An inhibitor targeting the TMEM215 gene and its application
By targeting the TMEM215 gene inhibitor, especially siRNA molecules, the growth of tumor vascular endothelial cells is inhibited, solving the problem of damage to normal blood vessels caused by existing anti-angiogenic drugs, achieving precise treatment of tumors and reducing side effects.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-11-22
- Publication Date
- 2026-04-03
AI Technical Summary
Existing anti-angiogenic drugs may damage normal blood vessels in the process of inhibiting tumor angiogenesis, causing adverse reactions, and there is a lack of precise treatment options for different tumor types and individual differences.
Develop inhibitors targeting the TMEM215 gene, particularly siRNA molecules, to reduce vascular endothelial cell survival and thus inhibit tumor angiogenesis by inhibiting the TMEM215 gene. Use tumor endothelial cell-targeting material cRGD-PEI-PEG to deliver inhibitors to reduce the impact of drugs on normal organs.
It effectively inhibits tumor angiogenesis, reduces tumor growth, lowers tumor quality, reduces the area of tumor tissue necrosis, decreases the density of CD31-labeled blood vessels, increases the number of apoptotic endothelial cells co-labeled by CD31 and cl.Caspase3, and reduces drug side effects.
Smart Images

Figure CN115786344B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular biomedical technology, specifically relating to an inhibitor targeting the gene TMEM215 and its application. Background Technology
[0002] Cancer is one of the most significant threats to human health. Treatment primarily involves surgical resection, traditional radiotherapy and chemotherapy, immunotherapy, targeted therapy for tumor cells, and targeted therapy for tumor angiogenesis. Tumor growth can be divided into two phases: the avascular phase and the vascular phase. Tumors in the avascular phase are typically smaller than 2 mm in size. 3 Tumors primarily absorb nutrients and oxygen through diffusion, resulting in slow tumor growth. However, as the tumor increases in size, relying solely on diffusion to absorb nutrients and oxygen becomes insufficient to sustain its growth. At this point, tumor cells secrete certain chemicals that activate vascular endothelial growth factor, promoting tumor angiogenesis. Once tumor angiogenesis occurs, a large supply of nutrients and oxygen is available, and the tumor enters a rapid proliferative phase. Therefore, tumor angiogenesis has become one of the important targets for tumor treatment.
[0003] Since the approval of bevacizumab, the first angiogenesis-targeting drug, significant progress has been made in the research of both macromolecular and small-molecule anti-angiogenic drugs, which are widely used clinically to treat malignant solid tumors such as medullary thyroid carcinoma, renal cell carcinoma, and liver cancer. Among them, small-molecule multi-target tyrosine kinase inhibitors exert their anti-tumor effects by inhibiting tumor angiogenesis and improving the tumor microenvironment, demonstrating significant efficacy and ease of clinical use, leading to their widespread application. However, anti-angiogenic drugs not only inhibit tumor angiogenesis but may also damage normal blood vessels, causing adverse reactions such as hypertension, proteinuria, and hand-foot syndrome. With the advancement of precision medicine, further research is needed to develop specific drugs and medication regimens targeting tumor angiogenesis, based on different tumor types and individual differences, to improve anti-tumor efficacy while reducing drug toxicity and side effects, and to standardize the clinical application of anti-angiogenic drugs. Therefore, in-depth research into the regulatory mechanisms of angiogenesis and the development of new anti-tumor angiogenesis therapies remains of significant practical importance. Summary of the Invention
[0004] In order to overcome the shortcomings of the prior art, the present invention aims to provide a TMEM215-targeting gene inhibitor and its application, which can reduce the toxic side effects of drugs while achieving anti-tumor efficacy.
[0005] To achieve the above objectives, the present invention employs the following technical solution:
[0006] This invention discloses an inhibitor targeting the gene TMEM215, wherein the TMEM215 inhibitor is a siRNA molecule that inhibits TMEM215, and the sequence is shown in SEQ.ID.NO.5.
