Herbicide-resistant acetyl-CoA carboxylase mutants and their applications

Abstract

The present invention provides a mutant acetyl-CoA carboxylase (ACC) protein, nucleic acid and its application. Specifically, it relates to a mutant acetyl-CoA carboxylase (ACC) protein, nucleic acid and its application in plant breeding. Specifically, the present invention provides a mutant acetyl-CoA carboxylase (ACC) protein, and compared with the parental acetyl-CoA carboxylase (ACC) protein, the mutant acetyl-CoA carboxylase (ACC) protein has mutations at the 1879th and / or 2186th amino acids corresponding to SEQ ID NO.: 1. Plants with mutated acetyl-CoA carboxylase (ACC) have high herbicide resistance and have very broad application prospects in the cultivation of herbicide-resistant plants.

Description

Technical Field

[0001] The present invention belongs to the fields of biotechnology and crop genetic breeding, and particularly relates to an acetyl-CoA carboxylase mutant protein, nucleic acid and a method and application thereof in improving plant resistance to herbicides. Background Art

[0002] Rice (Oryza sativa) is consumed by two-thirds of the world's population and is the main source of energy in the diet of at least half of them. Rice is a low-cost food that is easy and quick to prepare and can be eaten in a variety of dishes.

[0003] The use of herbicides to control weeds or plants in crops has become a nearly universal practice. As an essential component of modern agricultural production systems, herbicides are the most reliable and economical means of farmland weed control. Since the introduction of 2,4-D in the 1940s, the herbicide industry has developed over 60 years of history, and a large number of selective herbicides have been successfully developed. Research on ACCase inhibitors began in the 1970s. ACC herbicides are classified into four types: aryloxyphenoxypropanoates (APP), oxime ether cyclohexanedione oximes (CHD), aryloxyphenylcyclohexanedione (APCHD), and triketone cyclohexanedione (CTR). ACC herbicides inhibit fatty acid synthesis in grasses, are highly selective, and are transmissible throughout the plant, enabling post-emergence control of annual and perennial grass weeds. It has the advantages of high efficiency, low toxicity, long application period, and safety to subsequent crops, and therefore occupies an important position in the herbicide market.

[0004] Acetyl-CoA carboxylase (ACCase, ACC) is a biotin-containing enzyme discovered in 1958 and a key target of chemical herbicides. It catalyzes the carboxylation of acetyl-CoA to form malonyl-CoA, which provides the substrate for the synthesis of fatty acids and many secondary metabolites. It is a key or rate-limiting enzyme in fatty acid biosynthesis. This carboxylase undergoes a two-step reversible reaction, involving ATP-dependent carboxylation of the biotin group on the substrate domain by biotin-carboxylase activity, followed by transfer of the carboxyl group from biotin to the acetyl-CoA substrate by a carboxyltransferase. Acetyl-CoA carboxylase is a key enzyme in fatty acid biosynthesis in plants, a process that occurs in chloroplasts and mitochondria. ACC also plays a role in the formation of long-chain fatty acids and flavonoids, as well as in malonylation in the cytoplasm. Summary of the Invention

[0005] The present invention aims to provide a mutant acetyl-CoA carboxylase (ACC) protein or polynucleotide capable of conferring herbicide resistance to plants and its application.

[0006] Herein, ACCase or ACC refers to Acetyl CoA carboxylase.

[0007] Mutant acetyl-CoA carboxylase (ACC)

[0008] In one aspect, the present invention provides a mutant acetyl-CoA carboxylase (ACC), wherein the mutant acetyl-CoA carboxylase (ACC) is mutated at amino acid position 1879 and / or amino acid position 2186 corresponding to the amino acid sequence shown in SEQ ID NO.: 1, compared with the amino acid sequence of the parent acetyl-CoA carboxylase (ACC).

[0009] In one embodiment, the 1879th amino acid of the parent ACC is isoleucine (I), and the 2186th amino acid is cysteine ​​(C).

[0010] In one embodiment, the isoleucine (I) at position 1879 is mutated to an amino acid other than isoleucine (I), and the amino acid other than isoleucine (I) is selected from one or more amino acids in the group consisting of alanine (A), valine (V), glycine (G), leucine (L), glutamine (Q), phenylalanine (F), tryptophan (W), tyrosine (Y), aspartic acid (D), asparagine (N), glutamic acid (E), lysine (K), methionine (M), serine (S), threonine (T), cysteine ​​(C), proline (P), histidine (H) or arginine (R).

[0011] In a preferred embodiment, the isoleucine (I) at position 1879 is mutated to valine (V).

[0012] In one embodiment, the cysteine ​​(C) at position 2186 is mutated to an amino acid other than cysteine ​​(C), and the amino acid other than cysteine ​​(C) is selected from one or more amino acids in the group consisting of alanine (A), valine (V), glycine (G), leucine (L), isoleucine (I), phenylalanine (F), tryptophan (W), tyrosine (Y), aspartic acid (D), asparagine (N), lysine (K), glutamine (Q), methionine (M), serine (S), threonine (T), glutamate (E), proline (P), histidine (H) or arginine (R).

[0013] In a preferred embodiment, the cysteine ​​(C) at position 2186 is mutated to arginine (R).

[0014] In one embodiment, the mutation is selected from the group consisting of I1879V, C2186R, or a combination thereof.

[0015] In one embodiment, the parent acetyl-CoA carboxylase (ACC) can be derived from any plant.

[0016] In one embodiment, the parent acetyl-CoA carboxylase (ACC) is derived from one or more plants selected from the group consisting of: grasses, leguminous plants, chenopodiaceae, and cruciferous plants.

[0017] In one embodiment, the parent acetyl-CoA carboxylase (ACC) is derived from one or more plants selected from the group consisting of Arabidopsis thaliana, rice, tobacco, corn, sorghum, barley, wheat, millet, soybean, tomato, potato, quinoa, lettuce, rapeseed, cabbage, and strawberry.

[0018] In a preferred embodiment, the parent acetyl-CoA carboxylase (ACC) of the present invention is derived from the genus Oryza, particularly rice.

[0019] In one embodiment, the parent acetyl-CoA carboxylase (ACC) has ACC activity, and the amino acid sequence of the parent ACC has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO.: 1.

[0020] In a preferred embodiment, the amino acid sequence of the parent ACC has the sequence shown in SEQ ID NO.: 1, or the amino acid sequence of the parent ACC is as shown in SEQ ID NO.: 1.

[0021] In one embodiment, the mutant ACC has a homology of at least 60% to any one of SEQ ID NOs.: 2-4, preferably at least 70%, more preferably at least 80%, and most preferably at least 90%, such as 95%, 97%, or 99%.

[0022] In one embodiment, the mutant ACC is a polypeptide having an amino acid sequence as shown in any one of SEQ ID NOs.: 2-4, an active fragment thereof, or a conservative variant polypeptide thereof.

[0023] In one embodiment, the amino acid sequence of the mutant ACC is shown in any one of SEQ ID NOs.: 2-4.

