Recombinant ensifer adhesion as well as construction method and application thereof

Abstract

The invention provides recombinant ensifer adhesion as well as a construction method and application thereof. The recombinant ensifer adhesion provided by the invention is applied to preparation of 1, 3-propylene glycol through mixed fermentation with recombinant escherichia coli, and glycerol can be converted into 1, 3-propylene glycol without adding expensive coenzyme vitamin B12 in the fermentation process. And the ensifer adhesion and recombinant escherichia coli mixed bacterium system has good synergy, the growth of the recombinant ensifer adhesion does not generate obvious interference on the escherichia coli in the mixed bacterium system, and the normal growth and metabolism state of the escherichia coli can be basically kept. Experiments prove that after the recombinant ensifer adhesion and the recombinant microorganism escherichia coli are subjected to mixed fermentation, the product yield can be higher than that of fermentation of single-strain recombinant escherichia coli.

Description

Technical Field

[0001] The invention belongs to the field of bioengineering, and in particular relates to a recombinant adhesinic bacterium, a construction method and an application thereof. Background Art

[0002] 1,3-Propanediol (1,3-PDO) is an important commodity chemical widely used as a solvent in the cosmetics industry and a monomer in the polymer industry, especially as a monomer for the synthesis of polytrimethylene terephthalate (PTT), a high-performance polyester widely used in fibers.

[0003] Different microorganisms can bioconvert glycerol into 1,3-PDO, including Klebsiella pneumoniae, Clostridium butyricum, Clostridium pasteurianum, and Lactobacillus brevis. In Klebsiella, glycerol can be dehydrated to 3-hydroxypropionaldehyde (3-HPA) by glycerol dehydratase and further reduced to 1,3-PDO by alcohol dehydrogenase. The main disadvantage of this fermentation method is that Klebsiella is a conditional pathogen, and its biosafety needs to be strictly controlled during production.

[0004] There is also a method for producing 1,3-propylene glycol using recombinant microorganisms using glucose as a raw material in the prior art. For example, DuPont expresses the exogenous glycerol synthesis pathway (glycerol 3-phosphate dehydrogenase and glycerol 3-phosphoglycerol esterase) from Saccharomyces cerevisiae and the glycerol dehydratase and activation factor from Klebsiella and its own alcohol dehydrogenase YqhD in Escherichia coli, thereby achieving a one-step conversion of glucose to 1,3-propylene glycol. The disadvantage of this process is that the glycerol dehydratase in this process is coenzyme vitamin B12 dependent, and Escherichia coli cannot synthesize coenzyme B12, so expensive coenzyme B12 needs to be added during the fermentation process, which greatly increases the production cost of 1,3-propylene glycol and is not conducive to large-scale production. Summary of the invention

[0005] In order to solve the problem in the prior art that coenzyme vitamin B12 needs to be added during the production of 1,3-propylene glycol by microbial fermentation, the present invention provides a recombinant Xanthophyllales and a construction method thereof, and applies it to the mixed fermentation with recombinant Escherichia coli to prepare 1,3-propylene glycol. Glycerol can be converted into 1,3-propylene glycol without adding expensive coenzyme vitamin B12 during the fermentation process.

[0006] The technical solution adopted by the present invention is: a method for constructing a recombinant Sword-shaped Fungus, comprising: overexpressing at least one of a glycerol dehydratase encoding gene, a glycerol dehydratase activating factor gdrA / B, a 1,3-propanediol reductase encoding gene dhaT, and a glycerol promoter encoding gene glpF in the bottom fungus Sword-shaped Fungus to construct a recombinant Sword-shaped Fungus; wherein the glycerol dehydratase depends on coenzyme B12 to produce activity.

[0007] The sticky sword fungus contains all the genes required for the production of vitamin B12, and can ferment to produce the vitamin B12 required by the glycerol dehydratase. On this basis, the present invention further transforms the sticky sword fungus so that it can express all the genes in the metabolic process from glycerol to 1,3-propanediol and the glycerol promoter gene glpF. Therefore, in the mixed bacteria system containing the recombinant sticky sword fungus, the recombinant sticky sword fungus can not only continuously and stably synthesize coenzyme B12, provide enough coenzyme B12 for the glycerol dehydratase in the 1,3-propanediol synthesis path, but also have the ability to synthesize 1,3-propanediol. And experiments have shown that the recombinant sticky sword fungus will not produce obvious interference to the Escherichia coli in the mixed bacteria system, and can basically maintain the normal growth and metabolic state of Escherichia coli. And this mixed bacteria fermentation mode is expected to play an important role in the fields of biopharmaceuticals, food industry, etc., and provide new impetus for the development of related industries.

