A genetically engineered bacterium producing furfurylamine and its preparation method and application

Abstract

The present invention discloses a genetically engineered bacterium producing furfural amine, and a preparation method and application thereof, and the present invention belongs to the technical field of fermentation engineering. The present invention is to solve the problems of large amount of amino donor, high price, metal ion cofactor, large amount of co-substrate, etc. in the existing preparation of furfural amine by bio-transamination catalysis. The method of the present invention comprises the following steps: constructing a recombinant Escherichia coli cell; adding the whole cell of the recombinant engineered bacillus induced for expression into the reaction system; recovering the whole cell catalyst to prepare the product. Furfural amine is prepared by using a cheap inorganic amino donor and glucose as a co-substrate; the amount and cost of the amino donor are effectively reduced, and the amount of glucose is greatly reduced, thereby realizing the green and efficient synthesis of bio-based furfural amine.

Description

Technical Field

[0001] The invention belongs to the technical field of fermentation engineering, and specifically relates to a genetic engineering bacterium producing furfural amine and a preparation method and application thereof. Background Art

[0002] Furfurylamine (2-Furfurylamine, FLA), also known as 2-furanmethylamine, has a molecular formula of C5H7NO. It is a colorless oily liquid. It will absorb CO2 and deteriorate when exposed to light, heat or air. It is soluble in ethanol, etc. Furfurylamine is a primary amine compound derived from furfural. It has a variety of applications in modern chemistry and industry, including the synthesis of polymers, pesticides, bioactive molecules, and as an intermediate in the synthesis of drugs such as fungicides, cholinergic drugs, antihypertensive drugs and diuretics. At present, the main synthesis method of furfurylamine is mainly chemical. It is prepared by hydrogenation reaction of furfural and liquid nitrogen under high temperature and high pressure conditions. Due to the special structure of the product, the reaction conditions are relatively demanding. Subsequent research mainly focuses on the improvement of catalysts. At present, various precious metal catalysts (nickel metal, CN1704411A, furfurylamine yield 85%; Ru metal, Research on Chemical Intermediates, 2015, 42:19-30, furfurylamine yield 60%) have been used to synthesize furfurylamine. However, the existing precious metal catalytic hydrogenation method has problems such as harsh reaction conditions, high catalyst cost, and low yield, and it is impossible to achieve the green synthesis of furfurylamine.

[0003] Biocatalysis has the advantages of high selectivity, high catalytic efficiency and mild reaction conditions. For example, in 2017, Alice et al. (Green Chem, 2017, 19:397-404) used transaminase (CV-TAMs) from Chromobacteium violaceum (DSM30191) to catalyze furfural to prepare furfuralamine. However, the amino donors of the current transamination reaction are mostly organic amines such as alanine, isopropylamine and methylbenzylamine, which are used in large quantities, are expensive and some are biotoxic. In 2021, Li Qing et al. (Green Chem, 2021, 23:8154-8168) used transaminase (CV-TAMs) and alanine dehydrogenase (AlaDH) in a two-phase system of choline chloride / ethylene glycol-water, using ammonium chloride as the amino donor to catalyze the synthesis of furfuralamine. However, its cascade catalytic system requires the use of choline chloride / ethylene glycol to construct the reaction solvent system, metal ion cofactors, and a large amount of cosubstrate glucose.

[0004] On this basis, the existing bio-transamination catalysis for the preparation of furfurylamine has the problems of large amount of amino donor, high price, metal ion cofactor and large amount of co-substrate. Summary of the invention

[0005] The purpose of the present invention is to provide a green and efficient synthesis method for preparing furfuralamine by using recombinant Escherichia coli whole cells to catalyze furfural, and to prepare furfuralamine by using cheap inorganic amino donors and glucose, thereby overcoming the problems of large amount of amino donors, high price, large amount of metal ion cofactors and co-substrate in existing biological transamination.

[0006] The invention provides a genetically engineered bacterium for producing furfural amine, wherein the genetically engineered bacterium overexpresses a transaminase gene OATA and an alanine dehydrogenase gene ALD.