[0024] Fusion protein

[0025] On the other hand, the present invention provides a fusion protein comprising the mutant ACC protein of the present invention; further, the fusion protein also includes: a tag peptide such as a histidine tag, 6×His, or a plastid-directing peptide, such as a peptide that directs into the chloroplast, or a regulatory element, such as a promoter sequence, a terminator sequence, a leader sequence, a polyadenylation sequence, a marker gene, etc.

[0026] polynucleotides

[0027] On the other hand, the present invention provides a polynucleotide encoding the mutant ACC protein or an active fragment thereof.

[0028] In one embodiment, the polynucleotide is selected from the group consisting of:

[0029] (a) a polynucleotide encoding a protein as shown in any one of SEQ ID NOs.: 2-4;

[0030] (b) a polynucleotide whose sequence is shown in any one of SEQ ID NOs.: 5-7;

[0031] (c) a polynucleotide having a nucleotide sequence homology of ≥80% (preferably ≥90%, more preferably ≥95%, and most preferably ≥98%) to the sequence shown in SEQ ID NO.:5 and encoding the protein shown in SEQ ID NO.:2; or a polynucleotide having a nucleotide sequence homology of ≥80% (preferably ≥90%, more preferably ≥95%, and most preferably ≥98%) to the sequence shown in SEQ ID NO.:6 and encoding the protein shown in SEQ ID NO.:3; or a polynucleotide having a nucleotide sequence homology of ≥80% (preferably ≥90%, more preferably ≥95%, and most preferably ≥98%) to the sequence shown in SEQ ID NO.:7 and encoding the protein shown in SEQ ID NO.:4;

[0032] (d) A polynucleotide complementary to the polynucleotide described in any one of (a) to (c).

[0033] In one embodiment, the polynucleotide is selected from the group consisting of a genomic sequence, a cDNA sequence, an RNA sequence, or a combination thereof.

[0034] In one embodiment, the polynucleotide is preferably single-stranded or double-stranded.

[0035] In one embodiment, the polynucleotide further contains auxiliary elements flanking the ORF of the mutant protein selected from the following groups: a signal peptide, a secretory peptide, a tag sequence (such as 6His), a nuclear localization signal (NLS) or a combination thereof.

[0036] In one embodiment, the polynucleotide further comprises a promoter operably linked to the ORF sequence of the mutant polypeptide.

[0037] In one embodiment, the promoter is selected from the group consisting of a constitutive promoter, a tissue-specific promoter, an inducible promoter, or a strong promoter.

[0038] Nucleic acid constructs

[0039] In another aspect, the present invention provides a nucleic acid construct comprising the polynucleotide and a regulatory element operably linked thereto.

[0040] In one embodiment, the regulatory element is selected from one or more of the following groups: enhancer, transposon, promoter, terminator, leader sequence, polyadenylation sequence, marker gene.

[0041] carrier

[0042] The present invention also provides a vector comprising a nucleic acid sequence encoding the mutant ACCase or fusion protein of the present invention. Preferably, the vector further comprises an expression control element operably linked to the nucleic acid sequence.

[0043] In one embodiment, the vector includes a cloning vector, an expression vector, a shuttle vector, and an integration vector.

[0044] In one embodiment, the vector can be a vector for gene editing the endogenous ACC gene of the host cell.

[0045] In one embodiment, the vector contains a polynucleotide encoding a polypeptide as shown in any one of SEQ ID NOs.: 2-4.

[0046] In one embodiment, the expression vector further contains at least one replication origin to achieve self-replication.

[0047] In one embodiment, the vector may be one which, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated.

[0048] The vector can be a plasmid, virus, cosmid, phage, etc., which are well known to those skilled in the art.

[0049] Preferably, the vector in the present invention is a plasmid.

[0050] Editing vector system

[0051] In another aspect, the present invention provides an editing vector system capable of producing the aforementioned mutant ACC in plants. The editing vector system comprises one or more vectors, each of which comprises at least a guide sequence targeting the parental ACC.

[0052] The guide sequence contains a nucleotide sequence of part of the parental ACC, preferably contains at least 15bp of ACC nucleotide sequence, and more preferably includes at least 20bp of ACC nucleotide sequence. In one embodiment, the editing vector also includes a gene editing enzyme. The gene editing enzyme includes nucleases of CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats), TALEN (Tanscription Activator-like (TAL) effector nucleases), and ZFN (Zinc finger nuclease) editing tools.

[0053] Preferably, the gene editing enzyme is a Cas protein, also known as CRISPR enzyme or Cas effector protein, and its types include but are not limited to: Cas9 protein, Cas12 protein, Cas13 protein, Cas14 protein, Csm1 protein, FDK1 protein.

[0054] Preferably, the Cas protein is operably linked to a first regulatory element.

[0055] In one embodiment, the gene editing enzyme is a Cas9 protein, and the vector further includes a Scaffold sequence that can specifically bind to the Cas9 protein. After the Scaffold sequence is operably connected to the guide sequence, it constitutes a guide sequence (gRNA). Preferably, the gRNA is operably connected to the second regulatory element.

[0056] In other embodiments, the gene editing enzyme is a Cas12 protein, for example, Cas12a, Cas12b, or Cas12i, and the vector further includes a unidirectional repeat sequence (DirectRepeat) that specifically binds to the Cas12 protein. After the unidirectional repeat sequence is operably connected to the guide sequence, a guide guide sequence (gRNA) is formed. Preferably, the gRNA is operably connected to the second regulatory element.

[0057] Such regulatory elements include promoters, terminator sequences, leader sequences, polyadenylation sequences, signal peptide coding regions, marker genes, enhancers, internal ribosome entry sites (IRES), and other expression control elements (e.g., transcription termination signals, such as polyadenylation signals and poly-U sequences).

[0058] Preferably, the editing vector system further comprises a base editing element, and the base editing element is selected from adenine deaminase and / or cytosine deaminase.

[0059] In one embodiment, the editing vector further comprises resistance genes for easy screening, wherein the resistance genes include hyg, bar, kana, rif, spec, and amp, and the resistance genes are well known to those skilled in the art.

[0060] Preferably, the guide sequence of the gRNA is A-ACC1879: GAGAATATACATGGAAGTGC, A-ACC2186: ATAGCACTCAATGCGGTCTG, or a combination thereof.

[0061] Preferably, the Cas protein is nCas9 or other Cas9 proteins with nick activity, where "n" represents nick, i.e., a Cas protein with only single-strand cleavage activity.

[0062] host cells

[0063] On the other hand, the present invention provides a host cell, which contains the mutant acetyl-CoA carboxylase (ACC), the gene encoding the mutant acetyl-CoA carboxylase (ACC), the fusion protein, the vector and the nucleic acid construct, or the polynucleotide is integrated into the host cell genome.

[0064] In one embodiment, the host cell is a prokaryotic cell, such as Escherichia coli.

[0065] In one embodiment, the host cell is a plant cell, and the plant includes angiosperms and gymnosperms.

