Molecular markers related to the easy separation of mature fruit and pedicel in chili peppers, their applications and detection methods

By developing specific primers RE-40 and RE-67 and combining them with BSA-seq technology, the gene for easy separation of mature fruit and pedicel in chili peppers was accurately located and identified. This solved the problem of accurately locating the trait of easy separation of fruit and pedicel in chili pepper breeding in existing technologies, and improved breeding efficiency and economic benefits.

CN115786574BActive Publication Date: 2026-03-06INSTITUTE OF VEGETABLES & FLOWERS CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202211461398.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-11-17
Publication Date
2026-03-06
Estimated Expiration
2042-11-17

AI Technical Summary

Technical Problem

The lack of effective molecular markers in existing technologies for the accurate location and identification of the easily separable trait of mature pepper fruits and pedicels affects the efficiency and economic benefits of pepper breeding and mechanized harvesting.

Method used

Specific primers RE-40 and RE-67 were developed for PCR amplification. Combined with BSA-seq primary and fine mapping, the location of the gene controlling the easy separability of mature fruit and pedicel was determined. Tightly linked molecular markers were also developed, enabling accurate identification of the easy separability of mature fruit and pedicel in chili peppers.

Benefits of technology

This technology enables accurate identification of the easily separable mature fruit and pedicel of chili peppers during the seedling stage, improving the efficiency of chili pepper breeding, promoting the selection of processing-type chili pepper varieties, facilitating mechanized harvesting, and enhancing economic benefits.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115786574B_ABST
    Figure CN115786574B_ABST
Patent Text Reader

Abstract

This application relates to the field of molecular markers, specifically to molecular markers related to the easy separability of mature fruit and pedicel in chili peppers, their applications, and detection methods. This invention locates the gene controlling the easy separability of mature fruit and pedicel to chromosome 10, obtaining candidate regions for this gene. Molecular markers closely linked to this trait are then developed within these candidate regions. The invented molecular markers are closely linked to the gene controlling the easy separability of mature fruit and pedicel in chili peppers, exhibiting high identification efficiency. The development and utilization of these markers allows for the identification of whether the fruit and pedicel are easily separable even at the seedling stage.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the field of molecular markers, specifically to molecular markers related to the easy separation of mature fruit and pedicel of chili peppers, as well as their applications and detection methods. Background Technology

[0002] chili( Capsicum Peppers (spp.) are annual or finitely perennial crops belonging to the genus *Capsicum* in the family Solanaceae. The increasing discovery of single nucleotide polymorphisms (SNPs) and insertion / deletion polymorphisms (InDels) has spurred research in areas such as genetic mapping and diversity analysis of peppers.

[0003] Fruit-related separation studies have always been a hot topic in the breeding industry. On the one hand, the easy separation of mature fruits from the pedicel has a significant impact on pepper yield. On the other hand, due to the increasing demand for processing peppers, breeding pepper varieties with easily separable fruits and pedicels will facilitate mechanized harvesting, reduce production costs, and improve economic efficiency. Wild peppers have easily separable mature fruits and pedicels, possibly for easier seed dispersal. In most pepper varieties, the mature fruit, placenta, and pedicel are closely connected, possibly because during domestication, pepper materials with easily separable mature fruits and pedicels were artificially selected to ensure pepper yield. Multiple hybridization studies have verified that the easy separation of mature fruits and pedicels in peppers is a dominant trait controlled by a single gene, and the gene controlling this trait has been located on chromosome 10. However, due to the lack of pepper genome information during mapping, the exact physical location could not be determined; it is only speculated that this gene is related to the gene controlling fruit firmness. PG Closely linked or identical. Currently, the physical location of genes controlling the easy segregation of ripe fruit and pedicel in chili peppers can be located using published chili pepper genomes. Summary of the Invention

[0004] The purpose of this invention is to provide molecular markers related to the easy separation of mature chili fruit and pedicel.

[0005] Another object of the present invention is to provide the application of molecular markers related to the trait of easy separation between mature chili fruit and pedicel.

[0006] Another object of the present invention is to provide a method for identifying the trait of easy separation between mature chili pepper fruit and pedicel.