[0007] This invention also discloses the application of a TMEM215-targeting gene inhibitor in the preparation of anti-tumor angiogenesis drugs.
[0008] Preferably, the sequence of the TMEM215 target gene inhibitor is shown in SEQ.ID.NO.5.
[0009] Preferably, the TMEM215-targeting gene inhibitor achieves anti-tumor angiogenesis by inhibiting vascular endothelial cells.
[0010] Preferably, the dosage form of the drug is an injectable dosage form.
[0011] The present invention also discloses a pharmaceutical composition for anti-tumor angiogenesis, comprising an inhibitor of the TMEM215 gene.
[0012] Preferably, the pharmaceutical composition further includes other oncology drugs.
[0013] Preferably, the drug comprises one or more pharmaceutically acceptable carriers.
[0014] More preferably, the carrier includes a diluent, an adhesive, an adsorbent carrier, a filler, and a disintegrant.
[0015] Preferably, the drug further includes additives, including stabilizers, bactericides, buffers, isotonic agents, chelating agents, pH control agents, and surfactants.
[0016] Compared with the prior art, the present invention has the following beneficial effects:
[0017] This invention provides a TMEM215 inhibitor targeting the gene. By investigating the role of TMEM215 in maintaining vascular endothelial cell survival, it was found that TMEM215 is crucial for vascular endothelial cell survival. Knockdown of TMEM215 significantly reduced the number of surviving endothelial cells, significantly increased the number of Annexin V-positive apoptotic cells, and significantly increased the protein levels of cl.Caspase3 and cl.Caspase9 in the endogenous apoptosis signaling pathway, indicating that TMEM215 can serve as an important target for anti-angiogenic therapy. Further investigation into the effects of TMEM215 knockout on tumor growth and tumor angiogenesis in mice revealed that TMEM215 knockout significantly inhibited tumor growth, significantly reduced tumor mass, significantly increased the area of tumor necrosis, and significantly increased the number of apoptotic endothelial cells co-labeled by CD31 and cl.Caspase3. This indicates that TMEM215 knockout inhibits tumor angiogenesis and tumor development, while the physiological blood vessels of other normal organs remain unaffected. By investigating the effects of siRNA targeting tumor endothelial cells to inhibit TMEM215 on tumor growth and angiogenesis in mice, we found that using the tumor endothelial cell targeting material cRGD-PEI-PEG to deliver the TMEM215 inhibitor significantly reduced tumor mass, significantly increased the necrotic area of tumor tissue, significantly decreased the density of CD31-labeled blood vessels in tumor tissue, and significantly increased the number of apoptotic endothelial cells co-labeled by CD31 and cl. caspase3. These experiments suggest that targeting the TMEM215 gene can provide a reference for anti-tumor angiogenesis therapy. Inhibiting TMEM215 can effectively inhibit tumor angiogenesis and tumor development, indicating that targeting TMEM215 as an anti-tumor angiogenesis drug could improve the current situation of numerous adverse side effects of existing drugs and has good medical translational prospects. Attached Figure Description
[0018] Figure 1 This is a diagram showing the survival of lentiviruses expressing TMEM215-shRNA in human umbilical vein endothelial cells after infection according to the present invention.
[0019] Figure 2 This is a flow cytometry diagram of endothelial cell apoptosis detected by the present invention; wherein, A is a flow cytometry result of apoptotic cells, and B is a statistical diagram of the number of apoptotic cells;
[0020] Figure 3 This is a graph showing the changes in marker proteins of the apoptosis signaling pathway detected by Western blotting in this invention.
[0021] Figure 4This is a diagram of a subcutaneous tumor-bearing model established by subcutaneously inoculating a lung cancer cell line into a gene-modified mouse with induced knockout of endothelial cell TMEM215.
[0022] Figure 5 This is a tumor growth curve diagram of the gene-modified mouse according to the present invention;
[0023] Figure 6 The image shows the results of tumor sampling in genetically modified mice according to the present invention; wherein, A is a physical morphological image of the tumor sample from genetically modified mice, and B is a statistical chart of the quality of the tumor sample from genetically modified mice.