[0007] It is further defined that the genetically engineered bacteria is knocked out of the DNA binding transcription dual regulator arcA, and overexpresses the transaminase gene OATA, the alanine dehydrogenase gene ALD and the T7 promoter-linked carbon storage regulator CsrB gene.

[0008] It is further defined that the aminotransferase gene OATA is derived from Ochrobacterium hominis, and the gene sequence is shown in SEQ ID NO.3; the alanine dehydrogenase gene ALD is derived from Bacillus subtilis, Genebank ID: 936557; the csrB gene sequence is shown in SEQ ID NO.1; the GeneBank ID of the DNA binding transcription dual regulator arcA is QJZ27444.1.

[0009] It is further defined that the starting strain of the above-mentioned genetically engineered bacteria is Escherichia coli BL21 (DE3).

[0010] The present invention provides the microbial preparation of the above-mentioned genetically engineered bacteria.

[0011] The present invention provides a method for preparing the above-mentioned genetically engineered bacteria, characterized in that the specific steps of the preparation method are as follows:

[0012] Step 1: Knock out the global regulatory factor arcA on the genome of E. coli BL21 (DE3) to obtain mutant strain I; insert the sequence of the T7 promoter before the gene sequence of the carbon storage regulatory factor CsrB of the starting strain to obtain mutant strain II, and prepare competent cells;

[0013] Step 2: Prepare a recombinant plasmid containing the aminotransferase gene OATA and the alanine dehydrogenase gene ALD, and introduce the recombinant plasmid into competent cells to obtain recombinant Escherichia coli.

[0014] It is further defined that the specific steps of step 1 are to use the nucleotide sequence of the T7 promoter as a bridge sequence to clone the T7-csrB homology arm; connect the T7-csrB homology arm to the suicide plasmid pRE112 to obtain the recombinant plasmid pRE112-T7-csrB; and use the homologous recombination method mediated by the recombinant plasmid pRE112-T7-csrB to insert the nucleotide sequence of the T7 promoter in front of the carbon storage regulatory factor csrB gene sequence of the mutant strain I to obtain the mutant strain II, named E. coli BL21 (DE3) △ arcAT7-csrB.

[0015] The present invention provides a method for preparing furfural amine by whole-cell catalysis, which is characterized in that the genetically engineered bacteria are used to ferment in a fermentation culture system containing furfural, the fermentation temperature is 37°C, and the fermentation time is at least 12 hours.

[0016] Further defined, the components of the fermentation culture system include an amino donor, glucose and furan-2-carbaldehyde.

[0017] The present invention provides the application of the above-mentioned genetic engineering bacteria in synthesizing furfuralamine and increasing the yield of furfuralamine.

[0018] Beneficial effects: The method of the present invention targets the amino donors and co-substrates involved in the process of preparing furfuralamine from furfural catalyzed by transaminase, and for the first time utilizes the cascade reaction constructed by transaminase OATA and alanine dehydrogenase ALD, which is beneficial for inorganic ammonia as an amino donor, and the molar amount of the amino donor is reduced by 80%. At the same time, the metabolic pathway of engineering bacteria is utilized to construct a recombinant Escherichia coli host cell through global, multi-level, and multi-pathway metabolic transformation and combined regulation, ultimately achieving a 30% reduction in the amount of co-substrate glucose, thereby realizing the green and efficient synthesis of bio-based furfuralamine. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 The obtained furfurylamine 1 H NMR results.

[0020] Figure 2 The obtained furfurylamine 13 C NMR results.