[0008] Preferably, the glycerol dehydratase encoding gene is the glycerol dehydratase encoding gene dhaB derived from Klebsiella or Clostridium pasteurianum; and / or, the glycerol dehydratase activator gdrA is derived from one of Klebsiella, Clostridium butyricum or Clostridium pasteurianum; and / or, the glycerol dehydratase activator gdrB is derived from one of Klebsiella, Clostridium butyricum or Clostridium pasteurianum; and / or, the 1,3-propanediol reductase encoding gene dhaT is derived from one of Klebsiella, Clostridium butyricum or Clostridium pasteurianum; and / or, the glycerol promoter encoding gene glpF is derived from Klebsiella.

[0009] Preferably, the glycerol dehydratase encoding gene dhaB is derived from Klebsiella, and its nucleotide sequence is shown in SEQ ID NO.1, and its amino acid sequence is shown in SEQ ID NO.7; and / or, the glycerol dehydratase activating factor gdrA is derived from Klebsiella, and its nucleotide sequence is shown in SEQ ID NO.2, and its amino acid sequence is shown in SEQ ID NO.8; and / or, the glycerol dehydratase activating factor gdrB is derived from Klebsiella, and its nucleotide sequence is shown in SEQ ID NO.3, and its amino acid sequence is shown in SEQ ID NO.9; the 1,3-propanediol reductase encoding gene dhaT is derived from Klebsiella, and its nucleotide sequence is shown in SEQ ID NO.4, and its amino acid sequence is shown in SEQ ID NO.10; and / or, the glycerol promoting factor encoding gene glpF is derived from Klebsiella, and its nucleotide sequence is shown in SEQ ID NO.11, and its amino acid sequence is shown in SEQ ID NO.12.

[0010] Preferably, the glycerol dehydratase encoding gene dhaB, the glycerol dehydratase activating factor gdrA, and the glycerol promoting factor encoding gene glpF are regulated by promoter P1, and the nucleotide sequence of promoter P1 is shown in SEQ ID NO.5.

[0011] Preferably, the 1,3-propanediol reductase encoding gene dhaT and the glycerol dehydratase activating factor gdrB are regulated by promoter P2, and the nucleotide sequence of P2 is shown in SEQ ID NO.6.

[0012] Preferably, the method comprises: introducing the glycerol dehydratase encoding gene dhaB from Klebsiella, the glycerol dehydratase activating factor gdrA / B from Klebsiella, the 1,3-propanediol reductase encoding gene dhaT from Klebsiella, and the glycerol promoter encoding gene glpF from Klebsiella into the chassis fungus Sword-shaped fungus S17-1 through a vector to construct a recombinant Sword-shaped fungus.

[0013] The present invention also provides a recombinant Xanthophyllum adhensinum constructed by the method.

[0014] The present invention also provides the use of the recombinant Sword Bacteria in the preparation of 1,3-propylene glycol by microbial fermentation. The 1,3-propylene glycol synthesis route specifically includes: glycerol as a substrate generates 3-hydroxypropanal under the catalysis of glycerol dehydratase, and 3-hydroxypropanal generates 1,3-propylene glycol under the action of 1,3-propylene glycol reductase. In a preferred embodiment of the present invention, the recombinant Escherichia coli overexpressing the glycerol dehydratase gene and its activating factor and 1,3-propylene glycol reductase and the recombinant Sword Bacteria are fermented in a shake flask or fermenter with glycerol as a substrate according to a certain ratio range, such as according to the inoculated seed culture volume ratio (5-9): (1-5) to obtain 1,3-propylene glycol. And there is no need to add expensive coenzyme B12 during the fermentation process, which can significantly reduce the production cost and has good market application prospects.