[0024] Figure 7 The images show the HE staining results of mouse tumor tissue sections according to the present invention; wherein, A is the HE staining image of tumor tissue sections from control mice, B is the HE staining image of tumor tissue sections from endothelial-specific knockout TMEM215 mice, and C is a statistical diagram of the necrotic area of mouse tumor tissue.
[0025] Figure 8 The image shows the immunofluorescence staining results of CD31, a vascular marker, in gene-modified mouse tumor tissue sections according to the present invention. In the image, blue represents hoechst, red represents the vascular marker CD31, A is the immunofluorescence staining image of CD31, a vascular marker, in tumor tissue sections of control mice, B is the immunofluorescence staining image of CD31, a vascular marker, in tumor tissue sections of endothelial-specific knockout TMEM215 mice, and C is a statistical graph of the immunofluorescence staining results of mouse tumor tissues.
[0026] Figure 9 The images show the immunofluorescence staining results of CD31 (a vascular marker) and cl.Casp3 (a apoptosis marker) in tumor tissue sections of genetically modified mice according to the present invention. In the images, blue represents Hoechst, red represents CD31 (a vascular marker), and green represents cl.Casp3 (a apoptosis marker). A shows the immunofluorescence staining results of CD31 and cl.Casp3 in tumor tissue sections of control mice; B shows the immunofluorescence staining results of CD31 and cl.Casp3 in tumor tissue sections of endothelial-specific knockout TMEM215 mice; and C is a statistical graph of the immunofluorescence staining results of CD31 and cl.Casp3 in mouse tumor tissue sections.
[0027] Figure 10 This is a schematic diagram of the treatment scheme for delivering siRNA that inhibits TMEM215 using the tumor endothelial cell targeting material of the present invention;
[0028] Figure 11 The images show the results of tumor sampling in mice for targeted therapy according to the present invention; wherein, A is a physical morphological image of the tumor sample taken from the targeted therapy mouse, and B is a statistical chart of the quality of the tumor sample taken from the targeted therapy mouse.
[0029] Figure 12 This is a qRT-PCR detection diagram of the mRNA level of TMEM215 mouse tumor endothelial cells targeted by the present invention;
[0030] Figure 13 The images show HE staining images and necrosis area statistics of targeted therapy mouse tumor tissue sections according to the present invention; wherein, A is HE staining image of targeted therapy mouse tumor tissue sections loaded with control siRNA, B is HE staining image of targeted therapy mouse tumor tissue sections loaded with siRNA that inhibits TMEM215, and C is necrosis area statistics of targeted therapy mouse tumor tissue.
[0031] Figure 14 The image shows the immunofluorescence staining results of CD31, a vascular marker in mouse tumor tissue sections targeted by the present invention. Blue represents Hoechst, and red represents the vascular marker CD31. Image A shows the immunofluorescence staining of CD31, a vascular marker in mouse tumor tissue sections targeted by the present invention, loaded with control siRNA. Image B shows the immunofluorescence staining of CD31, a vascular marker in mouse tumor tissue sections targeted by the present invention, loaded with siRNA that inhibits TMEM215. Image C shows a statistical graph of the immunofluorescence staining results of CD31, a vascular marker in mouse tumor tissue sections targeted by the present invention.
[0032] Figure 15 The images show the immunofluorescence staining results of CD31 (a vascular marker) and cl.Casp3 (an apoptosis marker) in targeted therapeutic mouse tumor tissue sections of this invention. Blue represents Hoechst, red represents CD31, and green represents cl.Casp3. Image A shows the immunofluorescence staining results of CD31 and cl.Casp3 in targeted therapeutic mouse tumor tissue sections loaded with control siRNA. Image B shows the immunofluorescence staining results of CD31 and cl.Casp3 in targeted therapeutic mouse tumor tissue sections loaded with siRNA that inhibits TMEM215. Image C is a statistical graph showing the immunofluorescence staining results of CD31 and cl.Casp3 in targeted therapeutic mouse tumor tissue sections. Detailed Implementation
[0033] To enable those skilled in the art to better understand the present invention, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings of the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of the present invention.
