A recombinant microorganism for producing farnesene and lycopene

By constructing recombinant microorganisms containing specific metabolic pathways and synthetic genes, the problem of low production efficiency of farnesene and lycopene in the prior art was solved, efficient and time-divided communist production was achieved, and the economic value of farnesene was enhanced.

CN115806921BActive Publication Date: 2025-06-27WUHAN HESHENG TECH CO LTD
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202111076700.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-09-14
Publication Date
2025-06-27
Estimated Expiration
2041-09-14

AI Technical Summary

Technical Problem

It is difficult to efficiently produce farnesene and lycopene in the prior art, and the market price of farnesene is relatively low, making it difficult to achieve an increase in economic value.

Method used

Combination of farniene and lycopene is achieved by constructing a recombinant microorganism, including the MVA pathway or MEP pathway gene, the farniene synthesis gene and the lycopene synthesis gene. These genes can be present in the microorganism with plasmids as vectors, or directly integrated into the genome of the microorganism.

Benefits of technology

The high-time and space-sharing and high-yield synthesis of farniene and lycopene has been achieved, which has improved the production efficiency and economic value of farniene, and has met the market's demand for high-value-added products.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure QLYQS_1
    Figure QLYQS_1
  • Figure BDA0003262511980000031
    Figure BDA0003262511980000031
  • Figure BDA0003262511980000051
    Figure BDA0003262511980000051
Patent Text Reader

Abstract

The present invention discloses a recombinant microorganism for producing farnesene and lycopene, belonging to the field of synthetic biology. The recombinant microorganism of the present invention contains MVA pathway genes or MEP pathway genes, farnesene synthesis genes, and lycopene synthesis genes, and can use Saccharomyces cerevisiae, Escherichia coli or Streptomyces as a host. The recombinant microorganism of the present invention can be obtained by multi-copy integration of crtE, crtB, crtI, and tHMG1 genes at the rDNA locus of the genome of a high-farnesene-producing Saccharomyces cerevisiae strain, and the lycopene synthesis genes can be controlled by an inducible promoter for expression. The present invention produces two products, farnesene and lycopene, by means of a recombinant microorganism, and can enable the high-yield synthesis of farnesene and lycopene in a time- and space-separated manner.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of synthetic biology, and particularly relates to a recombinant microorganism for producing and spatiotemporally generating farnesene and lycopene. Background Art

[0002] Farnesene belongs to sesquiterpene compounds, which are terpene compounds composed of three isoprene units. It is found in plants such as mint, ginger, citrus, and chrysanthemum. Farnesene is considered to be used as an aphid pheromone for pest control. In recent years, it has been found that farnesene can also be used as a precursor of vitamin E to further synthesize vitamin E. Due to its wide range of uses, its market demand is huge. Microbial fermentation can be free from the interference and limitations of ecology, environment, and season, and can achieve stable supply. However, the current market price of farnesene is relatively low. To achieve a higher economic value conversion, it is necessary to further optimize the biosynthesis method of farnesene. As a product with high demand and low added value, realizing the production of high added value products in the same microorganism is beneficial to promoting the production process of farnesene. Summary of the Invention

[0003] The purpose of the present invention is to provide a recombinant microorganism for producing farnesene and lycopene, as well as a construction method of the recombinant microorganism and its application in the production of farnesene and lycopene.

[0004] The purpose of the present invention is achieved by the following technical solutions:

[0005] A recombinant microorganism for producing farnesene and lycopene contains MVA pathway genes or MEP pathway genes, farnesene synthesis genes, and lycopene synthesis genes. One or more of these genes can exist in the recombinant microorganism in the form of a plasmid vector, or directly integrated into the genome of the recombinant microorganism. Preferably, these genes are integrated into the genome of the recombinant microorganism.

[0006] The MVA pathway genes include ERG10, ERG13, tHMG1, ERG12, ERG8, MVD1, and IDI1. ERG10 is a gene encoding acetoacetyl-CoA thiolase, ERG13 is a gene encoding HMG-CoA synthase, tHMG1 is a gene encoding HMG-CoA reductase, ERG12 is a gene encoding mevalonate kinase, ERG8 is a gene encoding mevalonate-5-phosphate kinase, MVD1 is a gene encoding mevalonate pyrophosphate decarboxylase, and IDI1 is a gene encoding isopentenyl pyrophosphate isomerase.

[0007] The MEP pathway genes described above include Dxs, Dxr, ispD, ispE, ispF, ispG, ispH, and idi. Dxs is the gene encoding DOXP synthase, Dxr is the gene encoding DOXP racemase, ispD is the gene encoding CDP-ME synthase, ispE is the gene encoding CDP-ME kinase, ispF is the gene encoding MEcPP synthase, ispG is the gene encoding HMB-PP synthase, ispH is the gene encoding HMB-PP reductase, and idi is the gene encoding isopentenyl pyrophosphate isomerase.

[0008] The farnesene synthesis genes described above include ERG20 and FS. ERG20 is the gene encoding farnesyl pyrophosphate synthase, and FS is the gene encoding farnesene synthase.

[0009] The lycopene synthesis genes described above include crtE, crtB, and crtI. crtE is the gene encoding GGPP synthase, crtB is the gene encoding phytoene synthase, and crtI is the gene encoding phytoene desaturase.

[0010] In some embodiments, in the recombinant microorganism described above, the copy numbers of the ERG10, ERG13, tHMG1, ERG12, ERG8, MVD1, IDI1, ERG20, FS, crtE, crtB, and crtI genes are 2, 2, X, 2, 2, 2, 2, 2, X, X, X, and X respectively, where X is an integer greater than or equal to 1. Preferably, the recombinant microorganism uses Saccharomyces cerevisiae as the host.

[0011] In some embodiments, in the recombinant microorganism described above, the copy numbers of the Dxs, Dxr, ispD, ispE, ispF, ispG, ispH, idi, ispA, FS, crtE, crtB, and crtI genes are 2, 1, 1, 1, 1, 1, 1, 2, 2, Y, Y, Y, and Y respectively, where Y is an integer greater than or equal to 1. Preferably, the recombinant microorganism uses Escherichia coli or Streptomyces as the host.