[0015] Preferably, the application method comprises: using glycerol as a substrate, and fermenting the recombinant Xanthophyll sp. and recombinant Escherichia coli in a seed culture volume ratio of (5-9):(1-5) to obtain 1,3-propylene glycol. The fermentation temperature is preferably 28-30°C.

[0016] Preferably, the method for constructing the recombinant Escherichia coli comprises: overexpressing at least one of the glycerol dehydratase encoding gene dhaB from Klebsiella pneumoniae, the glycerol dehydratase activating factor gdrA / B, the 1,3-propanediol reductase encoding gene dhaT, and the glycerol promoter encoding gene glpF in the chassis bacteria Escherichia coli to construct the recombinant Escherichia coli.

[0017] The present invention also provides a mixed bacteria system for preparing 1,3-propylene glycol by microbial fermentation, comprising: Xanthophyta glutinosus and a strain capable of producing 1,3-propylene glycol; wherein the Xanthophyta glutinosus is a wild-type Xanthophyta glutinosus and / or the recombinant Xanthophyta glutinosus. The Xanthophyta glutinosus may be a wild-type Xanthophyta glutinosus, or the recombinant Xanthophyta glutinosus, or a mixture of a wild-type Xanthophyta glutinosus and a recombinant Xanthophyta glutinosus.

[0018] Preferably, the sticky sword fungus is the recombinant sticky sword fungus.

[0019] Preferably, the strain capable of producing 1,3-propanediol is a recombinant Escherichia coli; the recombinant Escherichia coli expresses at least one of the glycerol dehydratase encoding gene dhaB, the glycerol dehydratase activating factor gdrA / B, and the 1,3-propanediol reductase encoding gene dhaT.

[0020] The present invention also provides a method for preparing 1,3-propylene glycol by fermenting the mixed bacteria system, comprising: taking glycerol as a substrate, fermenting the mixed bacteria system to prepare 1,3-propylene glycol.

[0021] Preferably, the mixed bacterial system includes recombinant Xanthomonas aeruginosa and recombinant Escherichia coli.

[0022] Preferably, the method comprises: using glycerol as a substrate, the recombinant Xanthophyllales and the recombinant Escherichia coli are mixed and fermented in a seed culture solution volume ratio of (5-9):(1-5) to produce 1,3-propanediol.

[0023] Beneficial effects of the present invention: The present invention provides a method for preparing 1,3-propylene glycol based on the microbial fermentation of the recombinant C. adhensii. In this method, the recombinant C. adhensii can not only continuously and stably synthesize coenzyme B12, and provide sufficient coenzyme B12 for the glycerol dehydratase in the 1,3-propylene glycol synthesis pathway, but also has the ability to synthesize 1,3-propylene glycol. Therefore, this method does not need to add expensive vitamin B12 during the fermentation process. In addition, the mixed bacterial system of C. adhensii and recombinant Escherichia coli has good synergy, and the growth of the recombinant C. adhensii will not significantly interfere with the Escherichia coli in the mixed bacterial system, and the normal growth and metabolic state of Escherichia coli can be basically maintained. Experiments have shown that after the mixed bacterial fermentation of recombinant C. adhensii and recombinant microbial Escherichia coli, the product yield can be higher than that of the fermentation of a single strain of recombinant Escherichia coli. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 The production rates of the mixed fermentation products of recombinant Escherichia coli and Xanthophyllales ctenophora in different proportions in Examples 3-4 of the present invention.

[0025] Figure 2The strain composition is the mixed fermentation system of recombinant Escherichia coli and Xanthophyllales with different proportions in Examples 3-4 of the present invention. DETAILED DESCRIPTION

[0026] The following is an explanation of the embodiments of the present invention by specific specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied by other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that, in the absence of conflict, the features in the following embodiments and embodiments can be combined with each other. In the embodiments of the present invention, the methods used are all conventional methods unless otherwise specified, and the reagents used can be obtained from commercial sources.

[0027] Example 1: Construction of recombinant Escherichia coli

[0028] 1. Construction of recombinant plasmids overexpressing dhaB, gdrA / B and dhaT

[0029] Using Klebsiella ATCC10031 as a template and primers F1 / 2, PCR was performed to obtain the dhaB gene, and the PCR product of about 2.7 kb was purified.