[0066] In one embodiment, the plants include monocots and dicots.

[0067] In one embodiment, the plants include herbaceous plants and woody plants.

[0068] In one embodiment, the plant comprises Arabidopsis, tobacco, rice, corn, sorghum, barley, wheat, millet, soybean, tomato, potato, quinoa, lettuce, rapeseed, cabbage, or strawberry.

[0069] Resistant plants

[0070] On the other hand, the present invention provides a herbicide-resistant plant, which contains the mutant acetyl-CoA carboxylase (ACC), the polynucleotide encoding the mutant acetyl-CoA carboxylase (ACC), the fusion protein, the vector and the nucleic acid construct, or the polynucleotide is integrated into the plant genome.

[0071] The term "substantially identical" means that the two amino acid sequences are 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical.

[0072] Method for preparing mutant polypeptides

[0073] In another aspect, the present invention provides a method for preparing the mutant ACC polypeptide or an active fragment thereof, the method comprising the steps of:

[0074] (a) culturing a host cell containing the mutant ACC polypeptide under conditions suitable for expression, thereby expressing the mutant ACC polypeptide; preferably, the method further comprises:

[0075] (b) a step of isolating the mutant ACC polypeptide.

[0076] Method for obtaining herbicide-resistant plants

[0077] On the other hand, the present invention provides a plant cell, plant seed, plant tissue, plant part, or plant having herbicide resistance, wherein the plant cell, plant tissue, plant seed, plant part, or plant contains the mutant ACC polypeptide or its polynucleotide sequence.

[0078] In another aspect, the present invention provides a method for obtaining or preparing a plant cell, plant seed, plant tissue, plant part or plant having herbicide resistance, the method comprising introducing the mutant ACC polypeptide or its polynucleotide sequence into the plant cell, plant seed, plant tissue, plant part or plant.

[0079] In one embodiment, the introduction of the ACC mutant polypeptide of the present invention comprises the step of expressing the ACC mutant polypeptide in plant cells, plant seeds, plant tissues, plant parts or plants, for example, expressing the mutant polypeptide through an expression vector, or integrating the mutant polypeptide into the plant genome for expression.

[0080] In another preferred embodiment, the above method comprises the following steps:

[0081] (1) Providing Agrobacterium carrying an expression vector, wherein the expression vector contains the DNA coding sequence of the mutant ACC polypeptide or its active fragment;

[0082] (2) contacting plant cells, plant tissues, or plant parts with the Agrobacterium of step (1), thereby transferring the DNA coding sequence of the mutant ACC polypeptide or its active fragment into the plant cells and integrating it into the chromosomes of the plant cells; and

[0083] (3) Selecting a plant cell into which the DNA coding sequence of the mutant ACC polypeptide or its active fragment has been transferred.

[0084] In one embodiment, the introduction of the ACC mutant polypeptide comprises the step of mutating the endogenous ACC of the plant to thereby introduce the mutant polypeptide; preferably, the mutant polypeptide can be introduced by gene editing.

[0085] In another preferred embodiment, the method comprises the step of mutating the endogenous ACC coding sequence of plant cells, plant seeds, plant tissues, and plant parts at amino acid positions 1879 and / or 2186 corresponding to SEQ ID NO.: 1.

[0086] In another preferred embodiment, the method comprises the following steps:

[0087] (1) introducing the aforementioned editing vector system into plant cells, plant seeds, plant tissues, or plant parts;

[0088] (2) allowing gene editing tools to act on its endogenous ACC coding sequence and causing mutations at amino acid sites 1879 and / or 2186 corresponding to SEQ ID NO.: 1.

[0089] Furthermore, the above method also includes the steps of screening mutated plant cells, plant tissues, plant parts, and optionally, isolating the gene editing tool.

[0090] In another preferred embodiment, the gene editing tools include CRISPR, TALEN and ZFN.

[0091] In another preferred embodiment, the plants include angiosperms and gymnosperms.

[0092] In another preferred embodiment, the plants include monocotyledonous plants and dicotyledonous plants.

[0093] In another preferred embodiment, the plants include herbaceous plants and woody plants.

[0094] In another preferred embodiment, the plants include Arabidopsis, tobacco, rice, corn, sorghum, barley, wheat, millet, soybean, tomato, potato, quinoa, lettuce, rapeseed, cabbage, and strawberry.

[0095] In one embodiment, a plant containing the mutant polypeptide has a maximum tolerance to a herbicide concentration that is at least 1-4 times higher, e.g., 2-fold, 3-fold, or 4-fold higher, than that of the parent plant. When a herbicide is applied, the plant containing the mutant polypeptide of the present invention can tolerate at least 2-4 times the recommended herbicide dose, whereas the parent plant cannot tolerate this herbicide concentration.

[0096] Methods of weed control

[0097] In another aspect, the present invention also provides a method for controlling weed growth near plants, comprising:

[0098] a) providing the above-mentioned herbicide-resistant plants;

[0099] b) applying an effective amount of a herbicide to the plants and weeds in the vicinity of the plants, thereby controlling the weeds in the vicinity of the plants.

[0100] The plant is preferably rice.

[0101] The herbicide comprises one or more of aryloxyphenoxypropanoates (APP), cyclohexanedione oximes (CHD), aryloxyphenylcyclohexanedione (APCHD) and cyclohexanedione triketones (CTR). Preferably, the herbicide comprises one or more of fenpropimorph, fenpropimorph, clethodim, cyclohexenethioprine, cycloxydim, sethoxydim, pyraclostrobin, trimethylol, phenylacetophenone, clodinafop-butyl, clodinafop-propyl, chlorobutane, fenpropimorph, oxadiazol-butyl, fenpropimorph, thiazolinone, fluazifop-butyl, fluazifop-butyl, pyraclostrobin, pyraclostrobin, isopropyl, cyclohexanone, cypermethrin, quizalofop-butyl, quizalofop-ethyl, quizalofop-ethyl, trifluoxetine, pinoxaden, or their salts or esters.

[0102] Preferably, the herbicide is one or more of sethoxydim, phenacetothioprine, and clethodim.

[0103] use

[0104] On the other hand, the present invention provides uses of the mutant acetyl-CoA carboxylase (ACC), the gene encoding the mutant acetyl-CoA carboxylase (ACC), the fusion protein, the vector or the nucleic acid construct in a reagent or kit for preparing plants having herbicide resistance.

[0105] On the other hand, the present invention provides uses of the mutant acetyl-CoA carboxylase (ACC), the gene encoding the mutant acetyl-CoA carboxylase (ACC), the fusion protein, the vector or the nucleic acid construct in controlling weeds.

[0106] On the other hand, the present invention provides uses of the mutant acetyl-CoA carboxylase (ACC), the gene encoding the mutant acetyl-CoA carboxylase (ACC), the fusion protein, the vector or the nucleic acid construct in preparing plants with herbicide resistance.

