Zinc chloride was added to the yeast extract peptone dextrose medium to a concentration of 300 mg / L. The medium was sterilized and cooled for later use;
[0078] ② Inoculation and cultivation: Under sterile conditions, Saccharomyces cerevisiae mei2101.1 was inoculated into the zinc-enriched medium and cultured at 28 °C for 24 h;
[0079] ③ Collect mycelium: The cultured cells after enrichment culture were collected by centrifugation at 8000 rpm for 10 min, washed 3 times with physiological saline, and dried and weighed.
[0080] ④ Determination of zinc enrichment amount: The cells were digested by wet digestion according to the determination of zinc in foods in GB 5009.14-2017 National Food Safety Standard, and the zinc content in the cells was determined by flame atomic absorption spectrometry. The results are shown in Table 2.
[0081] (3) Determination method of enrichment amount when selenium and zinc are enriched simultaneously
[0082] ① Preparation of selenium-zinc enriched medium: Sodium selenite and zinc chloride were added to the yeast extract peptone dextrose medium to make their concentrations 60 mg / L and 300 mg / L respectively. The medium was sterilized and cooled for standby.
[0083] ② Inoculation and culture: Under sterile conditions, Saccharomyces cerevisiae mei2101.1 was inoculated into the selenium-zinc enriched medium and cultured at 28 °C for 24 h.
[0084] ③ Collect mycelium: The cultured cells after enrichment culture were collected by centrifugation at 8000 rpm for 10 min, washed 3 times with physiological saline, and dried and weighed.
[0085] ④ Determination of selenium-zinc enrichment amount: According to "GB 5009.93-2017" National Food Safety Standard, the selenium content in the cells was determined by hydride generation atomic fluorescence spectrometry in foods; according to the determination of zinc in foods in the national standard "GB 5009.14-2017", the cells were digested by wet digestion, and the zinc content in the cells was determined by flame atomic absorption spectrometry. The results are shown in Table 2.
[0086] (4) Results
[0087] Table 2 Biomass and enrichment amount of Saccharomyces cerevisiae mei2101.1 in the enrichment medium
[0088]
[0089] As shown in Table 2, when Saccharomyces cerevisiae mei2101.1 enriches selenium and zinc separately, the biomass is 1.98 mg / L and 4.13 mg / L respectively, and the enrichment amounts are as high as 1.71 mg / g and 40.25 mg / g respectively. When selenium and zinc are enriched simultaneously, the biomass is 2.58 mg / L, the selenium enrichment amount is 1.99 mg / g, and the zinc enrichment amount is 48.80 mg / g, proving that Saccharomyces cerevisiae mei2101.1 has the ability to efficiently enrich selenium and zinc simultaneously.
[0090] Example 3 Stress resistance analysis of Saccharomyces cerevisiae mei2101.1
[0091] 1. Stress resistance analysis to high temperature
[0092] The Saccharomyces cerevisiae mei2101.1 was inoculated into a conical flask containing 50 mL of yeast extract peptone dextrose medium and cultured in a constant temperature shaker incubator at 28 °C until the logarithmic phase of activation. The activated bacterial solution was inoculated into the sterilized yeast extract peptone dextrose medium and cultured at temperatures of 50 °C and 60 °C respectively. The absorbance at a wavelength of 600 nm was measured every 1 hour using a microplate reader (3 independent replicates). The growth curve of Saccharomyces cerevisiae mei2101.1 was plotted based on the change in its absorbance value, and commercial Saccharomyces cerevisiae was used as the control group. The results are as Figure 2 shown. At a temperature of 50 °C, the growth curve of Saccharomyces cerevisiae mei2101.1 first rose and then stabilized, while at a temperature of 60 °C, the growth curve of Saccharomyces cerevisiae mei2101.1 continued to rise. This indicates that Saccharomyces cerevisiae mei2101.1 can still grow under high-temperature cultivation at 50 °C and 60 °C. And regardless of whether the temperature is 50 or 60 °C, the growth curve of Saccharomyces cerevisiae mei2101.1 has always been higher than that of commercial Saccharomyces cerevisiae, which further indicates that Saccharomyces cerevisiae mei2101.1 has a high resistance to high temperatures.