[0012] Preferably, the FS is the gene bFS encoding β-farnesene synthase, and the β-farnesene synthase encoded by bFS is a β-farnesene synthase mutant derived from chamomile with the amino acid sequence shown in SEQ ID NO.1 (on the basis of the β-farnesene synthase derived from chamomile, it contains F11S, M35T, T319S, I434T, and I460V mutations at the same time). The GGPP synthase encoded by crtE is a GGPP synthase derived from Pantoea ananatis with the amino acid sequence shown in SEQ ID NO.2. The phytoene synthase encoded by crtB is a phytoene synthase derived from Pantoea agglomerans with the amino acid sequence shown in SEQ ID NO.3. The phytoene desaturase encoded by crtI is a phytoene desaturase derived from Blakeslea trispora with the amino acid sequence shown in SEQ ID NO.4.

[0013] Preferably, the Accession / GENE id of ERG10, ERG13, tHMG1, ERG12, ERG8, MVD1, IDI1, and ERG20 in NCBI is shown in the following table.

[0014] Gene Accession / GENE id ERG10 856079 ERG13 854913 tHMGR 854900, truncated at 4 - 1659bp ERG12 NM_001182715.1 ERG8 CP046093.1, 689693..691048 MVD1 NM_001183220.1 IDI1 NM_001183931.1 ERG20 853272

[0015] Preferably, when the recombinant microorganism for producing farnesene and lycopene uses Saccharomyces cerevisiae as the host, it can be constructed by transferring multiple genes containing lycopene synthesis genes (crtE, crtB, crtI) on the basis of a strain with high farnesene production. Among them, the strain with high farnesene production is based on Saccharomyces cerevisiae CEN.PK2-1D and contains 5 coding genes (bFS) of β-farnesene synthase shown in SEQ ID NO.1, contains additional MVA pathway genes (ERG10, ERG13, THMG1, ERG12, ERG8, MVD1, IDI1) and an additional ERG20 gene, and an additional tHMG1 gene. More preferably, the strain with high farnesene production is obtained by transferring the genes shown in the following table into Saccharomyces cerevisiae CEN.PK2-1D through a plasmid, and integrating the relevant genes into specific positions on the chromosome of Saccharomyces cerevisiae CEN.PK2-1D.

[0016]

[0017] Preferably, the recombinant microorganism for producing farnesene and lycopene additionally contains multiple copies of crtE, crtB, crtI, and tHMG1 on the basis of the above-mentioned strain with high farnesene production.

[0018] Preferably, in the recombinant microorganism for producing farnesene and lycopene, crtE, crtB, crtI, and tHMG1 are integrated in multiple copies on the genome of the above-mentioned high-yield farnesene strain. Further, crtE, crtB, crtI, and tHMG1 are integrated in multiple copies at the rDNA locus. The integrated copy numbers of crtE and crtI are the same (the copy number is between 1 and 200), and the integrated copy numbers of crtB and tHMG1 are the same (the copy number is between 1 and 200).

[0019] Preferably, in the recombinant microorganism for producing farnesene and lycopene, the farnesene synthesis gene and the lycopene synthesis gene are controlled by different promoters for expression. By controlling the expression of the farnesene synthesis gene and the lycopene synthesis gene with different promoters, farnesene and lycopene can be produced at different time periods. More preferably, the lycopene synthesis gene is controlled by an inducible promoter for expression.

[0020] Further, when the recombinant microorganism for producing farnesene and lycopene is Saccharomyces cerevisiae, its GAL80 gene can also be knocked out. After knocking out Gal80, the strain can synthesize farnesene and lycopene without adding galactose induction, which can reduce the experimental process and fermentation cost.

[0021] Preferably, when the recombinant microorganism for producing farnesene and lycopene uses Escherichia coli as the host, it contains an additional 1 copy of DXS, idi, and ispA, 5 copies of the coding gene (bFS) of β-farnesene synthase shown in SEQ ID NO.1, 1 copy of crtB, and 2 copies of crtE and crtI.

[0022] Preferably, when the recombinant microorganism for producing farnesene and lycopene uses Streptomyces as the host, it contains an additional 1 copy of DXS, idi, and ispA, 3 copies of the coding gene (bFS) of β-farnesene synthase shown in SEQ ID NO.1, 1 copy of crtB, and 2 copies of crtE and crtI.

[0023] Genes such as bFS, crtB, crtE, and crtI can be codon-optimized according to the codon preference of different hosts. The above-mentioned recombinant microorganism for producing farnesene and lycopene can be used for producing farnesene and lycopene.

[0024] A method for producing farnesene and lycopene using the above recombinant microorganism production method, comprising the following steps: inoculating the recombinant microorganism into a fermentation medium for fermentation to obtain a culture product containing farnesene and lycopene. Further, when the lycopene synthesis gene of the recombinant microorganism is controlled by an inducible promoter for expression, the method for producing farnesene and lycopene comprises the following steps: inoculating the recombinant microorganism into a fermentation medium for fermentation, and after the farnesene yield reaches the highest, adjusting the fermentation conditions to meet the induction conditions of the inducible promoter, and then continuing the fermentation to obtain a culture product containing farnesene and lycopene.

[0025] Advantages of the present invention: The present invention realizes the production of two products, farnesene and lycopene, by a recombinant microorganism, and realizes the high-yield synthesis of farnesene and lycopene in a time- and space-separated manner. Detailed implementation manners

[0026] The following examples are used to further illustrate the present invention, but should not be construed as limiting the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.

[0027] Example 1 Construction of the vector required for the chassis yeast strain

[0028] (1) Plasmid pZY600

[0029] The function of plasmid pZY600 is to integrate the Cas9 protein for subsequent strain modification using the Crispr-cas9 gene editing technology. Relevant characteristics of plasmid pZY600: △ChrXII-2: Hygr_pTEF1_Cas9_tCYC1, where pTEF1_Cas9_tCYC1 refers to the expression of Cas9 controlled by the TEF1 promoter, the terminator is cyc1, and the selection marker is Hygr, i.e., hygromycin; ΔchrXII-2 refers to the position of the expression cassette inserted into the chromosome.

[0030] Specific construction process of plasmid pZY600: Using plasmid pZY403 as a template, fragment G6001 (homologous left and right arms of ChrXII-2 site for integrating Cas9 gene, introducing NotI restriction site, plasmid backbone containing ampicillin resistance and ura tag) was obtained by PCR amplification with primers G6001-F and G6001-R; using pZY403 as a template, fragment G6002 (hygromycin resistance gene and its promoter TEF terminator TEF) was obtained by PCR amplification with primers G6002-F and G6002-R; using p43802 (addgene) as a template, fragment G6003 (gene Cas9 and its promoter TEF1 terminator CYC1) was obtained by PCR amplification with primers G6003-F and G6003-R. The above fragments were recombinantly constructed into pZY600 in Saccharomyces cerevisiae by DNA assemble (yeast assembly), then amplified in Escherichia coli. After restriction enzyme digestion verification and correct sequencing, pZY600 was obtained. After NotI restriction enzyme digestion linearization, the fragment with the target gene was obtained.