[0007] According to the present invention, molecular markers related to the easily separable trait of mature chili fruit and pedicel are obtained by amplification using the following specific primers.

[0008] RE-40 forward primer: 5'AGAGAAGTTGGTGTGTTTCTACA3'

[0009] RE-40 forward primer: 5'TCTTTGGTGGATGTTCACATACA3';

[0010] RE-67 forward primer: 5'CGAATTAGGTCTCAACGAGCG3',

[0011] RE-67 reverse primer: 5'TCACCTTTTCGTAGGGCTCTC3'.

[0012] According to the present invention, a method for identifying the easily separable trait of mature chili pepper fruit and pedicel includes the step of amplifying a test sample using specific primers for molecular markers related to the easily separable trait of mature chili pepper fruit and pedicel.

[0013] RE-40 forward primer: 5'AGAGAAGTTGGTGTGTTTCTACA3'

[0014] RE-40 reverse primer: 5'TCTTTGGTGGATGTTCACATACA3';

[0015] RE-67 forward primer: 5'CGAATTAGGTCTCAACGAGCG3',

[0016] RE-67 reverse primer: 5'TCACCTTTTCGTAGGGCTCTC3'.

[0017] According to the method for identifying the trait of easy separation between mature fruit and pedicel of chili pepper according to the present invention, the RE-40 molecular marker PCR amplification agarose gel electrophoresis results show that 167 bp represents mature fruit that is not easily separated from the pedicel, and 154 bp represents mature fruit that is easily separated from the pedicel; the RE-67 molecular marker PCR amplification agarose gel electrophoresis results show that 137 bp represents mature fruit that is not easily separated from the pedicel, and 115 bp represents mature fruit that is easily separated from the pedicel.

[0018] This invention combines BSA-seq preliminary and fine mapping to locate the gene controlling the easy separation of mature fruit and pedicel to chromosome 10, obtaining candidate regions for this gene. Molecular markers closely linked to this trait were developed within these candidate regions, and large-scale population testing verified the accuracy of these primers in identifying the easy separation of mature fruit and pedicel. The easy separation of mature fruit and pedicel in chili peppers is an important research focus in chili pepper breeding. Breeding processing chili pepper varieties with easily separable mature fruit and pedicel allows for convenient mechanized harvesting, improving economic benefits. The molecular markers of this invention are closely linked to the gene controlling the easy separation of mature fruit and pedicel in chili peppers, exhibiting high identification efficiency. The development and utilization of these markers allows for identification of whether the fruit and pedicel are easily separated at the seedling stage. Attached Figure Description

[0019] Figure 1 A schematic diagram of the fracture surface of a mature fruit and its pedicel under external force.

[0020] Figure 2 The results of PCR amplification and agarose gel electrophoresis of the two molecular markers located in this application are shown, where a: RE-40 molecular marker PCR amplification and agarose gel electrophoresis result, and b: RE-67 molecular marker PCR amplification and agarose gel electrophoresis result. Detailed Implementation

[0021] Fruit detachment force (FDF) and the fracture surface of fruit and pedicel were measured in the F2 population (Ac1979 × F2) of *Eriobotrya spp.*, Ac1979, and (Ac1979 × F2) (360 plants). Phenotypes were divided into two types: those with easy separation of fruit and pedicel, and those with difficult separation. Figure 1 As shown in Figure a, mature fruits with a large free surface area (FDF) exhibit peel tearing and placenta failure when broken under external force, indicating materials where fruit and pedicel separation is difficult. Figure b shows mature fruits with a smaller FDF, where the peel and placenta remain intact and separate completely from the pedicel when broken under external force, indicating materials where fruit and pedicel separation is easy. Parental pools for easy separation of mature fruits and pedicels (Ac1979), parents for difficult separation of mature fruits and pedicels (eggplant), a mixed pool of 30 single plants for easy separation of mature fruits and pedicels (DQ), and a mixed pool of 30 plants for difficult separation of mature fruits and pedicels (ND-Q) were established. Resequencing was performed, and the sequencing data were quality checked.

