A strain of purple tularensis D2 and its application

Abstract

The present invention relates to a purple Talaromyces D2 and an application thereof, and belongs to the field of microbial technology. The purple Talaromyces D2 disclosed in the present invention has a deposit number of GDMCC NO.66320. The strain is obtained by isolating from soil and domesticating, and its zinc tolerance concentration can reach 2g / L, and the bacterium can efficiently convert inorganic zinc into organic active zinc that is easily absorbed and utilized by the human body. The organic zinc prepared by the bacterium has significant ABTS free radical scavenging ability, and at the same time has tyrosine kinase and 5-α reductase inhibitory ability; it shows that the organic zinc prepared by purple Talaromyces D2 can be used to prepare zinc supplement health products, and can also be used as a raw material for cosmetic active substances with both free radical scavenging and whitening effects, and has broad market application prospects.

Description

Technical Field

[0001] The present invention relates to the field of microbial technology, and in particular to Talaromyces purpureogenus D2 and applications thereof. Background Art

[0002] Zinc (Zn) is an essential trace mineral, second only to iron in abundance in the human body and distributed throughout all tissues and body fluids. As a cofactor or structural component of various enzymes, zinc is widely involved in key physiological processes such as metabolism, immunity, neural signaling, and DNA synthesis and repair.

[0003] Since the human body cannot synthesize or store zinc, it must be continuously supplemented through diet. Zinc supplementation for the human body is mainly achieved through exogenous supplementation of inorganic or organic zinc preparations, and the bioavailability of different zinc preparations varies significantly. Although inorganic zinc is less expensive, it has poor absorption efficiency and is prone to cause adverse gastrointestinal reactions. In contrast, zinc-rich bacteria, as a new way of zinc supplementation, can organically combine zinc with proteins and polysaccharides in the bacteria through the enrichment and conversion of inorganic zinc by microorganisms to form biological zinc, thereby significantly improving the bioavailability of zinc and reducing adverse reactions to the human body.

[0004] In addition, studies have shown that biogenic zinc can play multiple roles in cosmetics and skin care products through its moisturizing, oil control, and anti-oxidation mechanisms. Compared with inorganic zinc, biogenic zinc usually exists in an organic form, which not only improves its bioavailability but also reduces irritation to the skin.

[0005] Due to the aforementioned advantages of biogenic zinc, microbial zinc enrichment has become a research hotspot in recent years. To meet the broad market application prospects of organic zinc, it is urgent to isolate and obtain microorganisms that can efficiently enrich zinc, which is of great significance to the development of both the food and cosmetics industries. Summary of the Invention

[0006] The present invention aims to overcome the shortcomings of the prior art by providing a strain of Talaromyces purpurogenus D2 that efficiently enriches organic zinc. This strain, isolated from soil and domesticated, has a zinc tolerance of up to 2 g / L and can efficiently convert inorganic zinc into bioavailable zinc that is readily absorbed and utilized by the human body. After fermentation, 2.5 g of lyophilized powder containing organic zinc is produced per liter of fermentation broth, with an organic zinc content of 111.4 mg / g. The organic zinc converted by the Talaromyces purpurogenus accounts for approximately 55.7% of the zinc content in the culture medium.

[0007] In the first aspect, the present invention provides Talaromyces purpureogenus D2, which was deposited in the Guangdong Provincial Microbiological Culture Collection Center on May 13, 2025, with the deposit number GDMCC NO.66320, and the deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0008] In a second aspect, the present invention provides a method for fermenting and producing organic zinc using the Talaromyces D2 described in the first aspect, comprising: 1) inoculating the purple-producing Talaromyces D2 into a liquid fermentation medium supplemented with zinc salt for fermentation and culturing;

[0009] 2) After fermentation is complete, the fermentation broth is centrifuged; the supernatant is separated through a 200 Da nanofiltration membrane, the retentate is collected, and the nanofiltration membrane is washed with water to obtain a nanofiltration membrane cleaning solution. The nanofiltration membrane cleaning solution and the retentate are combined to obtain an extracellular organic zinc solution; the precipitate after centrifugation is resuspended and ultrasonically treated, and the bacterial extract is collected by centrifugation;

[0010] 3) Combine the bacterial extract and the extracellular organic zinc solution and freeze-dry them.