[0031] Among them, the construction of plasmid pZY403 was as follows: Using yeast 30000B genome as a template, fragment Z4031 (homologous left arm of ChrXII-2 site for integrating ERG13 gene) was obtained by PCR amplification with primers Z4031-F and Z4031-R; using yeast 30000B genome as a template, fragment Z4032 (promoter) was obtained by PCR amplification with primers Z4032-F and Z4032-R; using yeast 30000B genome as a template, fragment Z4033 (ERG13 gene) was obtained by PCR amplification with primers Z4033-F and Z4033-R; using yeast 30000B genome as a template, fragment Z4034 (terminator) was obtained by PCR amplification with primers Z4034-F and Z4034-R; using plasmid pZY402 (see CN 111019850 A for details) as a template, fragment Z4035 (screening marker) was obtained by PCR amplification with primers Z4035-F and Z4035-R; using yeast 30000B genome as a template, fragment Z4036 (homologous right arm of ChrXII-2 site for integrating ERG13 gene) was obtained by PCR amplification with primers Z4036-F and Z4036-R; using pZY402 (see CN 111019850 A for details) as a template, fragment Z4037 (introducing NotI restriction site, plasmid backbone containing ampicillin resistance and ura tag) was obtained by PCR amplification with primers Z4037-F and Z4037-R;. The above fragments were recombinantly constructed into pZY403 in Saccharomyces cerevisiae by DNA assemble (yeast assembly), then amplified in Escherichia coli. After restriction enzyme digestion verification and correct sequencing, pZY403 was obtained.

[0032] The primer sequences used to construct the above plasmids are shown in the following table:

[0033]

[0034] (2) Plasmid pZY413 and gRNA plasmid pZY607

[0035] The function of plasmid pZY413 is to overexpress the related genes in the MVA pathway, providing an efficient chassis strain for FPP precursor synthesis for subsequent gene screening. The related characteristics of plasmid pZY413: △ChrXI-3: ERG8_pGAL1pGAL10_tHMG1_pGAL7_ERG12, where the genes ERG8, ERG12, and THMG1 are controlled by promoters GAL1, GAL7, and GAL10 respectively, and the inserted chromosomal locus is ChrXI-3.

[0036] The specific construction process of plasmid pZY413: Using plasmid pZY402 (see CN 111019850 A for details) as a template, fragment 4131 (the homologous right arm for integrating the genes ERG8, tHMG1, and ERG12, introducing a NotI restriction site and a part of the plasmid backbone containing ampicillin resistance and ura tag) was obtained by PCR amplification with primers 4131-F and 4121-R; Using pZY402 as a template, fragment 4132 (the remaining part of the plasmid backbone containing ampicillin resistance and ura tag, a part of the homologous right arm of ChrXI-3 site for integrating the genes ERG8, tHMG1, and ERG12, introducing a NotI restriction site) was obtained by PCR amplification with primers 4122-F and 4132-R; Using pZY402 as a template, fragment 4133 (the remaining part of the homologous right arm of ChrXI-3 site for integrating the genes ERG8, tHMG1, and ERG12, a part of the target genes ERG8, tHMG1, ERG12 and their promoters and terminators) was obtained by PCR amplification with primers 4133-F and 4133-R; Using pZY402 as a template, fragment 4134 (the remaining part of the target genes ERG8, tHMG1, ERG12 and their promoters and terminators) was obtained by PCR amplification with primers 4134-F and 4134-R. The above fragments were recombined in Saccharomyces cerevisiae by the method of DNA assemble to construct pZY413, then amplified in Escherichia coli. After enzyme digestion verification and correct sequencing, pZY413 was obtained. After NotI enzyme digestion and linearization, a fragment with the target gene was obtained.

[0037] pZY607 is a gRNA plasmid targeting the ChrXI-3 locus and is a tool plasmid for targeting and cleaving genomic DNA of Saccharomyces cerevisiae in the Crispr-Cas9 gene editing technology. Based on the plasmid p43803 (http: / / www.addgene.org / 43803 / ), its guide-RNA sequence was replaced with atatgtctctaattttggaa. Using plasmid p43803 as a template, fragment 6071 (a 20bp target sequence for targeted recognition, gRNAscafold, terminator SUP4, and a part of the plasmid backbone containing ampicillin resistance and ura tag) was obtained by PCR amplification with primers 6071-F and G6031-R; using p43803 as a template, fragment 6072 (the remaining part of the plasmid backbone containing ampicillin resistance and ura tag, a 20bp target sequence for targeted recognition, and promoter SNR52) was obtained by PCR amplification with primers G6032-F and 6072-R. The above fragments were recombinantly constructed into pZY607 in Saccharomyces cerevisiae by the DNA assemble method.

[0038] The sequences of each primer used to construct the above plasmid are shown in the following table:

[0039]

[0040]

[0041] (3) Plasmid pZY412L and gRNA plasmid pZY606

[0042] The function of plasmid pZY412L is to overexpress related genes in the MVA pathway and provide an efficient chassis strain for FPP precursor synthesis for subsequent gene screening. Relevant characteristics of plasmid pZY412L: △ChrXII-4: IDI1_pGAL1pGAL10_ERG10_pGAL7_MVD1, with promoters GAL1, GAL7, and GAL10 controlling the expression of genes IDI1, MVD1, and ERG10 respectively, and the inserted chromosomal locus being ChrXII-4.

[0043] Specific construction process of plasmid pZY412L: Fragment pZY412 SPD (a meaningless DNA sequence used to replace the g418 resistance gene in pZY410 (see CN 111019850 A) and having sticky ends containing SalI and SpeI restriction sites) was obtained by template-free denaturation annealing PCR using primers 412-F and 412-R. The reaction system for this template-free denaturation annealing PCR was 10 μL, with 4.5 μL of each primer and 1 μL of 10×T4 DNA ligase buffer. The following PCR program was set: 95°C for 5 min; touchdown PCR, 95°C for 1 min, -1°C / cycle for 70 cycles; 25°C for 5 min; 12°C for ∞ (the fragment can be temporarily stored at -40°C after being taken out from the template-free denaturation annealing PCR). After digesting pZY401 (see CN111019850A) with SalI and SpeI, the large fragment pZY412 VPD (a vector fragment containing the target genes MVD1, ERG10, IDI1, as well as ampicillin resistance and ura screening markers) of 12,835 bp was recovered by gel extraction. Fragment pZY412 SPD and fragment pZY412 VPD were ligated overnight (about 20 h) at 16°C using T4 DNA ligase in a molar ratio of 3:1. The ligation product was transferred into competent Escherichia coli DH10B cells for amplification. After digestion verification and correct sequencing, plasmid pZY412L was obtained. After linearization by NotI digestion, a fragment with the target gene was obtained.