[0030] Using Klebsiella ATCC10031 as a template and primers F3 / 4, PCR was performed to obtain a dhaT gene fragment of about 1.1 kb, which was then purified by PCR.

[0031] Using Klebsiella ATCC10031 as template and primers F5 / 6 and F7 / 8 as primers, PCR was performed to obtain two gdrAB fragments of approximately 1.8 kb and 380 bp for PCR purification.

[0032] Using plasmid pCDFDuet as template and primers F9 / 10 as primers, PCR was performed to obtain a vector fragment of about 3.5 kb for PCR purification.

[0033] The purified fragments were recombined using the Gibson Assembly kit (NEB) to obtain a recombinant plasmid named pCDF-dhaB-T-gdrAB.

[0034] 2. The plasmid pCDF-dhaB-T-gdrAB was transformed into Escherichia coli BL21 (DE3) and named as recombinant Escherichia coli BL21 / pCDF-dhaB-T-gdrAB.

[0035] Table 1. Primer table of Example 1

[0036]

[0037] Example 2: Construction of recombinant Xanthophyll sp.

[0038] 1. Construction of recombinant plasmids overexpressing dhaB, gdrA / B, dhaT, and glpF

[0039] Using Klebsiella ATCC13883 as a template and primers F11 / 12, PCR was performed to obtain the dhaB gene, gdrA gene, and glpF gene, and the PCR product of about 5.3 kb was purified.

[0040] Using Klebsiella ATCC13883 as a template and primers F13 / 14, PCR was performed to obtain the dhaT gene fragment and the gdrB fragment, about 1.5 kb, which were PCR purified.

[0041] Using Xanthoceras adhesus ATCC21921 as a template and primers F15 / 16, PCR was performed to obtain the native promoter sequence P1 of Xanthoceras adhesus, about 700 bp, and then purified.

[0042] Using Xanthoceras adhesus ATCC21921 as a template and primers F17 / 18, PCR was performed to obtain the native promoter sequence P2 of Xanthoceras adhesus, about 260 bp, and purified.

[0043] The dhaB gene, gdrA gene and glpF gene were driven by promoter P1, and the dhaT gene and gdrB gene were driven by promoter P2. The above genes were constructed with pSET152 as vector to obtain the recombinant Xanthophyllum plasmid pSET152-dhaB-T-gdrAB-glpF.

[0044] 2. The plasmid pSET152-dhaB-T-gdrAB-glpF was transformed into the sticky sword fungus S17-1 and named as the recombinant sticky sword fungus S17 / pSET152-dhaB-T-gdrAB-glpF.

[0045] Table 2. Primer table of Example 2

[0046]

[0047] F12 ttactcatcgataccgcattcgca

[0048] F13 agaaggtatattatgagctatcgtatgttt

[0049] F14 tcagtttctctcacttaacg

[0050] F15 aatcgttttgatcttttcatATGttctgacctccagtcaaaa

[0051] F16 tatgacatgattacACTAGTttgtcccaaatagccccatg

[0052] F17gatagctcataatataccttctggtcgttctctccttgcagcg

[0053] F18 tgcgaatgcggtatcgatgagtaagccgcccgtgaacctcgattt

[0054] Example 3: Fermentation of recombinant Escherichia coli and recombinant Adhesive Sword to produce 1,3-propanediol

[0055] The recombinant Escherichia coli BL21 / pCDF-dhaB-T-gdrAB in Example 1 was streaked on an LB plate containing 50 mg / L streptomycin and cultured at 36°C for 12-16 h. A single colony from a fresh plate was inoculated into a 250 ml shake flask containing 50 ml seed culture medium and cultured at 36°C for 16-18 h.

[0056] The recombinant S. adhesiomycetes S17 / pSET152-dhaB-T-gdrAB-glpF in Example 2 was cultured on LB medium, and the conjugate grew after conjugation and transfer with S. adhesiomycetes. The conjugate was streaked on a solid culture medium containing 50 mg / L of kanamycin and 100 mg / L of Abraxa, cultured at 30°C for 3-4 days, inoculated into a liquid seed culture medium, and cultured for 2-3 days.