[0093] 2. Analysis of stress resistance to acidity and alkalinity
[0094] The Saccharomyces cerevisiae mei2101.1 was inoculated into a conical flask containing 50 mL of yeast extract peptone dextrose medium and cultured in a constant temperature shaker incubator at 28 °C until the logarithmic phase of activation. The activated bacterial solution was inoculated into yeast extract peptone dextrose media with different pH values (4.5, 5.6, 11, 12) and continuously cultured at 28 °C for 20 h. The absorbance at a wavelength of 600 nm was measured every 1 hour using a microplate reader (3 independent replicates). The growth curve of Saccharomyces cerevisiae mei2101.1 was plotted based on the change in its absorbance value, and commercial Saccharomyces cerevisiae was used as the control group. The results are as Figure 3 shown. Under acidic conditions with a pH of 4.5 or 5.6, the growth curve of Saccharomyces cerevisiae mei2101.1 first rose and then stabilized, while under acidic conditions with a pH of 11 or 12, the growth curve of Saccharomyces cerevisiae mei2101.1 first rose and then slightly declined. This indicates that Saccharomyces cerevisiae mei2101.1 can still grow in acidic or alkaline environments. And regardless of whether the growth environment is acidic or alkaline, the growth curve of Saccharomyces cerevisiae mei2101.1 has always been higher than that of commercial Saccharomyces cerevisiae, which further indicates that Saccharomyces cerevisiae mei2101.1 has a high resistance to acids and alkalis.
[0095] Example 4 Preparation of selenium- and zinc-enriched yeast
[0096] This example provides a method for preparing selenium- and zinc-enriched yeast using Saccharomyces cerevisiae mei2101.1:
[0097] Under aseptic conditions, Saccharomyces cerevisiae mei2101.1 was inoculated into a selenium- and zinc-enriched medium and cultured at 28 °C for 24 h. The cultured cells were centrifuged at 8000 rpm for 10 min, and the cell pellet was collected to obtain selenium- and zinc-enriched yeast.
[0098] The preparation method of the selenium- and zinc-enriched medium was as follows: Sodium selenite and zinc chloride were added to a yeast extract peptone dextrose medium to a concentration of 60 mg / L and 300 mg / L, respectively. The medium was sterilized and cooled for later use.
[0099] Example 5 Application of Selenium- and Zinc-Enriched Yeast in the Preparation of Piglet Feed
[0100] 1. Preparation of Piglet Feed
[0101] Steps for preparing piglet feed:
[0102] Raw material mixing: 20 g of soybean meal powder, 60 g of corn flour, 15 g of wheat bran, 2 g of fish meal, 0.5 g of salt, and 1 g of bone meal were mixed evenly to obtain a basal feed. According to the viable count of 1.5×10 8 CFU per gram of the basal feed, the selenium- and zinc-enriched yeast cell pellet prepared in Example 4 (with a viable count of 9.4×10 9 CFU / g) was added to the basal feed to obtain a raw material mixture.
[0103] (2) Granulation: The raw material mixture was put into a granulator, and 15 g of a binder (an aqueous solution of pregelatinized tapioca starch with a mass concentration of 10%) was added. Granulation was carried out at a granulation temperature of 60 °C to obtain piglet feed supplemented with selenium- and zinc-enriched yeast.
[0104] As a comparison, a piglet feed supplemented with commercial Saccharomyces cerevisiae was prepared by replacing the selenium- and zinc-enriched yeast with a cell pellet of commercial Saccharomyces cerevisiae according to the aforementioned method and ratio (added at the same viable count).
[0105] The preparation method of the cell pellet of the aforementioned commercial Saccharomyces cerevisiae was as follows: Commercial Saccharomyces cerevisiae powder was inoculated into a yeast extract peptone dextrose medium and activated for 12 h. The cultured cell suspension was centrifuged at 8000 rpm for 10 min, and the precipitate was collected to obtain the cell pellet of commercial Saccharomyces cerevisiae (with a viable count of 7.3×10 9 CFU / g).