[0044] pZY606 is a gRNA plasmid targeting the Chr XII-4 locus and is a tool plasmid for identifying and cleaving genomic DNA of Saccharomyces cerevisiae in the Crispr-Cas9 gene editing technology. It replaces the guide-RNA sequence with gcttcaagaattgagtaaac on the basis of plasmid p43803. Using plasmid p43803 as a template, fragment 6061 (a 20-bp target sequence for targeted recognition, gRNA scafold, terminator SUP4, and a part of the plasmid backbone containing ampicillin resistance and ura tags) was amplified by PCR using primers 6061-F and G6031-R; using p43803 as a template, fragment 6062 (the remaining part of the plasmid backbone containing ampicillin resistance and ura tags, a 20-bp target sequence for targeted recognition, and promoter SNR52) was amplified by PCR using primers G6032-F and 6062-R. The above fragments were recombinantly constructed into pZY606 in Saccharomyces cerevisiae by the DNA assemble method.

[0045] The sequences of each primer used for constructing the above plasmids are shown in the following table:

[0046]

[0047] (4) Plasmid pZY414 and gRNA plasmid pZY608

[0048] The function of plasmid pZY414 is to overexpress the related genes in the MVA pathway, providing an efficient chassis strain for FPP precursor synthesis for subsequent gene screening. The related characteristics of plasmid pZY414: △ChrX-3: pGAL1_ERG13_pGAL10_tHMG1, where the expression of genes ERG13 and THMG1 is controlled by promoters GAL1 and GAL10 respectively, and the inserted chromosomal locus is ChrX-3.

[0049] The specific construction process of plasmid pZY414: Using the genome of Saccharomyces cerevisiae strain CEN.PK2-1D(30000B) as a template, fragment 4141 (the homologous right arm of ChrX-3 locus for integrating ERG13 and tHMG1 genes, introducing NotI restriction site) was amplified by PCR with primers 4141-F and 4141-R; Using plasmid pRS426 as a template, fragment 4142 (the plasmid backbone containing ampicillin resistance and ura tag) was amplified by PCR with primers 4142-F and 4142-R; Using the 30000B genome as a template, fragment 4143 (the homologous right arm of ChrX-3 locus for integrating ERG13 and tHMG1 genes, introducing NotI restriction site) was amplified by PCR with primers 4143-F and 4143-R; Using pZY410 (see CN 111019850 A for details) as a template, fragment 4144 (the target genes ERG13, tHMG1 and their promoters and terminators) was amplified by PCR with primers 4144-F and 4144-R. The above fragments were recombined in Saccharomyces cerevisiae to construct pZY414 by the method of DNAassemble, then amplified in Escherichia coli. After enzyme digestion verification and correct sequencing, the plasmid of pZY414 was obtained. After NotI enzyme digestion and linearization, the fragment with the target gene was obtained.

[0050] pZY608 is a gRNA plasmid targeting the ChrX-3 locus and is a tool plasmid for identifying and cleaving genomic DNA of Saccharomyces cerevisiae at the target site in the Crispr-Cas9 gene editing technology. On the basis of plasmid p43803, its guide-RNA sequence was replaced with ctaatgtgtccgcgtttcta. Using plasmid p43803 as a template, fragment 6081 (a 20bp target sequence for targeted recognition, gRNA scafold, terminator SUP4, and a part of the plasmid backbone containing ampicillin resistance and ura tag) was obtained by PCR amplification with primers 6081-F and G6031-R; using p43803 as a template, fragment 6082 (the remaining part of the plasmid backbone containing ampicillin resistance and ura tag, a 20bp target sequence for targeted recognition, and promoter SNR52) was obtained by PCR amplification with primers G6032-F and 6082-R. Fragment 6081 and fragment 6082 were recombinantly constructed into pZY608 in Saccharomyces cerevisiae by DNA assemble method, and then amplified in Escherichia coli. After enzyme digestion verification and correct sequencing, pZY608 was obtained.

[0051] The sequences of each primer used for constructing the above plasmid are shown in the following table:

[0052]

[0053]

[0054] Example 2 Construction of chassis yeast strain

[0055] The linearized fragment of plasmid pZY600 was transferred into Saccharomyces cerevisiae strain CEN.PK2-1D and integrated into the chromosome according to homologous recombination. The integration site was ChrXII-2 and the selection marker was hygromycin (Hygr). Thus, the background strain JCR1 was successfully constructed.

[0056] The linearized fragment of plasmid pZY413 and plasmid pZY607 were co-transformed into Saccharomyces cerevisiae JCR1. The selection marker was uracil (URA3). After counter-selection with 5-FOA to remove the plasmid, strain JCR23 was obtained.

[0057] The linearized fragment of plasmid pZY414 and plasmid pZY608 were co-transformed into Saccharomyces cerevisiae JCR23. The selection marker was uracil (URA3). After counter-selection with 5-FOA to remove the plasmid, strain JCR25 was obtained.

[0058] The linearized fragment of plasmid pZY412L and plasmid pZY606 were co-transformed into Saccharomyces cerevisiae JCR25. The selection marker was uracil (URA3). After counter-selection with 5-FOA to remove the plasmid, strain JCR27 was obtained.

[0059]

[0060] Example 3 Construction of Expression Vector for Farnesene Synthase

[0061] (1) Plasmid pZY900

[0062] Relevant characteristics of plasmid pZY900: △LEU2: LEU2(URA3)_TCYC1_LacZ_pGAL10pGAL1_ERG20_tERG20, with promoters GAL1 and GAL10 controlling the expression of genes ERG20 and LacZ respectively, the selection marker is Leu2, and the inserted chromosomal locus is Leu2.