[0021] Figure 3 For MS results. DETAILED DESCRIPTION

[0022] Example 1. Construction of genetically engineered bacteria

[0023] 1. ArcA gene knockout

[0024] The global regulatory factor arcA of the E. coli BL21 (DE3) genome was knocked out by P1 phage transduction. (1) Phage activation: 4 ml of heated and melted 0.4% agar medium was added to a 10 ml sterile EP tube, 400 μL of overnight cultured donor strain JW4364 (the donor strain is derived from the Keio Collection library and can be purchased through commercial channels. The Keio Collection library construction method is described in Baba T, et al. Construction of Escherichiacoli K-12 in-frame, single-gene knockout mutants: the Keio collection. Molecular Systems Biology 2006, 2(1): 1-11), 10 μL of stored phage stock solution was added, the solution was mixed and poured onto an LB non-antibiotic plate, and cultured at 37°C in a humidified environment until irregular plaques appeared. (2) Collection of phage lysis library: scrape all semi-solid culture medium on the plate into a 10ml sterile EP tube, add 3ml LB liquid culture medium, add 400μL chloroform, shake and centrifuge to collect the supernatant into another sterile EP tube, and add 400μL chloroform. This solution is the donor bacteria JW4364 lysis library. (3) Transduction: culture the recipient bacteria E.coli BL21(DE3) overnight, mix the donor bacteria JW4364 lysis library prepared in step (2) with the recipient bacteria E.coli BL21(DE3) at different concentrations and then transduce, spread on the resistance plate, culture overnight until a single clone grows, and verify the positive clone with primers to obtain the mutant strain BL21(DE3)△arcA (mutant I) with the global regulatory factor arcA knocked out.

[0025] 2. Overexpression of the carbon storage regulator csrB

[0026] The T7 promoter sequence was inserted in front of the genome of the carbon storage regulator csrB by homologous recombination mediated by pRE112 to achieve gene overexpression, wherein: the csrB gene sequence is shown in SEQ ID NO.1, and the nucleotide sequence of the T7 promoter is shown in SEQ ID NO.2.

[0027] (1) Construction of homology arms: A portion of about 700 bp of the csrB gene of the wild strain of E. coli BL21 (DE3) was used as the downstream homology arm, and about 700 bp of the upstream sequence of csrB was used as the upstream homology arm. The T7 promoter sequence was used as the bridge sequence between the upstream and downstream homology arms. Primers were designed based on this as a template.

[0028] Amplification primer sequences:

[0029] CsrB-Up-5':

[0030] 5'-CAGAGCTCCAGCTCCAGCCAGAATAAGCGCG-3' (SEQ ID NO. 5);

[0031] CsrB-Up-3':

[0032] 5'-CTATAGGGGAATTGTGAGCGGATAACAATTCCGTCGACAGGGAGTCAGACAAC-3' (SEQ ID NO. 6);

[0033] CsrB-Down-5':

[0034] 5'-CGCTCACAATTCCCCTATAGTGAGTCGTATTAGAAGATAGAATCGTCTTTTTC-3' (SEQ IDNO.7);

[0035] CsrB-Down-3':

[0036] 5'-ATCTGCGGTACCGTGGCATGAAGAGCATAAAA-3' (SEQ ID NO. 8);

[0037] The upstream homology arm of T7-csrB was amplified with primers, the downstream homology arm of T7-csrB was amplified with primers, and the upstream and downstream homology arms of T7-csrB were bridged by the fragment bridging method with primers to obtain the homology arm fragment of T7-csrB. The target homology arm fragment T7-csrB (SEQ ID NO.2 connected to SEQ ID NO.1) was recovered using a gel recovery kit. (2) Construction of recombinant plasmid pRE112-T7-csrB:

[0038] The T7-csrB fragment and suicide plasmid pRE112 were double-digested with restriction endonucleases KpnI and SacI, respectively. The gene fragment and vector after digestion were recovered using a gel recovery kit. The fragment and vector were ligated overnight at 16°C under the action of T4 DNA ligase at a molar ratio of 2:1. The ligated product was heat-shocked at 42°C to transform E. coli CC118 competent cells. After overnight culture until a single clone grew out, the positive clone was verified with primers to obtain the recombinant plasmid pRE112-T7-csrB. Homologous recombination: The recombinant plasmid pRE112-T7-csrB was transformed into E. coli χ7213 and used as a donor strain to perform two homologous recombination with the recipient strain BL21△ arcA. The strain with successful insertion of the T7 promoter sequence was verified by PCR using primers, which was a positive clone, and the mutant strain BL21(DE3)△arcA T7-csrB (mutant strain II) was obtained.