[0011] Preferably, the zinc salt is zinc sulfate; and the liquid fermentation medium to which the zinc salt is added contains 2-8 g / L of glucose, 2-8 g / L of yeast extract, 8-15 g / L of malt extract, and a zinc concentration of 0.5-2 g / L.

[0012] More preferably, the fermentation is carried out at 15-30°C.

[0013] Furthermore, the method for producing organic zinc by fermentation using the Bacillaceae D2 described in the first aspect includes:

[0014] (1) Strain activation: The frozen culture of Zn-rich T. purpurogenum strain D2 was inoculated onto a PDA plate and cultured at 28°C for 7 days;

[0015] (2) Seed solution preparation: The activated spores of the zinc-rich purple Talaromyces strain D2 were transferred to PDB medium and cultured overnight at 28°C and 180 rpm to obtain seed solution;

[0016] (3) Fermentation: 5-10% of the obtained seed liquid is inoculated into a liquid fermentation medium supplemented with zinc salt for fermentation and culture at 15-30°C for 3-7 days;

[0017] (4) Preparation of organic zinc from purple cynaroid fungus:

[0018] ① After fermentation is completed, centrifuge the fermentation liquid at 8000 rpm for 30 minutes;

[0019] ② The supernatant after centrifugation was separated by a 200Da nanofiltration membrane, and the retentate was collected. The nanofiltration membrane was washed with ultrapure water to obtain a nanofiltration membrane cleaning solution. The nanofiltration membrane cleaning solution and the retentate were combined to obtain an extracellular organic zinc solution. The pellet after centrifugation was resuspended and ultrasonicated at 600w for 15-30min. The bacterial extract was collected by centrifugation and the cell debris was discarded after repeating this step three times.

[0020] ③ Combine the bacterial extract and the extracellular organic zinc solution and freeze-dry them.

[0021] In a third aspect, the present invention provides a product comprising the Bacillaceae D2 described in the first aspect.

[0022] In a fourth aspect, the present invention provides use of the organic zinc prepared by the method described in the second aspect in the preparation of food, health products or cosmetics.

[0023] Preferably, the health care product is a zinc supplement health care product, and the cosmetics are oil-control, antioxidant, and whitening cosmetics.

[0024] Compared with the prior art, the present invention has the following beneficial effects:

[0025] The inventors isolated, purified, and further domesticated T. purpurogenum D2 from soil, which can tolerate zinc concentrations up to 2g / L and efficiently converts inorganic zinc into organic, active zinc that is easily absorbed and utilized by the human body. Fermentation of this strain yields 2.5g of freeze-dried powder containing organic zinc per liter of fermentation broth, with an organic zinc content of 111.4mg / g. The organic zinc converted by T. purpurogenum accounts for approximately 55.7% of the zinc content in the culture medium.

[0026] 2) The organic zinc obtained by fermentation of T. purpurogenum D2 was experimentally verified to have significant ABTS free radical scavenging ability and tyrosine kinase and 5-α-reductase inhibitory abilities. This suggests that this bacterium can be used to prepare zinc supplements and as a raw material for cosmetic active ingredients with both free radical scavenging and whitening effects, showing broad application prospects.

[0027] Biomaterial Deposit

[0028] A strain of purple blue fungus D2, classified and named Talaromyces purpureogenus, was deposited in the Guangdong Provincial Microbiological Culture Collection on May 13, 2025, with the deposit number GDMCC NO.66320, and the deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 The growth of purple-producing fungi on culture media containing different concentrations of zinc sulfate. DETAILED DESCRIPTION

[0030] In order to better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments.

[0031] Unless otherwise specified, other materials and reagents used in the examples can be obtained from commercial sources.

[0032] The culture medium involved in the present invention is:

[0033] PDA medium: 20 g / L glucose, 200 g / L potato, 20 g / L agar, distilled water, natural pH.