[0106] 2. Observation of the Morphology and Microscopic Structure of Piglet Feed
[0107] The prepared piglet feed supplemented with selenium- and zinc-enriched yeast was photographed with a camera, and the photo is as shown in Figure 4 a.
[0108] The microscopic structures of the piglet feed added with selenium-enriched zinc yeast and the piglet feed added with commercial Saccharomyces cerevisiae were observed as follows: Dissolve 0.5 g of piglet feed in 25 mL of sterilized physiological saline, suck a drop of the suspension onto a glass slide, cover it with a coverslip, and observe it under a microscope (400 times magnification).
[0109] The optical microscopic images of the piglet feed added with selenium-enriched zinc yeast and the piglet feed added with commercial Saccharomyces cerevisiae are shown in Figure 4 Figures 4b and 4c respectively. The arrows in the figures point to the yeast. It can be seen that the number of yeast cells in the feed suspension added with selenium-enriched zinc yeast is significantly higher than that in the feed suspension added with commercial Saccharomyces cerevisiae, which proves that after granulation, the survival rate of the selenium-enriched zinc yeast provided by the present invention in piglet feed is higher than that of commercial Saccharomyces cerevisiae.
[0110] 3. Determination of viable bacteria count in piglet feed
[0111] Disperse 0.5 g of feed in 10 mL of physiological saline, perform serial dilutions in gradients of 10 -1 ~10 -6 , coat them on Rose Bengal medium respectively, culture them at 28 °C for 24 h, select the plates with evenly dispersed single colonies for counting, and then calculate the viable bacteria count in the medium based on the number of colonies formed and the dilution factor. Use the piglet feed raw material mixture without granulation as the control group. The ratio of the actual viable bacteria count of the feed to the measured viable bacteria count of the control group is the yeast survival rate. The results are shown in Table 3.
[0112] Table 3 Effects of piglet feed granulation on yeast activity
[0113]
[0114] As shown in Table 3, the yeast survival rate in the piglet feed added with selenium-enriched zinc yeast is higher than that in the piglet feed added with commercial Saccharomyces cerevisiae, and the survival rates are 8.6% and 23.1% respectively. This result is consistent with the result observed by optical microscopy, which proves that selenium-enriched zinc yeast is more resistant to the damage of high temperature during granulation to its activity than commercial Saccharomyces cerevisiae, which is related to the high temperature resistance and stress resistance of selenium-enriched zinc yeast.
[0115] 4. Verification of selenium and zinc elements in piglet feed
[0116] Scanning electron microscopy energy spectrum analysis: Freeze-dry and slice the piglet feed added with selenium-enriched zinc yeast, spray gold on it, and then place it in a field emission scanning electron microscope for energy spectrum scanning. The scanning area is shown in Figure 5 Figure 5a, and the scanning result is shown in Figure 5 Figure 5b. It can be seen from the energy spectrum scanning map that zinc and selenium elements exist in the piglet feed added with selenium-enriched zinc yeast, which proves that the addition of selenium-enriched zinc yeast makes the piglet feed have the function of supplementing selenium and zinc.
[0117] Application of Selenium- and Zinc-Enriched Yeast in Preparation of Fish Feed
[0118] 1. Preparation of Fish Feed
[0119] Steps for preparing fish feed:
[0120] (1) Raw material mixing: Mix 40 g of rice bran, 38 g of wheat bran, 10.5 g of soybean meal powder, and 10 g of fish meal evenly to obtain a basic feed. Add the selenium- and zinc-enriched yeast bacterial sludge prepared in Example 4 (with a viable count of 9.4×10 8 CFU) to the basic feed according to 1.5×10 viable counts per gram of the basic feed to obtain a raw material mixture; 9 CFU / g).
[0121] (2) Granulation: Put the raw material mixture into a granulator, add 15 g of binder (an aqueous solution of pregelatinized tapioca starch with a mass concentration of 10%), and granulate at a granulation temperature of 60°C to obtain a fish feed added with selenium- and zinc-enriched yeast.