[0022] Using the chili pepper CM334 (Kim et al., 2014) genome as a reference genome, BWAmen (Qin et al., 2014) algorithm version 0.7.17 was used for alignment, filtering out reads with an alignment quality of less than 30. Variation detection was performed using GATK software (Bathke & Luhken, 2021), extracting variant sites with a quality value greater than 70, a site coverage depth greater than 5, and parental genotypic differences. A total of 14,480,011 valid SNP sites were obtained for BSA analysis. The SNP-index values ​​for easily separable pools (DQ) and difficult-to-separate pools (ND-Q) of mature fruit and pedicel within each chromosome interval were calculated to obtain the Δ(SNP-index) value, ultimately locating a 2 Mb significantly associated interval on chromosome 10.

[0023] Association analysis was performed between resequencing data variation detection results and phenotypic data. Two InDel molecular markers closely linked to the easily separable trait of mature fruit and pedicel were identified within the initially located region. The primer sequences and amplification product lengths, along with the number of sequence base differences, are shown in Table 1. PCR amplification was performed on both easily separable and difficult-to-separate fruit receptacles. The PCR products were then subjected to agarose gel electrophoresis, and the electrophoresis results are shown below. Figure 2 As shown in Figure a, the agarose gel electrophoresis results of RE-40 molecular marker PCR amplification are as follows: lanes 1-7 contain mature fruit and pedicel material that is difficult to separate (167 bp), while lanes 8-14 contain mature fruit and pedicel material that is easily separated (154 bp). Figure b shows the agarose gel electrophoresis results of RE-67 molecular marker PCR amplification: lanes 1-7 contain mature fruit and pedicel material that is difficult to separate (137 bp), while lanes 8-14 contain mature fruit and pedicel material that is easily separated (115 bp). M represents the 50 bp marker.

[0024] Table 1. Information on molecular markers and primers closely linked to the easily separable phenotype of mature pepper fruit and pedicel.

[0025] .

[0026] Two molecular markers closely linked to the easily separable trait of mature fruit and pedicel in chili peppers were used to verify the characteristics of a natural population containing 363 chili pepper accessions. Of these, 270 accessions exhibited the easily separable phenotype of mature fruit and pedicel in the field, while 93 accessions showed difficulty in separating the mature fruit and pedicel. The ease of separating the mature fruit and pedicel in these 270 chili pepper accessions was verified using two discovered InDel molecular markers. The accuracy rate for RE-40 identification was 94.44%, and the accuracy rate for RE-67 identification was 93.70%.

[0027] The above embodiments are only used to explain the technical solutions of this application and do not limit the scope of protection of this application.

Claims

1. A method for identifying a trait of easy detachability of mature fruits from the pedicel in Capsicum annuum, characterized by, The method comprises the step of amplifying the sample to be tested using specific primer pairs of molecular markers related to the easy separation of mature fruits and peduncle of Capsicum annuum, The primer pair RE-40 is composed of RE-40 forward primer and RE-40 reverse primer: RE-40 forward primer: 5' AGAGAAGTTGGTGTGTTTCTACA 3' RE-40 forward primer: 5' AGAGAAGTTGGTGTGTTTCTACA 3' The primer pair RE-67 is composed of RE-67 forward primer and RE-67 reverse primer: RE-67 forward primer: 5' CGAATTAGGTCTCAACGAGCG 3', RE-67 reverse primer: 5' TCACCTTTTCGTAGGGCTCTC 3', When amplification is performed using RE-40 forward primer and RE-40 reverse primer, if the amplified band is 167 bp, the mature fruits are not easy to separate from the peduncle material; if the amplified band is 154 bp, the mature fruits are easy to separate from the peduncle; when amplification is performed using RE-67 forward primer and RE-67 reverse primer, if the amplified band is 137 bp, the mature fruits are not easy to separate from the peduncle material; if the amplified band is 115 bp, the mature fruits are easy to separate from the peduncle.

Citation Information

Patent Citations

  • Insertion / deletion site related to color gene of chili ripe fruits, molecular marker, molecular marker primer and application

    CN108384875A

  • Molecular marker closely linked or co-separated with stem removal property of ripe capsicum fruits and application of molecular marker

    CN111172307A