[0034] It should be noted that the terms "first," "second," etc., in the specification, claims, and accompanying drawings of this invention are used to distinguish similar objects and are not necessarily used to describe a specific order or sequence. It should be understood that such data can be interchanged where appropriate so that the embodiments of the invention described herein can be implemented in orders other than those illustrated or described herein. Furthermore, the terms "comprising" and "having," and any variations thereof, are intended to cover a non-exclusive inclusion; for example, a process, method, system, product, or apparatus that comprises a series of steps or units is not necessarily limited to those steps or units explicitly listed, but may include other steps or units not explicitly listed or inherent to such processes, methods, products, or apparatus.
[0035] The present invention will now be described in further detail with reference to the accompanying drawings:
[0036] Example 1: The survival maintenance function of TMEM215 in vascular endothelial cells
[0037] This invention discloses the role of TMEM215 in maintaining the survival of vascular endothelial cells. Human umbilical vein endothelial cells were infected with a lentivirus expressing TMEM215-shRNA to knock down the expression level of TMEM215. The survival of the endothelial cells was then assessed using methods including trypan blue staining, flow cytometry, and detection of apoptosis signaling pathway proteins Caspase3 and Caspase9. The specific steps are as follows:
[0038] Step 1: Establish an in vitro cell model of human umbilical vein endothelial cells with TMEM215 knockdown.
[0039] With informed consent from the mothers, primary human umbilical vein endothelial cells were isolated from the umbilical cord. After 6-8 hours of passage, the cells fully adhered to the culture medium. The in vitro culture conditions were 5% CO2, 37°C, and endothelial cell-specific medium containing 5% serum. Endothelial cells were infected with lentivirus expressing TMEM215-shRNA or a control lentivirus at an MOI of 10. The medium was changed after 24 hours, and experimental observations were performed after 48 hours. Cell viability was assessed using trypan blue staining. Figure 1 As shown, knocking down TMEM215 in endothelial cells significantly reduced the number of surviving endothelial cells.
[0040] Step 2: Flow cytometry was used to detect endothelial cell apoptosis.
[0041] Flow cytometry samples were collected and stained according to the Annexin V-FITC / PI Kit apoptosis detection kit (Sizhengbai Biotechnology, China). Forty-eight hours after lentivirus infection in step 1, cell culture medium was collected into a centrifuge tube. Cells were digested with EDTA-free trypsin until they could be gently pipetted off. Complete cell culture medium was added, and all adherent cells were pipetted off and collected again into a centrifuge tube. The cells were centrifuged at 1200 rpm for 5 min, and the supernatant was carefully aspirated to collect the cell pellet. The cells were resuspended in 1 mL of pre-chilled PBS, centrifuged at 1200 rpm for 5 min, and the supernatant was carefully aspirated to collect the cell pellet again. The binding buffer was diluted 1:3 with deionized water, and the cells were resuspended in 1× binding buffer to adjust the concentration to 1–5 × 10⁻⁶. 6 / mL, take 100μL of cell suspension into a 5mL flow cytometry tube, add 5μL of Annexin V-FITC, mix well, and incubate at room temperature in the dark for 5min. Add 10μL of 20μg / mL propidium iodide solution (PI) and 400μL of PBS, and immediately perform flow cytometry detection. The detection results are as follows. Figure 2 As shown, the number of Annexin V-positive apoptotic cells was significantly increased in the TMEM215 knockdown group.