[0034] PDB liquid medium: 20 g / L glucose, 200 g / L potato, distilled water, natural pH.

[0035] Liquid fermentation medium: glucose 8 g / L, yeast extract 2 g / L, malt extract 10 g / L, ZnSO4 0.5 g / L, distilled water.

[0036] All the above culture media must undergo a sterilization step, with the sterilization conditions being 121°C for 20 min.

[0037] Example 1: Isolation, purification and domestication of efficient zinc-enriched bacteria

[0038] (1) Soil samples were collected near the exit of Guangzhou Taihe subway station and sterilized with saline solution from 10 to 10 -6 Perform gradient dilution to obtain soil dilution solution, and then take 100 μl of the dilution factor of 10 -3 , 10 -4 , 10 -5 , 10 -6 The dilutions were spread onto potato dextrose agar (PDA) containing 0.1 g / L zinc sulfate and incubated at 28°C until colonies were observed. Individual colonies with distinct morphological characteristics and good growth were selected and repeatedly isolated and purified using the plate streak method to obtain purified strains, which were then numbered and recorded. The purified strains were inoculated into a 30% glycerol solution and stored at -80°C.

[0039] (2) The purified strain was inoculated on PDA culture medium containing 0.2, 0.3, 0.4, 0.5, 1 and 2 g / L zinc sulfate in sequence, and finally zinc-rich bacteria D2 that could grow on a plate containing 2 g / L zinc sulfate was obtained.

[0040] (3) The zinc-rich bacteria D2 was inoculated into PDB liquid medium and cultured overnight at 28°C and 180 rpm. 100 μl of the seed solution was spread on fermentation medium plates containing 0.5, 1, and 2 g / L zinc sulfate, and cultured at 28°C for 5 days. It was observed that when the zinc sulfate concentration was 0.5 g / L, the hyphae of D2 completely covered the surface of the medium, and the biomass of D2 was the highest at this time. However, when the zinc sulfate concentration was 2 g / L, the growth of D2 was inhibited to a certain extent.

[0041] Example 2 Identification of Highly Efficient Zinc-Enriched Bacteria

[0042] Morphological characteristics: After 4-6 days of constant temperature cultivation at 28°C, dark green spores form on the front of the colony, and the colony surface appears velvety. Optical microscopy reveals typical broom-like branches, septate hyphae, and spherical or ellipsoidal conidia.

[0043] Molecular biological identification: 18S rDNA identification was performed. Genomic DNA from Zn-rich Bacteria D2 was extracted according to the instructions of a fungal genomic DNA extraction kit. 18S rDNA was amplified by PCR using universal 18S rDNA primers (NS1: 5'-GTAGTCATATGCTTGTCTC-3', FUNG: 5'-ATTCCCCGTTACCCGTTG-3'). Sequencing was subsequently commissioned to BGI. Sequence information was aligned and analyzed in the NCBI database. Combined with morphological characteristics, Zn-rich Bacteria D2 was confirmed to be a purple-producing fungus, designated Talaromyces purpureogenus.

[0044] The 18S rDNA sequence of the strain is shown in SEQ ID NO.1:

[0045] CAGTTGTAGTCATAAATATTGTCTCAAAGATTAAGCCATGCATGTCTAAGTATAAGCACTCTTTACTGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCCTACTACATGGATAACCTGTGGTAATTCTAGAGCTAATACATGCGCAAAACCCCGACTTCG GAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGATTCATAATAACTTCACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTGGCAACGGAAAACGGGGGGAATA.