[0107] herbicide

[0108] In one embodiment, the herbicide of the present invention is an ACCase-inhibiting herbicide, and the ACCase-inhibiting herbicide includes but is not limited to one or more of aryloxyphenoxypropanoates (APP), oxime ether cyclohexanedione (CHD), aryloxyphenylcy-clohexanedione (APCHD) and triketone cyclohexanedione (CTR).

[0109] Preferably, the herbicide of the present invention includes but is not limited to fenpropimorph, fenpropimorph, clethodim, cyclohexene chlorpyrifos, cycloxydim, sethoxydim, pyraclostrobin, trimethylol, phenylacetophenone, clodinafop-butyl, clodinafop-butyl, chlorobutane, fenpropimorph, oxadiazol-butyl, fenpropimorph, thiazolinone, fluazifop-butyl, fluazifop-butyl, fluazifop-butyl, fenpropimorph, isopropylamine, cyclohexanone, fenpropimorph, quizalofop-ethyl, quizalofop-ethyl, quizalofop-ethyl, trifluoxetine, pinoxaden, or one or more of its salts or esters. Preferably, the herbicide is one or more of fenpropimorph, sethoxydim and clethodim.

[0110] General Definition

[0111] Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

[0112] The terms "polynucleotide," "nucleotide sequence," "nucleic acid sequence," "nucleic acid molecule," and "nucleic acid" are used interchangeably and include DNA, RNA, or hybrids thereof, which may be double-stranded or single-stranded.

[0113] The term "homology" or "identity" is used to refer to the matching of sequences between two polypeptides or between two nucleic acids. Therefore, the compositions and methods of the present invention also include homologs of the nucleotide sequences and polypeptide sequences of the present invention (e.g., SEQ ID NOs: 1-7). "Homology" can be calculated by known methods including, but not limited to, Computational Molecular Biology (Lesk, A.M., ed.) Oxford University Press, New York (1988); Biocomputing: Informatics and Genome Projects (Smith, D.W., ed.) Academic Press, New York (1993); Computer Analysis of Sequence Data, Part I (Griffin, A.M. and Griffin, H.G., eds.) Humana Press, New Jersey (1994); Sequence Analysis in Molecular Biology (von Heinje, G., ed.) Academic Press (1987); and Sequence Analysis Primer (Gribskov, M. and Devereux, J., eds.) Stockton, NJ (1993). Stockton Press, New York (1991).

[0114] Specific amino acid positions (numbers) within the proteins of the present invention are determined by aligning the amino acid sequence of the target protein with SEQ ID NO. 1 using standard sequence alignment tools, such as the Smith-Waterman algorithm or the CLUSTALW2 algorithm, wherein the sequences are considered aligned when the alignment score is the highest. The alignment score can be calculated according to the method described in Wilbur, WJ and Lipman, DJ (1983) Rapid similarity searches of nucleic acid and protein data banks. Proc. Natl. Acad. Sci. USA, 80: 726-730. The default parameters for the ClustalW2 (1.82) algorithm are preferably used: protein gap open penalty = 10.0; protein gap extension penalty = 0.2; protein matrix = Gonnet; protein / DNA end gap = -1; protein / DNAGAPDIST = 4. Preferably, the AlignX program (part of the vectorNTI suite) is used to determine the position of specific amino acids within a protein by aligning the amino acid sequence of the protein with SEQ ID No. 1 using default parameters suitable for multiple alignment (gap opening penalty: 10 log, gap extension penalty 0.05).

[0115] The term "encode" refers to the inherent property of a particular nucleotide sequence in a polynucleotide, such as a gene, cDNA, or mRNA, to serve as a template for the synthesis of other polymers and macromolecules in a biological process having a defined nucleotide sequence (i.e., rRNA, tRNA, and mRNA) or a defined amino acid sequence and the resulting biological properties. Thus, a gene encodes a protein if transcription and translation of the mRNA corresponding to that gene produces the protein in a cell or other biological system.

[0116] The term "amino acid" refers to a carboxylic acid containing an amino group. Various proteins in living organisms are composed of 20 basic amino acids.

[0117] The terms "protein," "polypeptide," and "peptide" are used interchangeably herein to refer to a polymer of amino acid residues, including polymers in which one or more amino acid residues is a chemical analog of a naturally occurring amino acid residue. The proteins and polypeptides of the present invention can be produced recombinantly or by chemical synthesis.

[0118] The term "mutant protein" or "mutant protein" refers to a protein that has one or more amino acid residue substitutions, insertions, deletions and / or additions compared to the amino acid sequence of a parent protein.

[0119] The term "AxxB" indicates that the amino acid A at position xx is changed to amino acid B, for example, I1879V indicates that the I at position 1879 is changed to V, C2186R indicates that the C at position 2186 is changed to amino acid R, and so on. For double or multiple mutations, each mutation is separated by " / ", for example, I1879V / C2186R indicates that, relative to the amino acid sequence of SEQ ID NO.: 1, the I at position 1879 is replaced by V and the C at position 2186 is replaced by R, and both mutations are present in the specific mutant ACC protein.

[0120] The term "regulatory element", also known as "regulatory element", as used herein, is intended to include promoters, terminator sequences, leader sequences, polyadenylation sequences, signal peptide coding regions, marker genes, enhancers, internal ribosome entry sites (IRES), and other expression control elements (e.g., transcription termination signals, such as polyadenylation signals and poly-U sequences), which are described in detail in Goeddel, GENE EXPRESSION TECHNOLOGY: METHODS IN ENZYMOLOGY 185, Academic Press, San Diego, CA (1990). In some cases, regulatory elements include those that direct constitutive expression of a nucleotide sequence in many types of host cells and those that direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). Tissue-specific promoters can primarily direct expression in the desired tissue of interest, such as muscle, neurons, bone, skin, blood, specific organs (e.g., liver, pancreas), or special cell types (e.g., lymphocytes). In some cases, regulatory elements can also direct expression in a temporally dependent manner (e.g., in a cell cycle-dependent or developmental stage-dependent manner), which may or may not be tissue- or cell-type-specific. In some cases, the term "regulatory element" encompasses enhancer elements such as WPRE; CMV enhancer; R-U5' fragment in the LTR of HTLV-I ((Mol. Cell. Biol., Vol. 8(1), pp. 466-472, 1988); SV40 enhancer; and intron sequences between exons 2 and 3 of rabbit β-globin (Proc. Natl. Acad. Sci. USA., Vol. 78(3), pp. 1527-31, 1981).

[0121] As used herein, the term "promoter" has a meaning well known to those skilled in the art and refers to a non-coding nucleotide sequence located upstream of a gene that can initiate expression of a downstream gene. A constitutive promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or defining a gene product, results in the production of the gene product in a cell under most or all physiological conditions of the cell. An inducible promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or defining a gene product, results in the production of the gene product in the cell substantially only when an inducer corresponding to the promoter is present in the cell. A tissue-specific promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or defining a gene product, results in the production of the gene product in the cell substantially only when the cell is a cell of the tissue type corresponding to the promoter.