[0042] Step 3, Protein extraction and Western blot
[0043] Forty-eight hours after lentivirus infection in step 1, the original cell culture medium was aspirated, and the cells were washed once with pre-cooled PBS. RIPA cell lysis buffer containing 1% PMSF was added, and the cells were incubated on ice for 20 min. Cells were scraped off, and the lysis solution was transferred to a new centrifuge tube. The cells were centrifuged at 12,000 rpm for 15 min at 4°C, and the precipitate was discarded. The supernatant obtained was the extracted protein solution. A 12% separating gel / 5% stacking gel was prepared using an SDS-PAGE gel mixing kit (Beyotime, China), and sample electrophoresis was performed at 120V for 60 min. The separated proteins were transferred to a PVDF membrane and transferred at a constant current of 180 mA for 2 hours on ice. Then, the PVDF membrane was blocked with TBST solution containing 5% skim milk powder for 2 hours at room temperature. Next, the membrane was incubated with primary antibody overnight at 4°C, washed three times with TBST solution on a shaker for at least 5 min each time, and then incubated with secondary antibody for 1 hour at room temperature, followed by three washes. Chemiluminescence was performed using a chemiluminescence kit, and the grayscale values of the bands were analyzed using IMAGEJ software. The Western blot results are shown below. Figure 3 As shown, the protein levels of cl.Caspase3 and cl.Caspase9 in the endogenous apoptosis signaling pathway were significantly increased in the TMEM215 knockdown group.
[0044] Example 2: Effects of TMEM215 knockout in endothelial cells on tumor growth and tumor angiogenesis in mice
[0045] A subcutaneous tumor-bearing model was established by subcutaneously inoculating Lewis lung cancer cell line into genetically modified mice with TMEM215-induced knockout of endothelial cells. Tumor volume and mass were measured, and tumor growth curves were plotted to analyze the effect of TMEM215-induced knockout on tumor growth. The structural and functional changes of tumor vessels after TMEM215-induced knockout were analyzed using methods such as HE staining of tissue samples and immunofluorescence staining for vascular markers and apoptosis markers. The specific steps are as follows:
[0046] Step 1: Breeding and Genotyping of Genetically Modified Mice
[0047] TMEM215 Floxed Mice (Biocytogen Gene Biotechnology, China) and Cdh5(PAC) Cre ERT2 Mice (given to RH Adams) were mated to obtain TMEM215 with endothelial-specific knockout of TMEM215. iEC-KO Mouse (Cdh5-CREE) RT2 -TMEM215 Floxed / Floxed ), and control mice (Cdh5-CRE) ERT2 -TMEM215 + / + One week after birth, mice were tail-cropped for genotyping. 500 μL of digestion buffer containing 5 μL of proteinase K (working concentration 20 mg / mL) was added to the tail, and digestion was carried out overnight at 55°C. Then, 300 μL of a mixture of Tris-saturated phenol solution and chloroform-isoamyl alcohol (24:1 volume ratio) was added, and the mixture was incubated at room temperature for at least 30 min. After centrifugation at 12000 rpm for 10 min, the clear supernatant was transferred to a new centrifuge tube. 800 μL of pre-chilled anhydrous ethanol was added, and the tube was centrifuged at 12000 rpm for 10 min. The supernatant was discarded, and 800 μL of 75% ethanol was added. The tube was centrifuged at 12000 rpm for 10 min, and the supernatant was discarded. The tube was air-dried, and the extracted genomic DNA was dissolved in an appropriate amount of double-distilled water. Genotyping of mice was performed using PCR. The PCR reaction system consisted of 10 μL 2×Taq Master Mix, 2 μL DNA, 7 μL double-distilled water, and 0.5 μL each of forward and reverse primers.
[0048] The PCR primers for the Cre genotype were Cre-Forward and Cre-Reverse. The PCR reaction conditions were: 95℃ for 5 min, denaturation; 95℃ for 30 s; 62℃ for 30 s, 72℃ for 1 min, for 37 cycles.
[0049] The PCR primers for the TMEM215 genotype were TMEM215-Forward and TMEM215-Reverse. The PCR reaction conditions were: 95℃ for 5 min, denaturation; 95℃ for 30 s; 63℃ for 30 s, 72℃ for 1 min, for 35 cycles. The primer sequences are shown in Table 1.