[0046] Example 3 Preparation and quantitative analysis of organic zinc

[0047] 1. Preparation of organic zinc using zinc-rich Talaromyces purpurogenum strain D2

[0048] (1) Strain activation: The frozen culture of Zn-rich T. purpurogenum strain D2 was inoculated onto a PDA plate and cultured at 28°C for 7 days;

[0049] (2) Seed solution preparation: The activated spores of the zinc-rich purple Talaromyces strain D2 were transferred to PDB medium and cultured overnight at 28°C and 180 rpm to obtain seed solution;

[0050] (3) Fermentation: 8% of the obtained seed liquid was inoculated into the liquid fermentation medium and fermented at 28°C for 5 days;

[0051] (4) Preparation of organic zinc from purple cynaroid fungus:

[0052] ① After fermentation is completed, centrifuge at 8000 rpm for 30 min to obtain the fermentation supernatant and bacterial precipitate A;

[0053] ② Resuspend and wash the bacterial pellet A three times with ultrapure water. Centrifuge at 8000 rpm for 20 min. Combine the wash supernatant with the fermentation supernatant to obtain a mixed supernatant (the combined supernatant contains inorganic zinc that strain D2 failed to utilize and organic zinc converted by strain D2). Centrifuge the resulting bacterial pellet B.

[0054] ③ The mixed supernatant obtained in the above step is nanofiltered through a 200Da molecular weight nanofiltration membrane (this step can remove the inorganic zinc-containing supernatant with a molecular weight less than 200Da and retain the organic zinc-containing retentate with a molecular weight greater than 200Da), the retentate is collected, and the nanofiltration membrane is rinsed twice with an appropriate amount of ultrapure water. The nanofiltration membrane rinse solution is collected and combined with the retentate to obtain an extracellular organic zinc solution;

[0055] ④ Resuspend the bacterial precipitate B described in step ② with an equal volume of ultrapure water, ultrasonicate at 600W for 20 minutes, and centrifuge at 8000rpm for 30 minutes to collect the leaching solution. Repeat this step three times, discard the precipitated cell debris, and mix the three leaching solutions to obtain a mixed leaching solution;

[0056] ⑤ The extracellular organic zinc solution obtained after nanofiltration in step ③ is combined with the mixed leachate obtained in step ④, and freeze-dried to obtain zinc-rich freeze-dried powder.

[0057] 2. Detection of organic zinc content in zinc-rich Talaromyces purpurogenum

[0058] (1) Microwave digestion: Accurately weigh 0.2 g of the zinc-rich freeze-dried powder prepared above and dissolve it in 1000 ml of ultrapure water. Stir thoroughly to dissolve and prepare a 0.2 g / L liquid sample. Accurately pipette 1 ml of the liquid sample into a microwave digestion tank and add 5 ml of nitric acid for microwave digestion. After cooling, remove the digestion tank and remove the acid on a hot plate at 150 ° C to about 1 ml. After the digestion tank cools, transfer the digestion liquid to a 50 ml volumetric flask. Wash the digestion tank with a small amount of water three times, combine the washing liquid in the volumetric flask, dilute to the mark with water, and mix well for later use. Perform a reagent blank test at the same time.

[0059] (2) Preparation of standard solution:

[0060] ① Zinc standard stock solution (1000 mg / L): Accurately weigh 1.2447 g (accurate to 0.0001 g) of zinc oxide, add a small amount of 50% by volume nitric acid solution, heat to dissolve, cool, transfer to a 1000 mL volumetric flask, add water to the mark, and mix thoroughly.

[0061] ② Zinc standard intermediate solution (10 mg / L): Accurately pipette 1 mL of zinc standard stock solution (1000 mg / L) into a 100 mL volumetric flask, add 5% nitric acid solution to the scale, and mix well.

[0062] ③ Zinc Standard Solution Series: Accurately pipette 0 mL, 1 mL, 2 mL, 4 mL, 8 mL, and 10 mL of the zinc standard intermediate solution into a 100 mL volumetric flask. Add 5% nitric acid solution to the mark and mix thoroughly. The mass concentrations of this zinc standard solution series are 0 mg / L, 0.1 mg / L, 0.2 mg / L, 0.4 mg / L, 0.8 mg / L, and 1 mg / L, respectively.

[0063] The zinc content in the sample was measured by flame atomic absorption spectrometry using the first method in the National Standard of the People's Republic of China GB 5009.14-2017. The test results showed that the zinc content in the zinc-rich freeze-dried powder was 111.4 mg / g.