[0063] Specific construction process of plasmid pZY900: Using the yeast S288c genome as a template, fragments 9001 (left homologous arm of Leu2), 9002 (terminator tTDH2), 9006 (gene ERG20 and terminator tERG20), and 9007 (right arm of Leu2) were amplified respectively with 900-1F / 1R, 900-2F / 2R, 900-6F / 6R, and 900-7F / 7R; using the genome of yeast 30000B as a template, fragments 9003 (terminator tCYC1) and 9005 (promoters pGAL1 and Pgal10) were amplified respectively with primers 900-3F / 3R and 900-5F / 5R; the plasmid backbone (introducing MssI restriction site, selection marker) was amplified with primer 900-8F / 8R. The above fragments were recombined in Saccharomyces cerevisiae by the method of DNAassemble (yeast assembly) to construct pZY900, and then amplified in Escherichia coli. After enzyme digestion verification and correct sequencing, pZY900 was obtained.

[0064] The sequences of each primer used for constructing the above plasmid are shown in the following table:

[0065]

[0066]

[0067] (2) Plasmid pBFS45

[0068] The farnesene synthase used for constructing plasmid pBFS45 is β-farnesene synthase (Mac-bFS) from chamomile. Through research, it was found that after mutations in F11S, M35T, T319S, I434T, and I460V of this enzyme, the activity of β-farnesene synthase was greatly improved. The yield of farnesene produced by transforming the mutant enzyme into strain JCR27 with a plasmid was nearly doubled compared to the wild type.

[0069] The nucleotide sequence of Mac-bFS with F11S, M35T, T319S, I434T, and I460V mutations optimized according to the codons of Saccharomyces cerevisiae is as follows.

[0070]

[0071] The process of constructing plasmid pBFS45 is as follows. A fragment was amplified from the nucleotide sequence of Mac-bFS with mutations F11S, M35T, T319S, I434T, and I460V (SEQ ID NO.5) using primers pBFS1-1F / pBFS45-6R. Then, the amplified fragment was cloned into pZY900 by the method of GoldenGate assembly to obtain plasmid pBFS45.

[0072] The primer sequences used for constructing plasmid pBFS45 are shown in the following table:

[0073]

[0074]

[0075] (3) Plasmid pBFS45-P4

[0076] The Ura3 left arm, tCYC1, pGAL10-pGAL1, tPGK1, and Ura3 right arm were amplified from CEN.PK2-1D using primers pAFS1-P2-1F / R, pAFS1-P2-3F / pBFS45-P4-3R, pBFS45-P4-5F / pBFS45-P4-5R, pBFS45-P4-7F / pAFS1-P2-7R, and pAFS1-P2-8F / R. The His3 marker was amplified from pRS423 using primer pAFS1-P2-2F / R. Mac-bFS (F11S, M35T, T319S, I434T, I460V) was amplified from pBFS45 using primers pBFS45-P4-4F / R and pBFS45-P4-6F / R. The plasmid backbone was amplified from pRS426 using primer pAFS1-P2-9F / R. Subsequently, these fragments were assembled to obtain pBFS45-P4.

[0077] (4) Plasmid pBFS45-P7

[0078] The YPRCdelta15 left arm, tCYC1, pGAL10-pGAL1, tPGK1, and YPRCdelta15 right arm were amplified from CEN.PK2-1D using the primers pAFS1-P5-1F / R, pAFS1-P5-3F / pBFS45-P7-3R, pBFS45-P7-5F / R, pBFS45-P7-7F / pAFS1-P5-7R, and pAFS1-P5-8F / R. The Trp1 marker was amplified from pRS424 using the primer pAFS1-P5-2F / R, and Mac-bFS (F11S, M35T, T319S, I434T, I460V) was amplified from pBFS45 using the primers pBFS45-P7-4F / R and pBFS45-P7-6F / R. The plasmid backbone was amplified from pRS426 using the primer pAFS1-P5-9F / R. Subsequently, these fragments were assembled to obtain pBFS45-P7.

[0079] The primer sequences used for constructing the above plasmids are shown in the following table:

[0080]

[0081]

[0082]

[0083] Example 4 Construction of a High β-Farnesene-Producing Strain

[0084] The plasmid pBFS45 was linearized with Mssi, and the fragment carrying the target gene was recovered and transformed into Saccharomyces cerevisiae JCR27, which was integrated into the chromosome according to homologous recombination. The integration site was LEU2, and the selection marker was leucine, to construct strain JVA122. The linearized plasmid pBFS45-P4 was recovered with the fragment carrying the target gene and transformed into Saccharomyces cerevisiae JVA122, which was integrated into the chromosome according to homologous recombination. The integration site was URA3, and the selection marker was histidine, to construct strain JVA129. The linearized pBFS45-P7 was recovered with the fragment carrying the target gene and transformed into Saccharomyces cerevisiae JVA129, which was integrated into the chromosome according to homologous recombination. The integration site was YPRCdelta15, and the selection marker was tryptophan, to construct strain JVA139. After shake-flask fermentation, the yield of strain JVA139 was 790 mg / L.

[0085] Example 5 Construction of a Lycopene Synthesis Vector for Simultaneous Production

[0086] The pSNR52_gRNA.rDNA and KlURA3 were amplified from pKlURA3 100 using primers 1621-F / R, and then cloned into pCAS by Golden Gate assembly to obtain plasmid pXZ162.

[0087] The rDNA left arm was amplified from the Saccharomyces cerevisiae S288C genome using primers 1471-F / R. pGAL10-BtCrtI-tCYC1 was amplified from pZY184 using primers 1472-F / 1114-F. pGAL1-PaCrtE-tGPM1 was amplified from pZY153 using primers 1115-R / 1473-R. The rDNA right arm was amplified from S288C using primers 1474-F / 1474-R, and then assembled with pMD19T by Gibson assembly to obtain plasmid pXZ147.

[0088] The rDNA left arm was amplified from S288C using primers 1471-F / 1481-R. pGAL10-tHMG1-tACT1 was amplified from pZY141 using primers 1482-F / 1114-F. pGAL1-PagCrtB-tPGK1 was amplified from pZY184 using primers 1115-R / 1483-R. The rDNA right arm was amplified from S288C using primers 1484-F / 1474-R, and then assembled with pMD19T by Gibson assembly to obtain plasmid pXZ148.

[0089] Plasmids such as pKlURA3 100, pZY184, pZY153, and pZY141 used in the above plasmid construction are all known materials in the prior art. The source of pKlURA3 100 is "A gRNA-tRNA array for CRISPR-Cas9 based rapid multiplexed genome editing in Saccharomyces cerevisiae", and the sources of pZY184, pZY153, and pZY141 are "Systematic Metabolic Engineering of Saccharomyces cerevisiae for Lycopene Overproduction".