[0050] Table 1 Primer sequences
[0051]
[0052] Step 2, Induction protocol for TMEM215 knockout endothelial cells in adult mice
[0053] like Figure 4 Endothelial-specific knockout of TMEM215 iEC-KO Mouse (Cdh5-CREE) RT2 -TMEM215 Floxed / Floxed ) and control mice (Cdh5-CRE) ERT2 -TMEM215 + / + At 6–8 weeks, administer 100 μL of 20 mg / mL tamoxifen intraperitoneally per day for 5 consecutive days. On the first day after induction, perform subsequent experimental procedures.
[0054] Step 3: Establishment of a mouse subcutaneous tumor-bearing model
[0055] On day 1 after induction, TMEM215 was knocked out in endothelium-specific cells. iEC-KO Mouse (Cdh5-CREE) RT2 -TMEM215 Floxed / Floxed ) and control mice (Cdh5-CRE) ERT2 -TMEM215 + / + Lewis lung cancer cell line was subcutaneously injected into the right posterior back of each mouse, with each mouse receiving 5 × 10⁻⁶ cells. 6 A suspension of 100 μL of tumor cells was used. Starting from day 7 post-inoculation, the tumor volume on the back of the mouse was measured every 3 days using calipers. The long and short diameters of the tumor were recorded. The formula for calculating the tumor volume was: Volume = Long diameter × Short diameter 2 ×3.14 / 6. Measurement results are as follows: Figure 5 As shown, TMEM215 knockout in endothelial cells significantly inhibited tumor progression in mice.
[0056] Step 4, tumor sampling
[0057] On day 22 post-tumor inoculation, samples were collected for analysis. Mice were anesthetized with 1% sodium pentobarbital via intraperitoneal injection, and the left ventricle was perfused with PBS solution. The subcutaneous connective tissue surrounding the tumor was separated, and the tumor was removed and weighed. Figure 6 As shown, the tumor mass of mice in the endothelial cell TMEM215 knockout group was significantly reduced, and the tumor tissue was evenly distributed for subsequent experimental operations.
[0058] Step 5: Prepare paraffin sections and perform HE staining.
[0059] After tumor sampling, the tissue was fixed in 4% PFA and sent to Wuhan Saiwei Biotechnology Co., Ltd. for paraffin embedding, sectioning, and HE staining. Results are as follows... Figure 7 As shown, the area of tumor tissue necrosis was significantly increased in mice with TMEM215 endothelial cell knockout.
[0060] Step 6: Prepare frozen sections and perform immunofluorescence staining.
[0061] After tumor tissue was harvested, it was fixed in 4% PFA for 4 hours, then dehydrated in 30% sucrose solution overnight. The tissue was then embedded in OCT embedding reagent and frozen at -20°C. 10 μm thick tissue sections were prepared using a cryostat for immunofluorescence staining. The staining procedure was as follows: Blocking with blocking buffer containing 5% BSA at room temperature for 60 min, discarding the blocking buffer, adding primary antibody dilution buffer, incubating overnight at 4°C, washing three times with PBS for 5 min each time, adding secondary antibody dilution buffer, incubating at 37°C for 60 min, washing three times with PBS for 5 min each time, staining cell nuclei with Hoechst at room temperature for 15 min, washing three times with PBS for 5 min each time, mounting with 50% glycerol, and observing under a laser confocal microscope. Results are as follows: Figure 8 and Figure 9 As shown, the density of CD31-labeled blood vessels in tumor tissues of mice in the TMEM215 knockout group of endothelial cells was significantly reduced, and the number of apoptotic endothelial cells co-labeled by CD31 and cl.Caspase3 was significantly increased.
[0062] Example 3: Effects of siRNA targeting tumor endothelial cells to deliver TMEM215 on tumor growth and tumor angiogenesis in mice.