[0122] For comparison, use the bacterial sludge of commercial brewer's yeast to replace the selenium- and zinc-enriched yeast and prepare a fish feed added with commercial brewer's yeast according to the aforementioned method and ratio (adding according to the same viable count).
[0123] The preparation method of the aforementioned bacterial sludge of commercial brewer's yeast is as follows: Inoculate commercial brewer's yeast powder into yeast extract peptone dextrose medium and activate it for 12 h. After centrifuging the activated culture solution at 8000 rpm for 10 min, collect the precipitate to obtain the bacterial sludge of commercial brewer's yeast (with a viable count of 7.3×10 9 CFU / g).
[0124] 2. Observation of Morphology and Microscopic Structure of Fish Feed
[0125] Take a photo of the prepared fish feed added with selenium- and zinc-enriched yeast with a camera, and its photo is as shown in Figure 6 a.
[0126] Observe the microscopic structures of the fish feed added with selenium- and zinc-enriched yeast and the fish feed added with commercial brewer's yeast as follows: Dissolve 0.5 g of fish feed in 25 mL of sterilized physiological saline, suck a drop of the suspension onto a glass slide, cover it with a cover glass, and observe it under a microscope (400 times magnification).
[0127] The optical microscopic images of the fish feed added with selenium- and zinc-enriched yeast and the fish feed added with commercial brewer's yeast are respectively as shown in Figure 6As shown in Figures 6b and 6c, the arrow in the figure points to yeast. It can be seen that the number of yeast cells in the feed suspension supplemented with selenium and zinc-enriched yeast is significantly higher than that in the feed suspension supplemented with commercial brewer's yeast, proving that after granulation, the survival rate of the selenium and zinc-enriched yeast provided by the present invention in fish feed is higher than that of commercial brewer's yeast.
[0128] 3. Determination of viable bacteria count in fish feed
[0129] Disperse 0.5 g of feed in 10 mL of physiological saline, and perform 10 -1 ~10 -6 gradient serial dilutions, spread them on Rose Bengal medium respectively, culture at 28 °C for 24 h, select the plates with evenly dispersed single colonies for counting, and then calculate the viable bacteria count in the medium based on the number of colonies formed and the dilution factor. Use the ungranulated fish feed raw material mixture as the control group. The ratio of the actual viable bacteria count of the feed to the measured viable bacteria count of the control group is the yeast survival rate, and the results are shown in Table 4.
[0130] Table 4 Effect of fish feed granulation on yeast activity
[0131]
[0132] As shown in Table 4, the yeast survival rate in the fish feed supplemented with selenium and zinc-enriched yeast is higher than that in the fish feed supplemented with commercial brewer's yeast, and the survival rates are 4.3% and 15.7% respectively. This result is consistent with the result observed by optical microscopy, proving that selenium and zinc-enriched yeast is more resistant to the damage of high temperature during granulation to its activity than commercial brewer's yeast, which is related to the high temperature resistance and stress resistance of selenium and zinc-enriched yeast.
[0133] 4. Verification of selenium and zinc elements in fish feed
[0134] Scanning electron microscopy energy spectrum analysis: Freeze-dry and slice the fish feed supplemented with selenium and zinc-enriched yeast, spray gold, and then place it in a field emission scanning electron microscope for energy spectrum scanning. The scanning area is as shown in Figure 7 Figure a, and the scanning result is as shown in Figure 7 Figure b. It can be seen from the energy spectrum scanning map that zinc and selenium elements exist in the fish feed supplemented with selenium and zinc-enriched yeast, proving that the addition of selenium and zinc-enriched yeast makes the fish feed have the function of supplementing selenium and zinc.