[0122] A "nuclear localization signal" or "nuclear localization sequence" (NLS) is an amino acid sequence that "tags" proteins for import into the cell nucleus via nuclear transport. That is, proteins with an NLS are transported to the cell nucleus. Typically, an NLS comprises a positively charged Lys or Arg residue exposed on the protein surface. Exemplary NLSs include, but are not limited to, NLSs from the SV40 large T antigen, EGL-13, c-Myc, and TUS proteins.

[0123] As used herein, the term "operably linked" is intended to mean that the nucleotide sequence of interest is linked to the one or more regulatory elements in a manner that allows for expression of the nucleotide sequence (e.g., in an in vitro transcription / translation system or in a host cell when the vector is introduced into the host cell).

[0124] The term "vector" refers to a vector that contains elements that allow the vector to be integrated into the host cell genome or to replicate autonomously within the cell independently of the genome. The vector may contain any elements that ensure self-replication. It usually carries genes that are not part of the central metabolism of the cell and is usually in the form of double-stranded DNA. The choice of vector usually depends on the compatibility of the vector with the host cell into which the vector is to be introduced. If a vector is used, the choice of vector depends on methods well known to those skilled in the art for transforming host cells. For example, a plasmid vector can be used.

[0125] The term "ACC herbicide" refers to a class of herbicides that inhibit fatty acid synthesis in grasses. They are highly selective and transmissible within the plant, enabling post-emergence control of annual and perennial grass weeds. They hold a prominent position among herbicides due to their high efficacy, low toxicity, long application period, and safety for subsequent crops.

[0126] ACC herbicides are divided into four types: Aryloxyphenoxypropanoates (APP), Cyclohexanedione oximes (CHD), Aryloxyphenylcy-clohexanedione (APCHD) and Cyclict riketones (CTR). The results are shown below.

[0127]

[0128] The herbicides include but are not limited to: fenpropimorph, fenpropimorph, sethoxydim, cyclohexenethioprine, cycloxydim, sethoxydim, pyraclostrobin, trimethylol, clodinafop-butyl, clodinafop-butyl, chlorobutane, fenpropimorph, fenpropimorph, fenpropimorph, thiazolin-butyl, fluazifop-butyl, fluazifop-butyl, fluazifop-butyl, isocyanate, cyclohexim, cypermethrin, quizalofop-butyl, quizalofop-ethyl, quizalofop-ethyl, trifluoperoxypropionic acid, and pinoxaden.

[0129] "Herbicide resistance" or "herbicide resistance" refers to the inherited ability of a plant to survive and reproduce after exposure to a dose of a herbicide that is normally lethal to the wild type. In plants, resistance may be naturally occurring or induced by techniques such as genetic engineering or selection of variants produced by tissue culture or mutagenesis. Unless otherwise indicated, herbicide "resistance" is heritable and allows a plant to grow and reproduce in the presence of a typical herbicidally effective treatment of a given plant with a herbicide, as suggested by the current edition of the Herbicide Handbook at the time of filing of this disclosure. As will be appreciated by those skilled in the art, a plant may still be considered "resistant" even if some degree of plant damage due to herbicide exposure is evident. As used herein, the term "tolerant" or "tolerance" includes "resistant" or "resistant" plants as defined herein, as well as the improved ability of a particular plant to tolerate various degrees of herbicide-induced damage, typically ethyl, in wild-type plants of the same genotype, at the same herbicide dose.

[0130] The terms "parental ACC polypeptide" and "parental ACC polypeptide" refer to the polypeptide from which the ACC mutant polypeptide is derived. In preferred embodiments, the parent ACC polypeptide is a nucleic acid molecule or protein (polypeptide) that can be found in nature, and its nucleotide sequence can be obtained through genetic engineering techniques, such as genome sequencing, polymerase chain reaction (PCR), etc., and its amino acid sequence can be deduced from the nucleotide sequence. The amino acid sequence of the wild-type ACC polypeptide is, for example, as shown in SEQ ID NO.: 1. In certain embodiments, the parent ACC polypeptide can be a polypeptide in which one or more amino acid residues of the wild-type ACC polypeptide are changed, but the enzymatic activity of the polypeptide is not affected.

[0131] The terms "mutated ACC protein," "mutant ACC protein," "mutant ACC," "mutant ACCase," "mutant protein," "mutant polypeptide," "polypeptide of the present invention," "protein of the present invention," and the like are used interchangeably. Preferably, the mutant protein has a mutation at amino acid position 1879 and / or amino acid position 2186 corresponding to the sequence set forth in SEQ ID NO.: 1.

[0132] The term "host organism" should be understood as any unicellular or multicellular organism into which a mutant ACC protein encoding nucleic acid can be introduced, including, for example, bacteria such as Escherichia coli, fungi such as yeast (e.g., Saccharomyces cerevisiae), molds (e.g., Aspergillus), plant cells and plants, etc.

[0133] The term "plant" is to be understood as meaning any differentiated multicellular organism capable of photosynthesis, including crop plants, in particular monocotyledonous or dicotyledonous plants, at any stage of maturity or development, vegetable crops, including artichokes, Brussels sprouts, rocket, leeks, asparagus, lettuce (e.g., head lettuce, leaf lettuce, romaine lettuce), bok choy, yellow taro, melons (e.g., cantaloupe, watermelon, Crenshaw melon, honeydew melon, cantaloupe), oilseed crops (e.g., Brussels sprouts, cabbage, cauliflower, broccoli, kale, kale, Chinese cabbage, bok choy), cardoon, carrot, napa, okra, onion, celery, parsley, chickpeas, parsnips, endive, peppers, potatoes, cucurbits (e.g., zucchini, cucumber, courgette, squash, pumpkin), radish, cabbage, Onions, rutabagas, eggplant (also known as eggplant), salsify, lettuce, shallots, endive, garlic, spinach, green onions, squash, greens, beets (sugar beets and fodder beets), sweet potatoes, Swiss chard, horseradish, tomatoes, turnips, and spices; fruits and / or vines such as apples, apricots, cherries, nectarines, peaches, pears, plums, prunes, cherries, quince, almonds, chestnuts, hazelnuts, pecans, pistachios, walnuts, citrus, blueberries, boysenberries, y), cranberries, currants, loganberries, raspberries, strawberries, blackberries, grapes, avocados, bananas, kiwis, persimmons, pomegranates, pineapples, tropical fruits, pome fruits, melons, mangoes, papayas, and lychees; field crops such as clover, alfalfa, evening primrose, meadowsweet, corn / maize (feed corn, sweet corn, popcorn), hops, jojoba, peanuts, rice, safflower, small grain cereals (barley, oats, rye, wheat, etc.), sorghum, tobacco, kapok, and legumes (beans, lentils, peas, soybeans) , oil plants (rapeseed, mustard, poppy, olive, sunflower, coconut, castor oil plant, cocoa bean, peanut), Arabidopsis, fiber plants (cotton, flax, hemp, jute), Lauraceae (cinnamon, camphor), or a plant such as coffee, sugar cane, tea, and natural rubber plant; and / or bedding plants, such as flowering plants, cacti, succulents and / or ornamental plants, as well as trees such as forests (broadleaf trees and evergreen trees, such as conifers), fruit trees, ornamental trees, and nut-bearing trees, as well as shrubs and other seedlings.