[0039] Primer verification sequence:

[0040] CsrB-5':

[0041] 5'-TTCCAGCATTAGCTCGCATC-3' (SEQ ID NO. 9);

[0042] T7-3':

[0043] 5'-TTGTTATCCGTCACAATTC-3' (SEQ ID NO. 10);

[0044] III. Transformation of host cells with expression vectors 1. Prepare wild-type control strain E. coli BL21 (DE3) and the engineered strain BL21 (DE3) ΔarcA T7-csrB competent cells provided by the present invention according to the operating procedures of the TAKARA competent cell preparation kit.

[0045] Preparation of recombinant plasmid pACYCDuet-OATA-ALD: (1) Target gene PCR: Use PrimeSTAR polymerase to PCR amplify the ALD gene fragment, and the product is identified by 1% agarose gel electrophoresis and the target gene fragment is recovered by gel; (2) Vector preparation: pACYC-OATA (the OATA gene sequence is connected to the pACYCDuet-1 vector) is digested by enzymes, reacted at 37°C for 1 h, and the product is identified by 1% agarose gel electrophoresis and the vector fragment is recovered by gel; (3) Linking: pACYC-OATA is linked to ALD to obtain the recombinant plasmid pACYCDuet-OATA-ALD. The primer sequences are:

[0046] ALD-5NdeI:TAAGAAGGAGATATACATATGATTATTGGCGTGCCGAA (SEQ ID NO. 11);

[0047] ALD-3BglII: GCCGATATCCAATTGAGATCTTTACGCGCCCGCCACGCT (SEQ ID NO. 12);

[0048] The recombinant plasmid pACYCDuet-OATA-ALD was transformed into the wild-type control strain E. coli BL21 (DE3) and the engineering strain BL21 (DE3) △arcA T7-csrB competent state by heat shock method to obtain the recombinant strains E. coli BL21 and E. coli LYJ201.

[0049] Example 2. Whole-cell catalyzed reactions

[0050] The preparation and screening of whole-cell catalysts were carried out as follows:

[0051] Step 1: Inoculate a single colony of the recombinant strain on a solid LB plate into LB seed liquid medium, add 1‰ antibiotics, and grow at 37℃ for 8-12 h;

[0052] Step 2: The obtained primary seed liquid was transferred to a 500 mL fermentation shake flask containing 150 mL LB medium at an inoculation rate of 1-3% (wt). 1‰ of antibiotics was added when transferring the seed liquid. Three parallel controls were set for each strain and cultured at 37°C and 180 rpm.

[0053] Step 3: When the cell OD600 reaches 0.6-0.8, add IPTG at a final concentration of 200 µmol / L for induction.

[0054] Step 4: After IPTG induction, continue culturing at 30°C and 180 rpm for 7 h and then collect the bacterial culture.

[0055] Step 5: Centrifuge at 8000 rpm, 4°C for 5 min, then resuspend the precipitate with 30 mL PBS buffer, centrifuge under the same conditions, and wash once. Discard the supernatant, and place the bacterial precipitate on ice for use as a biocatalyst for the furfural transamination reaction to prepare furfuralamine.

[0056] Step 6: Add amino donor, glucose, furan-2-carboxaldehyde (0.05 M) and 0.1 g / mL recombinant Escherichia coli whole cells into a 100 mL conical flask, dilute to 30 mL with PBS buffer pH 7.5, shake at 37°C, 220 rpm, sample for 12 h, sample 400 μL, centrifuge to obtain the supernatant, dilute and perform HPLC detection.

[0057] The specific results are shown in Table 1 below: Furfuryl alcohol is a byproduct in the production of furfurylamine, and the less it is produced, the better.

[0058] Table 1

[0059]

[0060] ;

[0061] ;

[0062] ;

[0063] ;

[0064] .

[0065] Detection test:

[0066] (I) NMR and MS determination of the obtained furfurylamine

[0067] Result: As Figure 1 shown 1 H NMR and Figure 2 Shown 13 C NMR results and Figure 3 The MS results shown; 1 The chemical shifts and hydrogen atom numbers of each group of HNMR peaks are consistent with the standard material spectrum of furfurylamine. 13 The number of carbon atoms displayed by C NMR was consistent with the standard material spectrum of furfurylamine; m / z: 98.0602, which was consistent with the standard material of furfurylamine, indicating that furfurylamine was successfully prepared by the recombinant engineering strain.