[0090]

[0091]

[0092] Construction of Strains for Simultaneous Production of β-Farnesene and Lycopene in Example 6

[0093] Linearize plasmids pXZ147 and pXZ148 with Mssi, recover the fragments carrying the target genes, and co-transform them with pXZ162 into Saccharomyces cerevisiae JVA139. Through CRISPR-Cas9 gene editing, multi-site integration into the chromosome is achieved at the rDNA locus, with the selection marker being uracil, and strain JZL29 is constructed.

[0094] Select red-colored JZL29 monoclonal colonies and perform knockout of the GAL80 gene (construction of the knockout cassette pZY521: Using the genome of yeast 30000B as a template, amplify the left homologous arm of GAL80 using primers 5201-F / 5211-R; using pZY900 as a template, amplify the selection marker URA3 using primers 5212-F / 5212-R; amplify the right homologous arm of GAL80 using primers 5213-F / 5203-R;) to eliminate the use of galactose during fermentation, and strain JZL32 is constructed. After shake-flask fermentation, the yields of β-farnesene and lycopene reach 106 mg / L and 63 mg / L respectively.

[0095] The above primer sequences are shown in the following table:

[0096] Primer Sequence (5’-3’) 5201-F caatggtctaggtagtggcattcg 5211-R CGACTCACTATAGGGCGAATTGGGTACgacgggagtggaaagaacgg 5212-F tcccgttctttccactcccgtcGTACCCAATTCGCCCTATAGTGAG 5212-R gccaagcacagggcaagatgcttTCACAGCTTGTCTGTAAGCGGA 5213-F GCATCCGCTTACAGACAAGCTGTGAaagcatcttgccctgtgctt 5203-R gagaccaccaagaatacagaagctattat

[0097] Example 7 Fermentation of the strain for simultaneous synthesis of farnesene and lycopene in a fermenter

[0098] Refer to the fermentation medium described in the literature (van Hoek, P.; de Hulster, E.; van Dijken, J.P.; Pronk, J.T. Fermentative capacity in high-cell-density fed-batch cultures of baker’s yeast. Biotechnol. Bioeng. 2000, 68, 517 - 523.), and perform fed-batch fermentation on the constructed strain JZL32. Add a covering agent during fermentation to achieve in-situ extraction. The covering agent can be dodecane, isopropyl myristate, isopropyl palmitate, liquid paraffin, or white oil. Control the dissolved oxygen above 20% during fermentation, the pH at 5, the glucose concentration at 1 - 2 g / L, and the ethanol concentration below 5 g / L. Finally, after 144 h of fermentation in the fermenter, the farnesene yield of the strain is 616 mg / L, and the lycopene yield is 419 mg / L.

[0099] Example 8 Fermentation regulation to enable the strain for simultaneous synthesis of farnesene and lycopene to accumulate farnesene first and then lycopene

[0100] Using the fermentation medium described in the reference (van Hoek, P.; de Hulster, E.; van Dijken, J.P.; Pronk, J.T. Fermentative capacity in high-cell-density fed-batch cultures of baker’s yeast. Biotechnol. Bioeng. 2000, 68, 517-523.), fed-batch fermentation was carried out on the constructed strain, JZL32. During the fermentation process, a covering agent was added to achieve in-situ extraction. The covering agent can be dodecane, isopropyl myristate, isopropyl palmitate, liquid paraffin, or white oil. The dissolved oxygen was controlled above 20% during the fermentation process, the pH was 5, the glucose concentration was 1-2 g / L, and before 72 h of fermentation, the ethanol concentration was controlled at about 10 g / L to achieve efficient synthesis of farnesene. After 72 h, the ethanol concentration was controlled below 5 g / L to initiate the synthesis of lycopene. Finally, after 144 h of fermentation in the fermenter, the farnesene yield of the strain was 25 g / L, and the lycopene yield was 1.1 g / L.

[0101] Example 9 Construction of a Vector for Delayed Production of Lycopene

[0102] When producing both lycopene and farnesene simultaneously, the synthesis of both will compete for the substrate acetyl coenzyme A, resulting in a significant decrease in the yield of farnesene. Therefore, a plasmid was constructed to achieve the synthesis of lycopene by the promoter being controlled to start in the later stage of fermentation.

[0103] (1) Using the maltose-inducible promoter MAL32 to control the lycopene synthesis gene

[0104] The bidirectional promoter XhoI-pMAL32-pMAL32-NcoI was synthesized by gene. The fragment was obtained by amplifying from pXZ147 with primers pMAL32-F / R, and the plasmid pXZ147-pMAL32 was obtained by restriction digestion and ligation with the promoter.

[0105] The bidirectional promoter XhoI-pMAL32-pMAL32-MluI was synthesized by gene. The fragment was obtained by amplifying from pXZ148 with primers pMAL32-8F / 8R, and the plasmid pXZ148-pMAL32 was obtained by restriction digestion and ligation with the promoter.

[0106] Primer Sequence (5’-3’) pMAL32-F cataaccatggATGACTGTTTGTGCTAAGAAACAT pMAL32-R ataactcgagATGTCTGATCAGAAGAAGCAC pMAL32-8F acataaacgcgtATGTCACAACCACCATTATTG pMAL32-8R ataactcgagATGGTTTTAACCAATAAAACAGTCA

[0107] Promoter sequence:

[0108] agttaattaatagtcttggatgtaattcttattgttatactgaatacgctaaaaccactcacaacaagtatggagtatattgtgtctctttatatactgagtacttatgcaatatgcgctcactcaggatgaaatgtacacagccgaaagtatattgaaagctgcctctgtggaaacttctatctaatgttgtctccagatgtagactatgaggcctgaagaagtctttaaacacctgttggagagtataaggagactgctacaacaacgtcttccccacaaaaattatgtggaggccggtatgatacctgcacaaacgttaagttacacatgaaaaagagactgacataactttgatctctgaaaatatgttttcccctgagtagcttcactgcttggataccaatacgaatagaccttggctatagtaagttgcatctgtaccgtagagattcttgcaacctcgcttaaactctcgcttttatataatatttctccttattgcgcgcttcgttgaaaatttcgctaaacacggggtttaagtttaagtttacaggatttatccggaagttttcgcggaccccacacaattaagaattggctcgaagagtgataacgcatacttttcttttcttttttcagttcctagcgtacctaacgtaggtaacatgatttggatcgtgggatgatacaaacaacgtaagatgagtagttccttcctcaattcttctttcagcatcatttTcttgaggcgctctgggcaaggtataaaaagttccattaatacgtctctaaaaaattaaaccatctatctcttaagcagtttttttgataatctcaaatgtacatcagtcaagcgtaactaaaatacataa。

[0109] (2) Use the microaerophilic promoter pDAN1-1 to control the lycopene synthesis gene

[0110] The bidirectional promoter XhoI-pDAN1-1-pDAN1-1-NcoI was synthesized by gene synthesis. The fragment was amplified from pXZ147 using primers pDAN1-1-F / R, and the plasmid pXZ147-pDAN1-1 was obtained by restriction digestion and ligation with the promoter.