[0134] The term "plant tissue" or "plant part" includes plant cells, protoplasts, plant tissue cultures, plant callus, plant pieces, as well as plant embryos, pollen, ovules, seeds, leaves, stems, flowers, branches, seedlings, fruits, kernels, ears, roots, root tips, anthers, and the like.

[0135] The term "plant cell" is to be understood as any cell from or found in a plant, which is capable of forming, for example, undifferentiated tissue such as callus, differentiated tissue such as embryos, plant components, plants or seeds.

[0136] The term "gene editing" technology includes CRISPR technology, TALEN technology, and ZFN technology. CRISPR technology refers to clustered, regularly interspaced short palindromic repeats, which come from the immune system of microorganisms. Among them, gene editing tools include guideRNA, Cas proteins (such as Cas9, Cpf1, Cas12b, etc.). The gene editing tool referred to in TALEN technology is a restriction enzyme that can cut a specific DNA sequence, which includes a TAL effector DNA binding domain and a DNA cleavage domain. The gene editing tool referred to in ZFN technology is also a restriction enzyme that can cut a specific DNA sequence, which includes a zinc finger DNA binding domain and a DNA cleavage domain. It is well known to those skilled in the art that by constructing the nucleotides encoding the gene editing tool and other regulatory elements into a suitable vector and then transforming the cell, the editing of the genome in the cell can be achieved. The types of editing include gene knockout, insertion, and base editing.

[0137] As used herein, the term "gene editing enzyme" refers to nucleases suitable for editing tools such as CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats), TALEN (Transcription Activator-like (TAL) effector nuclease technology), and ZFN (Zinc finger nuclease technology). Preferably, the gene editing enzyme is a CRISPR enzyme, also known as a Cas protein, and its types include but are not limited to: Cas9 protein, Cas12 protein, Cas13 protein, Cas14 protein, Csm1 protein, and FDK1 protein. The Cas protein refers to a family of proteins, which may have different structures depending on their source, such as SpCas9 derived from Streptococcus pyogenes and SaCas9 derived from Staphylococcus aureus; it may also be classified according to structural features (such as domains), such as the Cas12 family including Cas12a (also known as Cpf1), Cas12b, Cas12c, Cas12i, etc. The Cas protein may have double-stranded or single-stranded or no cutting activity. The Cas protein of the present invention may be wild type or a mutant thereof, and the mutation type of the mutant may include amino acid replacement, substitution or deletion, and the mutant may or may not change the enzymatic activity of the Cas protein. Preferably, the Cas protein of the present invention has only single-stranded cutting activity or no cutting activity, which is a mutant of the wild-type Cas protein. Preferably, the Cas protein of the present invention is Cas9, Cas12, Cas13 or Cas14 with single-stranded cutting activity. In a preferred embodiment, the Cas9 protein of the present invention includes SpCas9n (D10A), nSpCas9NG, SaCas9n, ScCas9n, and XCas9n, wherein "n" represents nick, i.e., a Cas protein with only single-stranded cleavage activity. It is a conventional technical means in the art to mutate known Cas proteins to obtain Cas proteins with single-stranded or no cleavage activity. As known to those skilled in the art, a variety of Cas proteins with nucleic acid cleavage activity that have been reported in the prior art, the known protein or its modified variants can achieve the functions of the present invention, and are herein incorporated by reference into the scope of protection.

[0138] For example, those skilled in the art will appreciate that protein structure can be altered without adversely affecting its activity and functionality. For example, one or more conservative amino acid substitutions can be introduced into a protein's amino acid sequence without adversely affecting the activity and / or three-dimensional configuration of the protein molecule. Examples and implementations of conservative amino acid substitutions will be apparent to those skilled in the art. Specifically, an amino acid residue can be substituted with another amino acid residue belonging to the same group as the substituted residue, i.e., a non-polar amino acid residue can be substituted for another non-polar amino acid residue, a polar uncharged amino acid residue can be substituted for another polar uncharged amino acid residue, a basic amino acid residue can be substituted for another basic amino acid residue, and an acidic amino acid residue can be substituted for another acidic amino acid residue. Such substituted amino acid residues may or may not be encoded by the genetic code. Conservative substitutions, where one amino acid is replaced with another amino acid belonging to the same group, fall within the scope of the present invention, as long as the substitution does not impair the biological activity of the protein. Therefore, in addition to the aforementioned mutations, the mutant GBSS1 proteins of the present invention may also include one or more other mutations, such as conservative substitutions, in their amino acid sequences. Furthermore, the present invention also encompasses mutant ACC proteins that also include one or more other non-conservative substitutions, as long as such non-conservative substitutions do not significantly affect the desired function and biological activity of the protein of the present invention.

[0139] As is well known in the art, one or more amino acid residues can be deleted from the N and / or C terminus of a protein while still retaining its functional activity. Therefore, on the other hand, the present invention also relates to fragments (such as amino acid fragments containing the mutation sites of the present invention) that have deleted one or more amino acid residues from the N and / or C terminus of a mutant ACC protein while retaining its desired functional activity, which are also within the scope of the present invention and are referred to as biologically active fragments. In the present invention, a "biologically active fragment" refers to a portion of a mutant ACC protein of the present invention that retains the biological activity of the mutant ACC protein of the present invention. For example, a biologically active fragment of a mutant ACC protein can be a portion that has deleted one or more (e.g., 1-50, 1-25, 1-10 or 1-5, such as 1, 2, 3, 4 or 5) amino acid residues at the N and / or C terminus of the protein, but still retains the biological activity of the full-length protein.

[0140] In addition, the mutant proteins of the present invention can also be modified. Modifications (usually without altering the primary structure) include: chemical derivatization of the mutant protein in vivo or in vitro, such as acetylation or carboxylation. Modifications also include glycosylation, such as those produced by glycosylation during the synthesis and processing of the mutant protein or in further processing steps. Such modifications can be accomplished by exposing the mutant protein to a glycosylation enzyme (such as a mammalian glycosylase or deglycosylation enzyme). Modified forms also include sequences having phosphorylated amino acid residues (such as phosphotyrosine, phosphoserine, and phosphothreonine). Also included are mutant proteins that have been modified to improve their resistance to proteolysis or optimize their solubility.

[0141] The present invention also provides a polynucleotide encoding the mutant ACC polypeptide, which may also be a polynucleotide further comprising additional coding and / or non-coding sequences. Preferably, the mutant ACC polypeptide is shown in SEQ ID NO.: 2-4. It is well known to those skilled in the art that, due to the degeneracy of the genetic code, there are a variety of different nucleic acid sequences that can encode the amino acid sequences disclosed herein. It is within the capabilities of those of ordinary skill in the art to generate other nucleic acid sequences encoding the same protein, and therefore the present invention encompasses nucleic acid sequences that encode the same amino acid sequence due to the degeneracy of the genetic code. For example, in order to achieve high expression of a heterologous gene in a target host organism, such as a plant, the gene can be optimized using codons preferred by the host organism to enable better expression.