[0057] The solid plate formula includes (g / L): 40 g of sucrose, 10 g of corn powder, 4.8 g of betaine, 0.8 g of ammonium sulfate, 2.2 g of ammonium hydrogen phosphate, 0.8 g of manganese sulfate monohydrate, 0.022 g of cobalt chloride hexahydrate, 0.3 g of magnesium oxide, 0.006 g of DMBI, 0.022 g of zinc sulfate heptahydrate, and 2% of agar.

[0058] The above-mentioned seed culture medium formula includes (g / L): 25.94 corn powder, 20.8 sucrose, 2.3 ammonium sulfate, 1.5 magnesium sulfate heptahydrate, 0.156 manganese sulfate monohydrate, 0.7 ammonium hydrogen phosphate, 2.95 calcium carbonate, 4.2 betaine, 0.004 DMBI, and 0.02 cobalt chloride hexahydrate.

[0059] The above-mentioned recombinant Escherichia coli and the seed liquid of recombinant Sword Bacteria were mixed and inoculated into the fermentation medium at different volume ratios (1:9, 3:7, 5:5, 7:3, 9:1). The total volume of the inoculation volume was 15% of the culture medium. The negative control was set as a mixed fermentation of Saccharopolysaccharides erythrae (Saccharopolysaccharides erythrae also has a vitamin B12 synthesis gene cluster, but it can only produce a trace amount of vitamin B12) and recombinant Escherichia coli BL21 / pCDF-dhaB-T-gdrAB, and the inoculation ratio was 5:5 ( Figure 1 The positive control contained no sticky sword bacteria and only recombinant Escherichia coli BL21 / pCDF-dhaB-T-gdrAB ( Figure 1 Medium green, indicating only recombinant coli). Except for the positive control, which required the supplementation of coenzyme vitamin B12, the other experimental groups and the negative control group did not supplement the negative control.

[0060] Example 4: Fermentation of recombinant Escherichia coli and wild-type Xanthophyllales to produce 1,3-propanediol

[0061] The wild-type strain of Xanthophyllales was streaked on a solid culture medium and incubated at 30°C for 3-4 days, inoculated into a seed culture medium, and cultured for 2-3 days.

[0062] The recombinant E. coli in Example 1 was streaked on LB solid culture medium and incubated at 37° C. for 12-16 hours. A single colony was picked and inoculated into an LB seed bottle and incubated for 12-14 hours.

[0063] The above-mentioned recombinant Escherichia coli and the seed liquid of wild-type Xanthophyllales were mixed and inoculated into the fermentation medium at different volume ratios (1:9, 3:7, 5:5, 7:3, 9:1), and the total volume of the inoculation amount was 15% of the medium.

[0064] The fermentation system in Example 3 and Example 4 was cultured for about 20-24 hours at a fermentation temperature of 30°C. During the fermentation process, 50 g / L of glycerol was added. After 24 hours of fermentation, it was detected that the recombinant Escherichia coli and the recombinant Sword fungus mixed bacterial experimental group both produced 1,3-propylene glycol, indicating that the constructed mixed bacterial system can convert glycerol into 1,3-propylene glycol without adding B12. Figure 1 , under the condition that the recombinant Escherichia coli and the wild-type sticky sword bacteria / recombinant sticky sword bacteria were mixed in a volume ratio of 9:1, the mixed bacterial system containing the wild-type sticky sword bacteria ( Figure 1 The product production rate of wild eah was about 0.61 g / L·h, and the glycerol conversion rate was about 0.56 mol / mol; the mixed bacterial system containing recombinant Sword fungus ( Figure 1 Medium yellow, marked as recombinant eah) is about 0.65g / L·h; while the positive control is 0.58g / L·h( Figure 1The medium green color indicates that only the recombinant coli was used, and the glycerol conversion rate was about 0.39 mol / mol. This result shows that without the addition of coenzyme B12, the production rate of 1,3-propanediol in the mixed bacterial system containing wild-type Xylocopa glutinosus is almost the same as that in the positive control, and the glycerol conversion rate is higher, while the mixed bacterial system containing recombinant Xylocopa glutinosus produces 1,3-propanediol faster than the positive control.