[0068] Example 3. Preparation of furfurylamine by whole cell catalysis of furfural

[0069] 1. The screening of the reaction time for the preparation of furfural amine by whole-cell catalysis of furfural was carried out according to the following steps:

[0070] 2eq of amino donor (inorganic ammonia: ammonium chloride), 0.5eq of glucose, furan-2-carboxaldehyde (0.05 M) and 0.1g / mL recombinant E. coli LYJ201 whole cells were added to a 100 mL conical flask, and the volume was fixed to 30 mL with PBS buffer pH 7.5. The shaker was placed at 37°C and at 220 rpm. The sampling time was 1h, 2h, 3h, 6h, 12h, 24h, and 24h. 400 μL of the sample was taken, and the supernatant was centrifuged and diluted for HPLC detection. The specific results are shown in Table 2 below:

[0071] Table 2

[0072]

[0073] 2. The optimization of furfural concentration in the preparation of furfural by whole-cell catalysis was carried out in the following steps:

[0074] 2eq of amino donor, 0.5eq of glucose, furan-2-carboxaldehyde (0.05 M) and 0.1g / mL recombinant E. coli LYJ201 whole cells were added to a 100 mL conical flask, and the volume was fixed to 30 mL with PBS buffer pH 7.5. The mixture was shaken at 37°C, 220 rpm, and the sampling time was 12h. 400 μL of the sample was taken, and the supernatant was centrifuged and diluted for HPLC detection. The specific results are shown in Table 3 below:

[0075] Table 3

[0076]

[0077] 4. Optimization of the molar equivalent ratio of the amino donor to furfural in the whole-cell catalysis of furfural was carried out according to the following steps:

[0078] Amino donor, 0.5eq of glucose, furan-2-carboxaldehyde (0.05 M) and 0.1g / mL recombinant E. coli LYJ201 whole cells were added to a 100 mL conical flask, and the volume was adjusted to 30 mL with PBS buffer pH 7.5. The mixture was shaken at 37°C, 220 rpm, and the sampling time was 12h. 400 μL of the sample was taken, and the supernatant was centrifuged and diluted for HPLC detection. The specific results are shown in Table 4 below:

[0079] Table 4

[0080]

[0081] The amount of amino donor reported by Alice et al. was 10 eq of furfural, so the amount of amino donor used in the recombinant engineered strain / reported in the literature = 2 / 10, the molar amount of amino donor was reduced by 80%, and the conversion rate and yield achieved were the same as those reported in the literature.

[0082] 5. The optimization of the molar equivalent ratio of glucose to furfural in the preparation of furfural by whole cell catalysis was carried out according to the following steps:

[0083] 2eq of amino donor, glucose, furan-2-carboxaldehyde (0.05 M) and 0.1g / mL recombinant E. coli LYJ201 whole cells were added to a 100 mL conical flask, and the volume was adjusted to 30 mL with PBS buffer pH 7.5. The mixture was shaken at 37°C, 220 rpm, and the sampling time was 12h. 400 μL of the sample was taken, and the supernatant was centrifuged and diluted for HPLC detection. The specific results are shown in Table 5 below:

[0084] Table 5

[0085]

[0086] The amount of co-substrate glucose reported by Li Qing et al. was 1 eq of furfural, so the glucose amount of the recombinant engineered strain / the literature report = 0.5 / 1. The molar amount of glucose was reduced by 50%, and the conversion rate and yield achieved were the same as those reported in the literature.