[0142] The full-length sequence of the polynucleotide of the present invention can usually be obtained by PCR amplification, recombinant method or artificial synthesis method. For PCR amplification, primers can be designed based on the relevant nucleotide sequence disclosed in the present invention, especially the open reading frame sequence, and a commercially available cDNA library or a cDNA library prepared by conventional methods known to those skilled in the art is used as a template to amplify and obtain the relevant sequence. When the sequence is long, it is often necessary to perform two or more PCR amplifications, and then the fragments amplified each time are spliced ​​together in the correct order. The obtained nucleotide sequence can be cloned into a vector, then transferred into cells, and then isolated from the host cells after the proliferation by conventional methods to obtain large quantities of relevant sequences. The mutation site of the present invention can also be introduced by artificial synthesis.

[0143] More than one copy of a polynucleotide of the present invention may be inserted into a host cell to increase production of the gene product. Increasing the number of copies of a polynucleotide can be achieved by integrating at least one additional copy of the sequence into the host cell genome or by including an amplifiable selectable marker gene with the polynucleotide. In the latter case, cells containing amplified copies of the selectable marker gene and, therefore, additional copies of the polynucleotide can be selected by artificially culturing the cells in the presence of an appropriate selectable agent.

[0144] Methods well known to those skilled in the art can be used to construct vectors containing a DNA sequence encoding an ACC mutant polypeptide and appropriate transcription / translation control signals. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombination techniques, and the like. The DNA sequence can be effectively linked to an appropriate promoter in the vector to direct mRNA synthesis. The vector also includes a ribosome binding site for translation initiation and a transcription terminator.

[0145] Vectors suitable for use in the present invention include commercially available plasmids such as, but not limited to, pBR322 (ATCC 37017), pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden), GEM1 (Promega Biotec, Madison, WI, USA), pQE70, pQE60, pQE-9 (Qiagen), pD10, psiX174, pBluescript IIKS, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene), ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia), pKK232-8, pCM7, pSV2CAT, pOG44, pXT1, pSG (Stratagene), pSVK3, pBPV, pMSG, and pSVL (Pharmacia).

[0146] The present invention also provides a host cell comprising a nucleic acid sequence encoding an ACC mutant polypeptide of the present invention, a nucleic acid construct, or an expression vector. The vector encoding the present invention is introduced into the host cell such that the vector exists as part of a chromosomal integrant or as a self-replicating extrachromosomal vector as described earlier, or the vector can perform gene editing on the endogenous ACC gene of the host cell. The host cell can be any host cell familiar to those skilled in the art, including prokaryotic and eukaryotic cells.

[0147] The nucleic acid sequence, nucleic acid construct or expression vector of the present invention can be introduced into the host cell by a variety of techniques, including transformation, transfection, transduction, viral infection, gene gun or Ti-plasmid-mediated gene delivery, as well as calcium phosphate transfection, DEAE-dextran-mediated transfection, lipofection or electroporation.

[0148] In the production methods of the present invention, the cells are cultured in a nutrient medium suitable for production of the polypeptide using methods well known in the art. If the polypeptide is secreted into the nutrient medium, the polypeptide can be recovered directly from the medium. If the polypeptide is not secreted into the medium, it can be recovered from cell lysates.

[0149] As used herein, the terms "guide RNA," "mature crRNA," and "guide sequence" are used interchangeably and have meanings generally understood by those skilled in the art. In general, a guide RNA can comprise, consist essentially of, or consist of a direct repeat sequence and a guide sequence (also referred to as a spacer in the context of an endogenous CRISPR system).

[0150] In some cases, the guide sequence is any polynucleotide sequence that has sufficient complementarity to the target sequence to hybridize with the target sequence and guide the specific binding of the CRISPR / Cas complex to the target sequence. In one embodiment, when optimally aligned, the degree of complementarity between the guide sequence and its corresponding target sequence is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%. Determining optimal alignment is within the capabilities of those of ordinary skill in the art. For example, there are publicly available and commercially available alignment algorithms and programs, such as, but not limited to, ClustalW, Smith-Waterman algorithm in matlab, Bowtie, Geneious, Biopython, and SeqMan.

[0151] Sequence Listing

[0152] Serial number type content SEQ ID NO.: 1 protein Amino acid sequence of wild-type ACC SEQ ID NO.: 2 protein Amino acid sequence of I1879V SEQ ID NO.: 3 protein Amino acid sequence of C2186R SEQ ID NO.: 4 protein Amino acid sequence of the I1879V and C2186R double mutations SEQ ID NO.: 5 DNA DNA sequence of I1879V SEQ ID NO.: 6 DNA DNA sequence of C2186R SEQ ID NO.: 7 DNA DNA sequence of the I1879V and C2186R double mutations

[0153] The main advantages of the present invention are:

[0154] 1. The present invention screened out a group of mutant ACC proteins.

[0155] 2. Plants containing the mutant ACC protein of the present invention have obvious herbicide resistance compared to wild-type plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0156] Figure 1 .Schematic diagram of the ABE-nCas9 base editor; OsU6 and ZmUb i are promoters; sgRNA is the guide RNA; bp-NLS is the nuclear localization signal; NOS is the terminator.

[0157] Figure 2 .The herbicide resistance exhibited by plants with mutations at amino acid position 1879 of ACC compared to the wild type.

[0158] Figure 3 .The herbicide resistance exhibited by plants with mutations at amino acid position 2186 of ACC compared to the wild type.

[0159] Figure 4 .I1879V edited the tolerance test of plants to sethoxydim.

[0160] Figure 5 .I1879V edited the tolerance test of plants to benzothiazone sprayed for 20 days.

[0161] Figure 6 .Tolerance test of I1879V and C2186R edited plants to quizalofop-p-ethyl and fenoxadone-ethyl.

[0162] Figure 7 .I1879V edited plant tolerance test to different herbicides. Implementation Method

[0163] The present invention will be further described below with reference to the following embodiments. The following description is merely a preferred embodiment of the present invention and does not limit the present invention in any other form. Any person skilled in the art may utilize the above disclosed technical content to make equivalent embodiments with equivalent variations. Any simple modification or equivalent variation of the following embodiments made in accordance with the technical essence of the present invention without departing from the content of the present invention shall fall within the scope of protection of the present invention.

[0164] Example 1. Construction of gene editing vector and screening of mutation sites

[0165] 1. Construction of an ABE-nCas9 base editor targeting the endogenous ACC gene in rice

[0166] The ABE base editor can achieve base conversion from A / T to G / C within a certain sequence window. The present invention uses the ABE-nCas9 base editor as a vector, designs sgRNAs in the endogenous ACCase gene of rice (sgRNAs shown in Table 1), and clones them into the ABE-nCas9 vector respectively to form a base editor targeting the endogenous ACCase gene of rice. The amino acids encoded by the endogenous ACCase gene of rice are shown in SEQ ID No. 1.