[0065] After 24 hours of fermentation, the 16S rRNA component of the strain in the fermentation broth was identified. Figure 2 As shown. The results show that at any ratio between 1:9 and 9:1, E. coli (blue) can always be in a growth advantage, and Xanthophyll (orange) does not interfere with its growth metabolism. The mixed bacterial system of wild-type Xanthophyll or the recombinant Xanthophyll and recombinant E. coli has good synergy, and the growth of recombinant Xanthophyll will not significantly interfere with the E. coli in the mixed bacterial system, and can basically maintain the normal growth and metabolic state of E. coli.

[0066] The embodiments described above are merely descriptions of preferred implementations of the present invention and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope of the present invention.

Claims

1. A method for constructing a recombinant sword-shaped bacteria, characterized in that: include: At least one of the glycerol dehydratase encoding gene, the glycerol dehydratase activating factor gdrA / B, the 1,3-propanediol reductase encoding gene dhaT, and the glycerol promoter encoding gene glpF is overexpressed in the bottom fungus Xanthophyll sticky sword to construct a recombinant Xanthophyll sticky sword; wherein the glycerol dehydratase depends on coenzyme B12 to produce activity.

2. The method according to claim 1, characterized in that The glycerol dehydratase encoding gene dhaB is derived from Klebsiella, or other glycerol dehydratase genes with similar activity that requires coenzyme B12; and / or, The glycerol dehydratase activator gdrA is derived from one of Klebsiella, Clostridium butyricum or Clostridium pasteurianum; and / or, the glycerol dehydratase activator gdrB is derived from one of Klebsiella, Clostridium butyricum or Clostridium pasteurianum; and / or, the 1,3-propanediol reductase encoding gene dhaT is derived from one of Klebsiella, Clostridium butyricum or Clostridium pasteurianum; and / or, The glycerol promoter encoding gene glpF is derived from Klebsiella.

3. The method according to claim 1, characterized in that The glycerol dehydratase encoding gene dhaB, the glycerol dehydratase activating factor gdrA, and the glycerol promoter encoding gene glpF are regulated by promoter P1, and the nucleotide sequence of promoter P1 is shown in SEQ ID NO.5; and / or, The 1,3-propanediol reductase encoding gene dhaT and the glycerol dehydratase activating factor gdrB are regulated by promoter P2, and the nucleotide sequence of P2 is shown in SEQ ID NO.

6.

4. The method according to any one of claims 1 to 3, characterized in that: include: The glycerol dehydratase encoding gene dhaB from Klebsiella, the glycerol dehydratase activating factor gdrA / B from Klebsiella, the 1,3-propanediol reductase encoding gene dhaT from Klebsiella, and the glycerol promoting factor encoding gene glpF from Klebsiella were introduced into the chassis fungus Sword-shaped fungus S17-1 through a vector to construct a recombinant Sword-shaped fungus.

5. The recombinant Xanthophyllum adhensinum obtained by the method according to any one of claims 1 to 3.

6. Use of the recombinant Xanthophyllales as claimed in claim 5 in the preparation of 1,3-propylene glycol by microbial fermentation.

7. A mixed bacteria system for preparing 1,3-propylene glycol by microbial fermentation, characterized in that: include: A strain of Xanthophyta with the ability to produce 1,3-propanediol; wherein the Xanthophyta is a wild-type Xanthophyta and / or the recombinant Xanthophyta as described in claim 5.

8. The mixed bacteria system according to claim 7, characterized in that: The strain capable of producing 1,3-propanediol is a recombinant Escherichia coli; the recombinant Escherichia coli expresses at least one of a glycerol dehydratase encoding gene dhaB, a glycerol dehydratase activating factor gdrA / B, and a 1,3-propanediol reductase encoding gene dhaT.

9. A method for preparing 1,3-propylene glycol by fermentation using the mixed bacteria system according to any one of claims 7 to 8, characterized in that: include: The mixed bacteria system is fermented with glycerol as a substrate to produce 1,3-propylene glycol.

10. The method according to claim 9, characterized in that The mixed bacterial system includes recombinant Xanthomonas aeruginosa and recombinant Escherichia coli; With glycerol as substrate, the recombinant Xanthophyllales and the recombinant Escherichia coli are mixed and fermented in a seed culture solution volume ratio of (5-9):(1-5) to produce 1,3-propylene glycol.

Images