[0111] The bidirectional promoter XhoI-pDAN1-1-pDAN1-1-SpeI was synthesized by gene synthesis. The fragment was amplified from pXZ148 using primers pDAN1-1-8F / 8R, and the plasmid pXZ148-pDAN1-1 was obtained by restriction digestion and ligation with the promoter.

[0112] Primer Sequence (5’-3’) pDAN1-1-F aagtaccatggATGACTGTTTGTGCTAAGAAACATG pDAN1-1-R ataactcgagATGTCTGATCAGAAGAAGCAC pDAN1-1-8F caagtaactagtATGTCACAACCACCATTATTGGA pDAN1-1-8R ataactcgagATGGTTTTAACCAATAAAACAGTCA

[0113] Promoter sequence:

[0114] agctcaattcacgctggattcggcgatccgttttcttcaatcctcacgtgctttcttcgtttgagtgcaaaagttcatatgatgctatctcccgcttaccttattagtcgaaaatggggagaatttcctattttatctgtcgtttagcacatatggccaggaagatacataaggtttcgccgaacgacggggtcaattcgtcctttttgtacacatcgtttaatttatgaggaaaaattgatgaatgtatcctccgtagacgctcctctgaaaagtttcatgttccctgcgcgttcctttgataggcaataaaacaatacaacgcgtgcctttgaaaatgccgagatctatacgaggcctctaacaaaacatcgttcaggaacagagaatactagaaatgcaaaagggtccctgggtactcattgaatagagatgattgaaaatactgcgtataaaatagcacgactaagtgatactatttttatgtcgacacggtactatttcttctttttcagataaaagtgtagcatactaaatatataccccaagta.

[0115] (3) Use the copper ion-inducible promoter pCUP1 to control the lycopene synthesis gene

[0116] The bidirectional promoter XhoI-pCUP1-pCUP1-NcoI was synthesized by gene synthesis. The fragment was amplified from pXZ147 using primers pCUP1-F / R, and the plasmid pXZ147-pCUP1-1 was obtained by restriction digestion and ligation with the promoter.

[0117] The bidirectional promoter XhoI-pCUP1-pCUP1-MluI was synthesized by gene synthesis. The fragment was amplified from pXZ148 using primers pCUP1-8F / 8R, and the plasmid pXZ148-pCUP1-1 was obtained by restriction digestion and ligation with the promoter.

[0118] Primer Sequence (5’-3’) pCUP1-F aagtaccatggATGACTGTTTGTGCTAAGAAACATG pCUP1-R ataactcgagATGTCTGATCAGAAGAAGCAC pCUP1-8F aactgacgcgtATGTCACAACCACCATTATTGGA pCUP1-8R ataactcgagATGGTTTTAACCAATAAAACAGTCA

[0119] Promoter sequence:

[0120] tatctgtatttaaaacacttttgtattatttttcctcatatatgtgtataggtttatacggatgatttaattattacttcaccaccctttatttcaggctgatatcttagccttgttactagttagaaaaagacatttttgctgtcagtcactgtcaagagattcttttgctggcatttcttctagaagcaaaaagagcgatgcgtcttttccgctgaaccgttccagcaaaaaagactaccaacgcaatatggattgtcagaatcatataaaagagaagcaaataactccttgtcttgtatcaattgcattataatatcttcttgttagtgcaatatcatatagaagtcatcgaaatagatattaagaaaaacaaactg.

[0121] Construction of Lycopene-Producing Strains with Delayed Production in Example 10

[0122] The plasmids pXZ147-pMAL32 and pXZ148-pMAL32 were linearized with Mssi, and the fragments carrying the target genes were recovered. These fragments were co-transformed with pXZ162 into Saccharomyces cerevisiae JVA139, and multiple-site integration into the chromosome was achieved through crispr-cas9 gene editing. The integration site was rDNA, and the selection marker was uracil, resulting in the construction of strain JZL29-pMAL32.

[0123] Red-colored JZL29-pMAL32 monoclonal colonies were selected, and the GAL80 gene was knocked out (knockout cassette pZY521) to eliminate the use of galactose during fermentation, resulting in the construction of strain JZL32-pMAL32.

[0124] Linearize plasmids pXZ147-pDAN1-1 and pXZ148-pDAN1-1 with Mssi, recover the fragments carrying the target gene, and co-transform them with pXZ162 into Saccharomyces cerevisiae JVA139. Through CRISPR-Cas9 gene editing, achieve multi-site integration onto the chromosome. The integration site is rDNA, and the selection marker is uracil, to construct strain JZL29-pDAN1-1.

[0125] Select red-colored JZL29-pDAN1-1 monoclonal colonies, perform knockout of the GAL80 gene (knockout cassette pZY521) to eliminate the use of galactose during fermentation, and construct strain JZL32-pDAN1-1.

[0126] Linearize plasmids pXZ147-pCUP1 and pXZ148-pCUP1 with Mssi, recover the fragments carrying the target gene, and co-transform them with pXZ162 into Saccharomyces cerevisiae JVA139. Through CRISPR-Cas9 gene editing, achieve multi-site integration onto the chromosome. The integration site is rDNA, and the selection marker is uracil, to construct strain JZL29-pCUP1.

[0127] Select red-colored JZL29-pCUP1 monoclonal colonies, perform knockout of the GAL80 gene (knockout cassette pZY521) to eliminate the use of galactose during fermentation, and construct strain JZL32-pCUP1.

[0128] Example 11 Fed-batch fermentation of strains for sequential and spatial synthesis of farnesene and lycopene

[0129] Refer to the fermentation medium described in the literature (van Hoek, P.; de Hulster, E.; van Dijken, J. P.; Pronk, J. T. Fermentative capacity in high-cell-density fed-batch cultures of baker’s yeast. Biotechnol. Bioeng. 2000, 68, 517 - 523.), and perform fed-batch fermentation on the constructed strains JZL32-pMAL32, JZL32-pDAN1-1, and JZL32-pCUP1. Add a covering agent during fermentation to achieve in-situ extraction. The covering agent can be dodecane, isopropyl myristate, isopropyl palmitate, liquid paraffin, or white oil. Control the pH at 5, the glucose concentration at 1 - 2 g / L, and the ethanol concentration below 5 g / L during the fermentation process.