[0135] Example 7 Application of selenium and zinc-enriched yeast in the preparation of egg chick feed
[0136] 1. Preparation of egg chick feed
[0137] Steps for preparing egg chick feed:
[0138] (1) Raw material mixing: Mix 60 g of corn flour, 24 g of soybean meal powder, 6.5 g of wheat bran, 2 g of fish meal, 4 g of rapeseed meal powder, 1.5 g of limestone powder, and 0.5 g of table salt evenly to obtain the basic feed. According to the viable count of 1.5×10 8 CFU per gram of the basic feed, add the selenium-enriched zinc yeast mud prepared in Example 4 (viable count is 9.4×10 9 CFU / g) to the basic feed to obtain the raw material mixture;
[0139] (2) Pelleting: Put the raw material mixture into a pellet mill, add 15 g of binder (an aqueous solution of pregelatinized tapioca starch with a mass concentration of 10%), and pellet at a pelleting temperature of 60 °C to obtain the feed for laying hens supplemented with selenium-enriched zinc yeast.
[0140] For comparison, use the yeast mud of commercial Saccharomyces cerevisiae to replace the selenium-enriched zinc yeast and prepare the feed for laying hens supplemented with commercial Saccharomyces cerevisiae according to the aforementioned method and ratio (adding according to the same viable count).
[0141] The preparation method of the aforementioned yeast mud of commercial Saccharomyces cerevisiae is as follows: Inoculate commercial Saccharomyces cerevisiae powder into yeast extract peptone dextrose medium and activate it for 12 h. After centrifuging the activated culture solution at 8000 rpm for 10 min, collect the precipitate to obtain the yeast mud of commercial Saccharomyces cerevisiae (viable count is 7.3×10 9 CFU / g).
[0142] 2. Observation on the morphology and microstructure of the feed for laying hens
[0143] Take a photo of the prepared feed for laying hens supplemented with selenium-enriched zinc yeast with a camera, and its photo is as Figure 8 shown in a.
[0144] Observe the microstructure of the feed for laying hens supplemented with selenium-enriched zinc yeast and the feed for laying hens supplemented with commercial Saccharomyces cerevisiae according to the following method: Dissolve 0.5 g of the feed for laying hens in 25 mL of sterilized physiological saline, suck a drop of the suspension onto a glass slide, cover it with a cover glass, and observe under a microscope (400 times).
[0145] The optical microscopic images of the feed for laying hens supplemented with selenium-enriched zinc yeast and the feed for laying hens supplemented with commercial Saccharomyces cerevisiae are respectively as Figure 8 shown in b and 8c. The arrows in the figure point to the yeast. It can be seen that the number of yeast cells in the feed suspension supplemented with selenium-enriched zinc yeast is significantly higher than that in the feed suspension supplemented with commercial Saccharomyces cerevisiae, which proves that after pelleting, the survival rate of the selenium-enriched zinc yeast provided by the present invention in the feed for laying hens is higher than that of commercial Saccharomyces cerevisiae.
[0146] 3. Determination of the viable count of the feed for laying hens
[0147] Disperse 0.5 g of feed in 10 mL of physiological saline and perform 10 -1 ~10 -6 gradient serial dilutions, spread them on Rose Bengal medium respectively, culture at 28 °C for 24 h, select the plates with evenly dispersed single colonies for counting, and then calculate the viable bacteria count in the medium based on the number of colonies formed and the dilution factor. Use the ungranulated feed raw material mixture for egg chicks as the control group. The ratio of the actual viable bacteria count of the feed to the measured viable bacteria count of the control group is the yeast survival rate, and the results are shown in Table 5 below.
[0148] Table 5 Effects of granulation of feed for egg chicks on yeast activity
[0149]
[0150] As shown in Table 5, the yeast survival rate in the feed for egg chicks supplemented with selenium-zinc-enriched yeast is higher than that in the feed for egg chicks supplemented with commercial brewing yeast, and the survival rates are 9.3% and 17.3% respectively. This result is consistent with the result observed by optical microscopy, proving that selenium-zinc-enriched yeast is more resistant to the damage of high temperature during granulation to its activity than commercial brewing yeast, which is related to the high-temperature stress resistance of selenium-zinc-enriched yeast.