[0167] Table 1 sgRNA sequences targeting rice ACC (guide sequences)

[0168] sgRNA number guide-PAM sequence (5'-3') A-ACC1879 GAGAATATACATGGAAGTGC A-ACC2186 ATAGCACTCAATGCGGTCTG

[0169] 2. Rice genetic transformation and identification of transgenic plants

[0170] Using multiple rice varieties such as Wanzhijing 006, Nanjing 9108, and Jiahe 218 as experimental materials, the constructed base editors were transformed with Agrobacterium to obtain gene-edited plants. The resulting seedlings were screened using a culture medium containing the herbicide sethoxydim, with a concentration of SET-2 of 2 mg / L. Alternatively, the edited seedlings were planted in a cultivation room and sprayed with 0.5 g / L sethoxydim herbicide (corresponding to a field application rate of 10 g.ai / mu). After 10 days, the survival of the seedlings was counted.

[0171] By screening and culturing, herbicide-resistant plants were obtained by screening on a culture medium containing sethoxydim herbicide, such as Figure 2 As shown, the plants indicated by the arrows are more tolerant to herbicides than other plants and show resistance to herbicides. PCR and sequencing were used to identify the above herbicide-resistant plants, and it was found that the resistant plants had the expected base substitution within the target range, and the specific editing types were I1879V. In addition, herbicide-resistant plants were also screened in the cultivation room. Figure 3 As shown, compared with the control plants, the edited plants were able to tolerate herbicides and showed resistance to herbicides. The above herbicide-resistant plants were identified by PCR and sequencing, and it was found that the resistant plants had the expected base substitution within the target range, and the specific editing type was C2186R.

[0172] For the I1879V rice edited plants, the dosage of sethoxydim was continued to increase to 15g.ai / mu. After 14 days, the control plants were obviously yellowed and dead, while the edited plants could grow normally. Figure 4 When the dosage of sethoxydim was increased to 30 g.ai / mu, all the wild-type plants died after 20 days of cultivation. Meanwhile, the edited material still showed significant drug resistance, with drug damage of only about 30%.

[0173] Example 2: Resistance to other types of herbicides

[0174] The edited rice plants I1879V and C2186R obtained in Example 1 were planted separately to conduct resistance tests to other types of herbicides, such as phenylacetamide, quizalofop-p-ethyl, fenoxaprop-p-ethyl, clethodim (clethodim, Chinese trade name: Shouletong, Sailete), high-efficiency fluazifop-p-ethyl, pinoxaden, butyraclonil and the like.

[0175] 2.1 Phenylacetamide:

[0176] Rice seedlings were planted in the field and sprayed with 20g.ai / mu (4 times the recommended dosage) of phenylacetamide and the results were observed. For the I1879V edited plants, 7 days after spraying phenylacetamide, the wild type sprayed with herbicide group showed obvious chlorosis and drug spots, but the I1879V edited material had no visible drug damage. 20 days after the drug application, if Figure 5 As shown, the wild type group sprayed with herbicide had serious damage ( Figure 5 The arrows show obvious phytotoxicity), and its growth was also severely affected. The biomass of the I1879V edited material was not much different from that of the unsprayed control group. That is, even after 20 days, the I1879V edited material still showed excellent resistance to phenyltetrazol, with no obvious phytotoxicity and unaffected growth. However, compared with the wild-type control, the C2186R edited plants showed a certain degree of resistance. Compared with the I1879V edited plants, the C2186R edited plants showed obvious phytotoxicity at a dosage of 20g.ai / mu phenyltetrazol. The edited materials had chlorotic spots at the base of their leaves, which was not safe enough and could not be used in practice.

[0177] 2.2 Quizalofop-Phthiop-ethyl and Fenoxadone-Phthiop-ethyl:

[0178] For I1879V-edited plants and C2186R-edited plants, 5 g ai / mu of quizalofop-ethyl or 5 g ai / mu of oxazolidinone were applied, and the results were observed after 14 days; Figure 6 As shown, 14 days later, there was no significant difference between the treated edited plants and the treated wild-type controls, and the edited plants were unable to develop tolerance to quizalofop-PhD or oxazolidin-PhD.

[0179] 2.3 Clethodim, Halpyralid, Pinoxaden, and Butyclothioprine:

[0180] The tolerance of I1879V edited plants to clethodim, high-efficiency fluazifop-butyl, pinoxaden, and butyleclothiodide herbicides was tested. For clethodim, high-efficiency fluazifop-butyl, and pinoxaden, concentrations of 5g ai / mu (1X) and 10g ai / mu (2X) were applied respectively; for butyleclothiodide, concentrations of 10g ai / mu (1X) and 20g ai / mu (2X) were applied. After 20 days of drug application, the growth of the edited plants was observed and the drug resistance of the edited plants was statistically analyzed. Figure 7 As shown, the I1879V edited plants have shown certain phytotoxicity at the above-mentioned 1X herbicide concentration, with a mortality rate of 30%-50%; at the above-mentioned 2X herbicide concentration, the edited plants are already in a basically non-resistant state, with a mortality rate of 70%-90%.

[0181] All documents mentioned in this application are incorporated herein by reference, just as if each document were incorporated herein by reference individually. It should also be understood that after reading the above teachings of the present invention, those skilled in the art may make various changes or modifications to the present invention, and that such equivalents also fall within the scope of the claims appended hereto.

Claims

1. A method for conferring herbicide resistance to plants or a method for producing herbicide-resistant plants, the method comprising the step of introducing a mutant acetyl-CoA carboxylase (ACC) into plant seeds or plant tissues; characterized in that, compared with the amino acid sequence of the parental acetyl-CoA carboxylase (ACC), the mutant ACC has a mutation only at the 1879th amino acid corresponding to the amino acid sequence shown in SEQ ID NO.: 1, and the 1879th amino acid is mutated to valine (V); the herbicide is bentazone; the amino acid sequence of the parental ACC is as shown in SEQ ID NO.: 1; the plant is rice.

2. The method according to claim 1, wherein The method comprises the step of expressing the mutant ACC in plant seeds or plant tissues.

3. The method according to claim 1, wherein The method comprises the step of mutating the endogenous ACC of the plant to introduce the mutant ACC.

4. The method according to claim 3, wherein The method comprises introducing the mutant ACC by means of gene editing.

5. The method according to claim 4, wherein The gene editing tool is selected from one or any combination of CRISPR, TALEN and ZFN.

6. A method for controlling weeds in farmland, characterized in that: a) providing a herbicide-resistant plant prepared by any one of the methods of claims 1-5, b) applying an effective amount of a herbicide to the plant and the weeds in its vicinity, thereby controlling the weeds in the vicinity of the plant, the herbicide being bentazone; the plant being rice.

Images