[0087] 6. The optimization of the amount of recombinant Escherichia coli cells catalyzing furfural to produce furfuralamine was carried out according to the following steps:

[0088] 2eq of amino donor, 0.5eq of glucose, furan-2-carboxaldehyde (0.05 M) and 0.1g / mL recombinant E. coli LYJ201 whole cells were added to a 100 mL conical flask, and the volume was adjusted to 30 mL with PBS buffer pH 7.5. The mixture was shaken at 37°C, 220 rpm, and the sampling time was 12h. 400 μL of the sample was taken, and the supernatant was centrifuged and diluted for HPLC detection. The specific results are shown in Table 6 below:

[0089] Table 6

[0090]

[0091] VII. Screening of the buffer solution for the whole-cell catalytic furfural to furfuralamine transamination reaction was carried out in the following steps:

[0092] 2eq of amino donor, 0.5eq of glucose, furan-2-carboxaldehyde (0.05 M) and 0.1g / mL recombinant E. coli LYJ201 whole cells were added to a 100 mL conical flask, the buffer was fixed to 30 mL, shaken at 37°C, 220rpm, the sampling time was 12h, 400 μL of the sample was taken, the supernatant was centrifuged and diluted for HPLC detection. The specific results are shown in Table 7 below:

[0093] Table 7

[0094]

[0095] 8. Screening of the reaction temperature for the whole-cell catalytic furfural to furfuralamine transamination reaction was carried out in the following steps:

[0096] 2eq of amino donor, 0.5eq of glucose, furan-2-carboxaldehyde (0.05 M) and 0.1g / mL recombinant E. coli LYJ201 whole cells were added to a 100 mL conical flask, and the volume was adjusted to 30 mL with PBS buffer pH 7.5. The shaker was shaken at 220rpm for 12h, and 400 μL of the sample was taken. The supernatant was centrifuged and diluted for HPLC detection. The specific results are shown in Table 8 below:

[0097] Table 8

[0098]

[0099] IX. The high-concentration fermentation of furfural to furfuralamine by whole-cell catalysis is carried out in the following steps:

[0100] Step 1: Inoculate a single colony of the recombinant strain on a solid LB plate into LB seed liquid medium, add 1‰ antibiotics, and grow at 37℃ for 8-12 h;

[0101] Step 2: The obtained primary seed solution was transferred to a 500 mL fermentation shake flask containing 150 mL LB medium at a 1-3% (wt) inoculation rate. When transferring the seed solution, 1‰ of antibiotics was added and cultured at 37°C and 180 rpm for 6-10 hours.

[0102] Step 3: The obtained secondary seed liquid was transferred to a 5L fermentation tank at an inoculation rate of 1-3% (wt), and 1‰ of antibiotics was added when the seed liquid was transferred to 2L fermentation medium, and cultured at 37°C for 10-12h; when OD600 reached 15-20, IPTG with a final concentration of 200 µmol / L was added for induction. After induction, culture was continued at 30°C for 3-7h, and the temperature was raised to 37°C, and 2q of amino donor, 0.5eq of glucose, and furan-2-carboxaldehyde were added to ferment and prepare furfurylamine. 400 μL of the sample was taken, centrifuged to obtain the supernatant, and diluted for HPLC detection. The specific results are shown in Table 9 below:

[0103] Table 9

[0104]

[0105] (1) SEQ ID NO.1

[0106] GTCGACAGGGAGTCAGACAACGAAGTGAACATCAGGATGATGACACTTCTGCAGGACACACCAGGATGGTGTTTCAGGGAAAGGCTTCTGGATGAAGCGAAGAGGATGACGCAGGACGCGTTAAAGGACACCTCCAGGATGGAGAATGAGAACCGGTCAGGATGATTCGGTGGGTCAGGAAGGCCAGGGACACTTCAGGATGAAGTATCACATCGGGGTGGTGTGAGCAGGAAGCAATAGTTCAGGATGAACGATTGGCCGCAAGGCCAGAGGAAAAGTTGTCAAGGATGAGCAGGGAGCAACAAAAGTAGCTGGAATGCTGCGAAACGAACCGGGAGCGCTGTGAATAC AGTGCTCCCTTTTTTTATT

[0107] (2)SEQ ID NO.2

[0108] TAATACGACT CACTATAGGG GAATTGTGAG CGGATAACAA TTCC

[0109] (3)SEQ ID NO.3

[0110]