[0064] Result analysis:

[0065] In the present invention, the fermentation broth is collected after fermentation with the zinc-rich purple Talaromyces strain D2, and the cells are collected after centrifugation. The inorganic zinc salts remaining on the cell surface are washed off by resuspending and rinsing with ultrapure water. The eluted supernatant is combined with the fermentation supernatant and then subjected to a 200Da nanofiltration treatment. The nanofiltration step can remove inorganic zinc that cannot be utilized by strain D2 (zinc sulfate has a molecular weight of approximately 161.5Da), while organic zinc greater than 200Da (such as zinc glycinate, which has a molecular weight of approximately 213.5Da) will remain on the filter membrane or in the intercepted liquid. Therefore, nanofiltration can remove inorganic salts in the fermentation product and obtain an extracellular supernatant containing organic zinc. In addition, the cells collected after centrifugation are subjected to ultrasonic disruption to obtain a cell extract containing organic zinc. Finally, the extracellular supernatant containing organic zinc with a concentration greater than 200Da after nanofiltration is combined with the bacterial extract, and the organic zinc-rich freeze-dried powder can be obtained after freeze-drying. The zinc content measured using the zinc-rich freeze-dried powder is the organic zinc content in the product, which can reach 111.4 mg / g; this shows that the purple basket fungus D2 is an efficient zinc-rich microorganism, which can efficiently convert inorganic zinc into organic zinc, and the converted organic zinc accounts for approximately 55.7% of the zinc content in the culture medium.

[0066] Example 4. Determination of ABTS free radical scavenging rate of Basilisk bio-organic zinc:

[0067] (1) Preparation of ABTS.+ working solution: Mix 7 mmol / L ABTS aqueous solution and 2.45 mmol / L potassium persulfate aqueous solution in a 1:1 ratio. Incubate at 25°C in the dark for 16 hours to form the ABTS.+ stock solution. Dilute the stock solution 40-50 times with anhydrous ethanol until the absorbance of the diluted solution is 0.7 ± 0.02. This is the ABTS.+ working solution.

[0068] (2) Organic zinc solution of Basilicum: Use ultrapure water to prepare a series of mass concentration gradient solutions of 5 g / L, 1 g / L, and 0.8 g / L from the zinc-rich freeze-dried powder.

[0069] (3) Refer to the reagent addition amount in Table 1 and add ultrapure water, anhydrous ethanol, sample solution, ABTS to each well in sequence. .+ Mix the working solution thoroughly. Repeat three times for each sample. Incubate at 30°C for 10 minutes and measure the absorbance at 734 nm using a microplate reader. The ABTS free radical scavenging rate is calculated as follows:

[0070]

[0071] Table 1 Sample addition table for ABTS free radical scavenging test

[0072] Reagents <![CDATA[Solvent background hole (T a )]]> <![CDATA[Solvent reaction hole (T b )]]> <![CDATA[Sample background hole (T c )]]> <![CDATA[Sample reaction well (T d )]]> <![CDATA[ABTS .+ Working solution (μl)]]> 0 180 0 180 Ultrapure water (μl) 20 20 0 0 Anhydrous ethanol (μl) 180 0 180 0 Sample (μl) 0 0 20 20 Total (μl) 200 200 200 200

[0073] Note: The readings of Ta, Tb, Tc, and Td wells after measurement are recorded as Aa, Ab, Ac, and Ad respectively.

[0074] (4) Under the aforementioned experimental conditions, the experimental results of the ABTS free radical scavenging rate of zinc-rich freeze-dried powder are as follows in Table 2:

[0075] Table 2 Scavenging rate of ABTS free radicals by zinc-rich freeze-dried powder

[0076] Concentration of zinc-rich freeze-dried powder (g / L) ABTS free radical scavenging rate (%) 5 78.54±1.82 1 56.99±0.29 0.8 49.55±0.74

[0077] (5) Experimental results: According to the results in Table 2, the zinc-rich freeze-dried powder prepared from the zinc-rich purple Talaromyces strain D2 in the present invention has significant ABTS free radical scavenging ability in the concentration range of 0.8-5 g / L, indicating that the organic zinc prepared from the zinc-rich purple Talaromyces strain D2 has antioxidant ability.