[0063] Using the tumor endothelial cell targeting material cRGD-PEI-PEG, siRNA inhibiting TMEM215 was delivered to mice inoculated with Lewis lung cancer cell lines. The inhibitory efficiency of TMEM215 after targeted delivery was detected, tumor mass in mice was measured, and the effect of endothelial cell TMEM215 inhibition on tumor growth in mice was analyzed. The structural and functional changes of tumor blood vessels after endothelial cell TMEM215 inhibition were analyzed using methods such as HE staining of tissue samples and immunofluorescence staining for vascular markers and apoptosis markers. The specific steps are as follows:
[0064] Step 1, delivery of targeted therapy drugs
[0065] like Figure 10As shown, Lewis lung cancer cell line was subcutaneously injected into the right posterior back of 6-8 week old C57BL / 6 mice, with each mouse receiving 5 × 10⁻⁶ cells. 6 100 μL of tumor cell suspension was used. From day 7 to day 19 post-inoculation, cRGD-PEI-PEG (4 mg / kg) loaded with either TMEM215-inhibiting siRNA or control siRNA was injected via tail vein every two days. The siRNAs were synthesized by Shanghai Aibosi Biotechnology, and their sequences are shown in Table 2. Analysis was performed on day 21 post-inoculation. The mass ratio of siRNA to the targeting material cRGD-PEI-PEG was 1:1. Both were thoroughly dissolved in PBS before injection and incubated at room temperature for 10 min. The siRNA and cRGD-PEI-PEG were purchased from Xi'an Ruixi Biotechnology.
[0066] Table 2. Sequences of siRNA inhibiting TMEM215 and control siRNA.
[0067] Name Sequence(5' to 3') Number siRNA that inhibits TMEM215 GACAGAUACUGUUGCUACAUC SEQ.ID.NO.5 control siRNA UUCUCCGAACGUGUCACGUTT SEQ.ID.NO.6
[0068] Step 2, tumor sampling
[0069] In step 1, mice were harvested on day 21 post-inoculation. Mice were anesthetized with an intraperitoneal injection of 1% sodium pentobarbital, and the left ventricle was perfused with PBS solution. The subcutaneous connective tissue surrounding the tumor was separated, and the tumor was removed and weighed. Figure 11 As shown, the tumor mass of mice delivered with TMEM215 siRNA was significantly reduced compared to mice delivered with control siRNA. The tumor tissue was then evenly distributed for subsequent experimental procedures.
[0070] Step 3, isolate tumor endothelial cells
[0071] The tumor tissue from step 2 was minced and digested in a digestion solution (containing 1 mg / mL type I collagenase, 100 μg / mL DNase I, prepared with Hank's solution) at 37°C for 30 min. Next, the tissue blocks were filtered through a 70 μm sieve to obtain a single-cell suspension. The suspension was centrifuged, the supernatant was discarded, and erythrocyte lysis buffer was added to lyse the cells. PBS was added to terminate the lysis. After centrifugation and discarding the supernatant, the cells were washed with magnetic bead buffer, and then... 7 Cells were added to 90 μL of magnetic bead buffer, followed by 10 μL of CD31 magnetic bead antibody. After mixing, the mixture was incubated at 4°C in the dark for 30 min. After incubation and washing the cells, 2 mL of magnetic bead buffer was added to resuspend the cells. Simultaneously, the washed MS column was placed on a magnetic rack, and cell suspension was added. After all the unbound cell suspension had flowed out, the MS column was washed with 3 mL of magnetic bead buffer. After all the magnetic bead buffer had flowed out, the MS column was removed, 2 mL of magnetic bead buffer was added, and the liquid was pushed into a new centrifuge tube using the stopcock. The supernatant was discarded after centrifugation, and the precipitate was the tumor endothelial cells.
[0072] Step 4: qRT-PCR was used to verify the inhibitory efficiency of TMEM215 on tumor endothelial cells.