[0111] (4)SEQ ID NO.4

[0112] ATGCAGACCCCGCACATTCTTATCGTTGAAGACGAGTTGGTAACACGCAACACGTTGAAAAGTATTTTCGAAGCGGAAGGCTATGATGTTTTCGAAGCGACAGATGGCGCGGAAATGCATCAGATCCTCTCTGAATATGACATCAACCTGGTGATCATGGATATCAATCTGCCGGGTAAGAACGGTCTTCTGTTAGCGCGTGAACTGCGCGAGCAGGCGAATGTTGCGTTGATGTTCCTGACTGGCCGTGACAACGAAGTCGATAAAATTCTCGGCCTCGAAATCGGTGCAGATGACTACATCACCAAACCGTTCAACCCGCGTGAACTGACGATTCGTGCACGCAACCTACTGTCCCGTACCATGAATCTGGGTACTGTCAGCGAAGAACGTCGTAGCGTTGAAAGCTACAAGTTCAATGGTTGGGAACTGGACATCAACAGCCGTTCGTTGATCGGCCCTGATGGCGAGCAGTACAAGCTGCCGCGCAGCGAGTTCCGCGCCATGCTTCACTTCTGTGAAAACCCAGGCAAAATTCAGTCCCGTGCTGAACTGCTGAAGAAAATGACCGGCCGTGAGCTGAAACCGCACGACCGTACTGTAGACGTGACGATCCGCCGTATTCGTAAACATTTCGAATCTACGCCGGATACGCCGGAAATCATCGCCACCATTCACGGTGAAGGTTATCGCTTCTGCGGTGATCTGGAAGATTAA。

Claims

1. A genetically engineered bacterium producing furfural, characterized in that: The genetically engineered bacteria is knocked out of the DNA binding transcription dual regulator arcA, and overexpresses the transaminase gene OATA, the alanine dehydrogenase gene ALD and the T7 promoter connected to the carbon storage regulator CsrB gene; the transaminase gene OATA is derived from Ochrobacterium hominis, and the gene sequence is shown in SEQ ID NO. 3; the alanine dehydrogenase gene ALD is derived from Bacillus subtilis, Genebank ID: 936557; The csrB gene sequence is shown in SEQ ID NO.1; the gene sequence of the DNA binding transcription dual regulator arcA is shown in SEQ ID NO.4; the nucleotide sequence of the T7 promoter is shown in SEQ ID NO.2; and the starting strain of the genetically engineered bacteria is Escherichia coli E.coli BL21 (DE3).

2. A microbial preparation containing the genetically engineered bacteria according to claim 1.

3. The method for preparing the genetically engineered bacteria according to claim 1, characterized in that: The specific steps of the preparation method are as follows: Step 1: Knock out the global regulatory factor arcA on the genome of E. coli BL21 (DE3) to obtain mutant strain I; insert the sequence of the T7 promoter before the gene sequence of the carbon storage regulatory factor CsrB of the starting strain to obtain mutant strain II, and prepare competent cells; Step 2: Prepare a recombinant plasmid containing the aminotransferase gene OATA and the alanine dehydrogenase gene ALD, and introduce the recombinant plasmid into competent cells to obtain recombinant Escherichia coli.

4. The preparation method according to claim 3, characterized in that: The specific steps of step 1 are as follows: using the nucleotide sequence of the T7 promoter as a bridge sequence to clone the T7-csrB homology arm; connecting the T7-csrB homology arm to the suicide plasmid pRE112 to obtain the recombinant plasmid pRE112-T7-csrB; using the homologous recombination method mediated by the recombinant plasmid pRE112-T7-csrB to insert the nucleotide sequence of the T7 promoter in front of the carbon storage regulatory factor csrB gene sequence of the mutant strain I to obtain the mutant strain II, which is named E. coli BL21 (DE3) △ arcA T7-csrB.

5. A method for preparing furfurylamine by whole-cell catalysis, characterized in that: The genetically engineered bacteria according to claim 1 are used for fermentation in a fermentation culture system containing furfural, the fermentation temperature is 37° C., and the fermentation time is at least 12 hours.

6. The method according to claim 5, characterized in that The components of the fermentation culture system include an amino donor, glucose and furan-2-carbaldehyde.

7. Use of the genetically engineered bacteria according to claim 1 in synthesizing furfuralamine and increasing the yield of furfuralamine.

Images