[0078] Example 5. Determination of tyrosinase inhibition rate of organic zinc from Bacillaceae:

[0079] (1) 3.1 Phosphate buffer solution (PBS): pH = 6.8, 0.1 mol / L; Weigh 17.91 g of disodium hydrogen phosphate dodecahydrate and dissolve it in water. The volume is then adjusted to 500 mL with water to obtain solution A. Weigh 7.80 g of sodium dihydrogen phosphate and dissolve it in water. The volume is then adjusted to 500 mL with water to obtain solution B. Take 212.98 mL of solution A and 247.65 mL of solution B to prepare 460 mL of pH 6.8 phosphate buffer solution.

[0080] (2) L-tyrosine solution: Weigh 25 mg of L-tyrosine and dissolve it in PBS buffer solution to 50 mL. Store in a dark place and use immediately.

[0081] (3) Prepare tyrosinase at a concentration of 500 U / mL using PBS buffer solution.

[0082] (4) Refer to the reagent addition amounts in Table 3. Add L-tyrosine solution, sample solution, and PBS buffer to each well in sequence, mix thoroughly, and incubate at 37°C for 10 min. Then, add 20 μL of tyrosinase solution to each well in sequence. Mix and react at 37°C for 5 min±5 s, then immediately place the well in a microplate reader for absorbance measurement at 475 nm. The tyrosinase inhibition rate is calculated as follows:

[0083]

[0084] (5) Sample solution preparation: Use ultrapure water to prepare a series of mass concentration gradient solutions of 15 g / L, 10 g / L, 5 g / L, and 1 g / L from the zinc-rich freeze-dried powder.

[0085] Table 3 Sample loading table for tyrosinase activity inhibition test

[0086] Reagents <![CDATA[Solvent background hole (T a )]]> <![CDATA[Solvent reaction hole (T b )]]> <![CDATA[Sample background hole (T c )]]> <![CDATA[Sample reaction well (T d )]]> L-tyrosine solution (μl) 0 40 0 40 Sample solution (μl) 0 0 40 40 Solvent (PBS buffer) (μl) 40 40 0 0 PBS buffer (μl) 70 30 70 30 Tyrosinase solution (μl) 20 20 20 20 Total (μl) 130 130 130 130

[0087] Note: The readings of Ta, Tb, Tc, and Td wells after measurement are recorded as Aa, Ab, Ac, and Ad respectively.

[0088] (6) Under the aforementioned experimental conditions, the experimental results of the inhibition rate of zinc-rich freeze-dried powder on tyrosinase are shown in Table 4 below:

[0089] Table 4 Inhibition rate of zinc-rich freeze-dried powder on tyrosinase

[0090] Concentration of zinc-rich freeze-dried powder (g / L) Tyrosinase inhibition rate (%) 15 81.29±12.80 10 76.01±4.01 5 69.73±4.43 1 50.76±7.30

[0091] (7) Experimental results: According to the results in Table 4, the zinc-rich freeze-dried powder prepared from the zinc-rich purple Talaromyces strain D2 in the present invention has significant tyrosinase inhibition ability within the concentration range of 1-15 g / L, indicating that the organic zinc prepared from the zinc-rich purple Talaromyces strain D2 has the ability to inhibit melanin synthesis, can be used in whitening skin care products, and also has the potential to be used as a natural preservative.

[0092] Example 6. Determination of 5α-reductase inhibition rate of organic zinc from Talaromyces (kit method):

[0093] (1) Preparation of working solution: This experiment uses a 5α-reductase inhibition rate assessment kit (purchased from Huizhi Heyuan Biotechnology Co., Ltd.). Accurately pipette appropriate amounts of SD rat testicular 5α-reductase (20 mg / mL), NADPH solution (30 mM), and testosterone T (1 mM), and dilute them with Buffer A (pH 6.0) at a ratio of 1:10 (v:v) for later use.