[0151] 4. Verification of selenium and zinc elements in the feed for egg chicks
[0152] Scanning electron microscopy energy spectrum analysis: Freeze-dry and section the feed for egg chicks supplemented with selenium-zinc-enriched yeast, spray gold and then place it in a field emission scanning electron microscope for energy spectrum scanning. The scanning area is as shown in Figure 9 a, and the scanning result is as shown in Figure 9 b. It can be seen from the energy spectrum scanning pattern that zinc and selenium elements exist in the feed for egg chicks supplemented with selenium-zinc-enriched yeast, proving that the addition of selenium-zinc-enriched yeast makes the feed for egg chicks have the function of supplementing selenium and zinc.
[0153] Obviously, the above embodiments are only examples clearly described and not limitations on the implementation manners. For those of ordinary skill in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation manners here. And the obvious changes or modifications derived therefrom are still within the protection scope of the present invention.
Claims
1. A selenium- and zinc-enriched yeast mycelium, characterized in that The selenium- and zinc-enriched yeast mycelium is obtained by culturing Saccharomyces cerevisiae in a selenium- and zinc-enriched medium. The Saccharomyces cerevisiae is specifically Saccharomyces cerevisiae mei2101.1, with the preservation number of CGMCC No. 25928. The selenium- and zinc-enriched medium is a yeast extract peptone dextrose medium containing 30-240 mg / L Se 4+ and 100-500 mg / L Zn 2+ .
2. A method for preparing the selenium- and zinc-enriched yeast mycelium according to claim 1, characterized in that It includes the following steps: Under aseptic conditions, inoculate the Saccharomyces cerevisiae into the selenium- and zinc-enriched medium, culture at 28-37°C for 16-24 h, and collect the cultured cells after centrifuging at 8000-10000 rpm for 10-15 min.
3. Use of the selenium- and zinc-enriched yeast mycelium according to claim 1 or the selenium- and zinc-enriched yeast mycelium obtained by the preparation method according to claim 2 in the preparation of feed.
4. A piglet feed, characterized in that It includes a basic feed and the selenium- and zinc-enriched yeast mycelia described in claim 1. The basic feed includes the following raw material components in parts by weight: 15-20 parts of soybean meal powder, 50-60 parts of corn flour, 10-15 parts of wheat bran, 1-2 parts of fish meal, 0.5-1 part of table salt, and 0.5-1 part of bone meal. The viable count of the selenium- and zinc-enriched yeast mycelia added to each gram of the basic feed is 1×10 8 -5×10 8 CFU.
5. A method for preparing the piglet feed according to claim 4, characterized in that It includes the following steps: Mix the raw material components of the piglet feed evenly, add a binder, and granulate at 50-60°C to obtain the piglet feed.
6. A fish feed, characterized in that Comprising a basal diet and the selenium- and zinc-enriched yeast mycelia as described in claim 1, the basal diet comprising the following raw material components in parts by weight: 35-40 parts of rice bran, 35-40 parts of wheat bran, 10-12 parts of soybean meal powder, 10-12 parts of fish meal, and the viable count of the selenium- and zinc-enriched yeast mycelia added to each gram of the basal diet being 1×10 8 -5×10 8 CFU.
7. A method for preparing the fish feed according to claim 6, characterized in that It includes the following steps: Mix the raw material components of the fish feed evenly, add a binder, and granulate at 50-60°C to obtain the fish feed.
8. A layer chick feed, characterized in that It includes a basic feed and the selenium- and zinc-rich yeast mycelia described in claim 1. The basic feed comprises raw material components in the following parts by weight: 50-60 parts of corn flour, 20-25 parts of soybean meal powder, 5-8 parts of wheat bran, 1-3 parts of fish meal, 3-5 parts of rapeseed meal powder, 1-3 parts of stone powder, 0.5-1 part of table salt, and the viable count of the selenium- and zinc-rich yeast mycelia added to each gram of the basic feed is 1×10 8 -5×10 8 CFU.
9. A method for preparing the layer chick feed according to claim 8, characterized in that It includes the following steps: Mix the raw material components of the layer chick feed evenly, add a binder, and granulate at 50-60°C to obtain the layer chick feed.
Citation Information
Patent Citations
Preparation method of saccharomyces cerevisiae rich in iron, zinc and selenium
CN112195113A
Saccharomyces cerevisiae and application thereof
CN115948261A