[0073] In step 3, the tumor endothelial cells isolated were added to Invitrogen's TRIzol reagent for RNA extraction according to the manufacturer's instructions. Subsequently, reverse transcription was performed using a Takara reverse transcription kit according to the manufacturer's instructions. After obtaining cDNA, the SYBR Green real-time quantitative PCR procedure was performed according to Takara's instructions. The results were quantified using the ΔΔCT method, with β-actin as an internal reference gene. The results are shown below. Figure 12 As shown, mice delivered with TMEM215 siRNA had significantly lower TMEM215 levels in tumor endothelial cells compared to mice delivered with control siRNA.
[0074] Step 5: Prepare paraffin sections and perform HE staining.
[0075] In step 2, a portion of the tumor tissue was fixed in 4% PFA and sent to Wuhan Saiwei Biotechnology Co., Ltd. for paraffin embedding, sectioning, and HE staining. Figure 13 As shown, mice delivered with TMEM215 siRNA had a significantly larger area of tumor necrosis compared to mice delivered with control siRNA.
[0076] Step 6: Prepare frozen sections and perform immunofluorescence staining.
[0077] After fixing part of the tumor tissue in step 2, frozen sections were prepared and immunofluorescence staining was performed according to the steps described in Example 2. The results are as follows: Figure 14 and Figure 15 As shown, mice delivered with TMEM215 siRNA had significantly lower CD31-labeled blood vessel density in tumor tissues compared to mice delivered with control siRNA, and significantly higher numbers of apoptotic endothelial cells co-labeled by CD31 and cl.Caspase3.
[0078] All data are expressed as mean ± standard deviation. Statistical analysis was performed using SPSS 22.0 software. Normality analysis and homogeneity of variance tests were conducted first. Independent samples t-tests were used for comparisons between two samples; one-way ANOVA was used for pairwise comparisons among multiple groups, and LSD post hoc tests were used for pairwise comparisons between groups. A p-value < 0.05 was considered statistically significant.
[0079] The above content is only for illustrating the technical concept of the present invention and should not be construed as limiting the scope of protection of the present invention. Any modifications made to the technical solution based on the technical concept proposed in this invention shall fall within the scope of protection of the claims of this invention.
Claims
1. An inhibitor targeting the TMEM215 gene, characterized in that, The TMEM215 inhibitor is a siRNA molecule that inhibits TMEM215, the sequence of which is shown in SEQ.ID.NO.
5.
2. The application of a TMEM215-targeting gene inhibitor in the preparation of anti-tumor angiogenesis drugs, characterized in that, The sequence of the TMEM215 inhibitor is shown in SEQ.ID.NO.
5.
3. The application according to claim 2, characterized in that, Inhibitors targeting the TMEM215 gene achieve anti-tumor angiogenesis by inhibiting vascular endothelial cells.
4. The application according to claim 2, characterized in that, The drug is in the form of an injectable formulation.
5. The application according to claim 2, characterized in that, via cRGD PEI PEG delivers siRNA that inhibits TMEM215.
6. A pharmaceutical composition for inhibiting tumor angiogenesis, characterized in that, It includes an inhibitor targeting the TMEM215 gene and one or more pharmaceutically acceptable vectors; the sequence of the TMEM215 inhibitor is shown in SEQ.ID.NO.
5.
7. The pharmaceutical composition for inhibiting tumor angiogenesis according to claim 6, characterized in that, The pharmaceutical composition also includes other oncology drugs.
8. The anti-tumor angiogenesis pharmaceutical composition according to claim 6, characterized in that, The carrier includes a diluent, a binder, an adsorbent carrier, a filler, and a disintegrant.
9. The pharmaceutical composition for inhibiting tumor angiogenesis according to claim 6, characterized in that, The carrier is cRGD PEI PEG.
10. The anti-tumor angiogenesis pharmaceutical composition according to claim 6, characterized in that, The drug also includes additives, including stabilizers, bactericides, buffers, isotonic agents, chelating agents, pH control agents, and surfactants.