[0094] (2) Preparation of reaction solution: According to the experimental dosage, prepare Buffer B: Reagent I: Reagent II at a ratio of 98:1:1.

[0095] (3) Add the corresponding Buffer A, testosterone, NADPH, sample or control solution, and 5α-reductase to the centrifuge tube in sequence, mix well, incubate at 37°C, inactivate the centrifuge, take the supernatant and transfer it to a 96-well plate, add Reaction Solution and mix well, incubate at 37°C, add Start Solution and mix well to start the reaction, place in a microplate reader and incubate at 37°C for 8 minutes, measure the change in OD value before and after incubation at 405nm, and calculate the inhibition rate of the test substance on 5α-reductase. The calculation formula is as follows:

[0096]

[0097] Table 5 Incubation system for the first step of the assay

[0098] Experimental group Blank control group (water) Negative control group Positive control group (finasteride) Buffer A 149 170 150 149 sample 1 / / / Positive control / / / 1 testosterone 10 10 10 10 5α-reductase 20 / 20 20 NADPH Solution 20 20 20 20

[0099] Table 6 Second step incubation system in the assay

[0100] Experimental group Blank control group Negative control group Positive control group Reaction Solution 75 75 75 75 supernatant 20 20 20 20 Start Solution 5 5 5 5

[0101] (4) The experimental results of the inhibition rate of zinc-rich freeze-dried powder on 5α-reductase are shown in Table 7 below:

[0102] Table 7 Inhibition rate of zinc-rich freeze-dried powder on 5α-reductase

[0103]

[0104] (5) Experimental results: According to the results in Table 7, the zinc-rich freeze-dried powder prepared from the zinc-rich purple Talaromyces strain D2 in the present invention has the ability to inhibit 5α-reductase, indicating that the organic zinc prepared from the zinc-rich purple Talaromyces strain D2 can achieve the purpose of oil control.

[0105] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A method for producing organic zinc by fermentation with Talaromyces purpurogenus D2, characterized in that: include: 1) Inoculating the purple-producing fungus D2 into a liquid fermentation medium supplemented with zinc salt for fermentation; 2) After fermentation is complete, centrifuge the fermentation broth; The supernatant after centrifugation is separated by a 200Da nanofiltration membrane, and the retentate is collected. The nanofiltration membrane is washed with water to obtain a nanofiltration membrane cleaning solution, and the nanofiltration membrane cleaning solution and the retentate are combined to obtain an extracellular organic zinc solution. The precipitate after centrifugation is resuspended and then ultrasonically treated, and the bacterial extract is collected by centrifugation. 3) The bacterial extract and the extracellular organic zinc solution are combined and freeze-dried; Among them, the deposit number of the purple-producing T. purpurogenum D2 is GDMCC NO.66320; The zinc salt is zinc sulfate; The liquid fermentation medium with zinc salt added contains 2-8 g / L of glucose, 2-8 g / L of yeast extract, 8-15 g / L of malt extract, and a zinc concentration of 0.5-2 g / L.

2. The method according to claim 1, characterized in that The fermentation is carried out at a temperature of 15 to 30°C.

3. The method according to claim 1, characterized in that The steps include: (1) Strain activation: inoculate the frozen culture of T. purpurogenum D2 onto a PDA plate for culture; (2) Seed solution preparation: transfer the activated spores of T. purpurogenum D2 to PDB medium to obtain seed solution; (3) Fermentation: inoculating the obtained seed liquid into a liquid fermentation medium supplemented with zinc salt for fermentation; (4) Preparation of organic zinc: After fermentation is completed, the fermentation liquid is centrifuged; the supernatant after centrifugation is separated by a 200Da nanofiltration membrane, the retained liquid is collected, and the nanofiltration membrane is cleaned with ultrapure water to obtain a nanofiltration membrane cleaning liquid, and the nanofiltration membrane cleaning liquid and the retained liquid are combined to obtain an extracellular organic zinc solution; the precipitate after centrifugation is resuspended and ultrasonically treated, and the bacterial extract is collected by centrifugation; the bacterial extract is combined with the extracellular organic zinc solution and freeze-dried.

Images