[0130] To achieve the spatio-temporal synthesis of farnesene and lycopene, the fermentation of strain JZL32-pMAL32 was controlled as follows: farnesene was synthesized first before 72 h. After the farnesene production reached the highest level at 72 - 84 h, maltose was added to induce the expression of lycopene synthesis genes. Finally, after 144 h of fermentation, the farnesene production of the strain was 35 g / L, and the lycopene production was 1200 mg / L.

[0131] To achieve the spatio-temporal synthesis of farnesene and lycopene, the fermentation of strain JZL32-pDAN1-1 was controlled as follows: in the early stage before 72 h, the dissolved oxygen in the fermentation process was controlled to be sufficient to synthesize farnesene first. After the farnesene production reached the highest level (72 - 84 h), the expression of lycopene synthesis genes was induced by reducing aeration and lowering the rotation speed to reduce the dissolved oxygen. Finally, after 144 h of fermentation, the farnesene production of the strain was 15 g / L, and the lycopene production was 1000 mg / L.

[0132] To achieve the spatio-temporal synthesis of farnesene and lycopene, the fermentation of strain JZL32-pCUP1 was controlled as follows: farnesene was synthesized first. After the farnesene production reached the highest level (72 - 84 h), copper ions were added to induce the expression of lycopene synthesis genes. Finally, after 144 h of fermentation, the farnesene production of the strain was 38 g / L, and the lycopene production was 1050 mg / L.

[0133] Example 12 Construction of Recombinant Escherichia coli for Co-Synthesis of Farnesene and Lycopene

[0134] Isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP) are two common substrates for isoprenoid biosynthesis. Different from Saccharomyces cerevisiae, in Streptomyces and Escherichia coli, IPP and DMAPP are synthesized through the MEP pathway. By optimizing the MEP pathway in Escherichia coli and introducing the heterologous synthesis genes farnesene synthase and lycopene synthesis genes, the co-synthesis of farnesene and lycopene in Escherichia coli can be achieved.

[0135] To achieve efficient co - synthesis of farnesene and lycopene in Escherichia coli, first, the rate - limiting enzymes DXS (the gene encoding it has the number ACT42267.1 in the genebank database) and IDI (with the number ACT44538.1 in the genebank database) of the MEP pathway were overexpressed to increase the flux of the MEP pathway. On this basis, ispA (with the number NP_414955.1 in the genebank database), five farnesene synthase genes bFS (identical to the amino acid sequence of the farnesene synthase used in the construction of the Saccharomyces cerevisiae strain, codon - optimized for Escherichia coli), a set of lycopene - synthesizing genes crtE, crtB, crtI, and an additional copy of crtE and crtI (identical to the amino acid sequence of the lycopene - synthesizing genes used in the construction of the Saccharomyces cerevisiae strain, codon - optimized for Escherichia coli) were introduced. The optimized sequences of each gene are as follows.

[0136]

[0137] crtE - Escherichia coli: atgaccgtgtgtgcaaaaaaacatgttcatctgacccgcgatgccgccgaacagctgctggccgatattgatcgccgtctggatcagctgctgccggttgaaggcgaacgtgatgtggttggtgcagcaatgcgtgaaggcgccctggccccgggtaaacgcattcgtccgatgctgctgctgctgaccgcacgtgatctgggttgtgcagtgagtcatgatggtctgctggatctggcctgcgccgtggaaatggttcatgccgcaagcctgattctggatgatatgccgtgcatggatgatgcaaaactgcgtcgtggccgtccgaccattcatagtcattatggtgaacatgtggccattctggcagcagttgcactgctgagtaaagcatttggtgttattgccgatgccgatggcctgaccccgctggcaaaaaatcgcgccgtgagtgaactgagtaatgccattggtatgcagggcctggtgcagggccagtttaaagatctgagcgaaggcgataaaccgcgcagtgccgaagccattctgatgaccaatcattttaaaaccagtaccctgttttgtgccagtatgcagatggcaagtattgtggccaatgcaagtagtgaagcccgtgattgtctgcatcgttttagcctggatctgggtcaggcctttcagctgctggatgatctgaccgatggcatgaccgataccggtaaagatagtaatcaggatgccggtaaaagtaccctggttaatctgctgggcccgcgcgcagttgaagaacgtctgcgtcagcatctgcagctggcaagtgaacatctgagcgcagcatgtcagcatggccatgcaacccagcattttattcaggcatggtttgataaaaagctggccgccgttagctaa。

[0138] crtB - Escherichia coli: atgagtcagccgccgctgctggatcatgcaacccagaccatggccaatggcagtaaaagttttgccaccgcagccaaactgtttgatccggcaacccgtcgtagcgtgctgatgctgtatacctggtgccgtcattgtgatgatgttattgatgatcagacccatggttttgccagtgaagcagcagccgaagaagaagcaacccagcgcctggcacgtctgcgcaccctgaccctggcagcctttgaaggcgcagaaatgcaggatccggcctttgccgcatttcaggaagtggcactgacccatggtattaccccgcgcatggccctggatcatctggatggttttgcaatggatgttgcccagacccgttatgttacctttgaagataccctgcgttattgttatcatgttgcaggcgtggtgggcctgatgatggcacgtgttatgggtgttcgcgatgaacgcgttctggatcgtgcctgcgatctgggtctggcatttcagctgaccaatattgcccgtgatattattgatgatgcagcaattgatcgctgctatctgccggcagaatggctgcaggatgcaggtctgaccccggaaaattatgcagcacgtgaaaatcgcgcagccctggcacgcgtggcagaacgtctgattgatgcagccgaaccgtattatattagcagccaggccggcctgcatgatctgccgccgcgttgcgcctgggcaattgccaccgcacgtagtgtttatcgtgaaattggcattaaagttaaggcagcaggcggcagcgcctgggatcgtcgtcagcataccagtaaaggcgaaaaaattgccatgctgatggcagcaccgggtcaggttattcgtgcaaaaaccacccgtgtgaccccgcgtccggcaggtctgtggcagcgtcctgtgtaa。

[0139]

[0140] The plasmid pE-FL-1-T7 contains one copy of DXS, idi, ispA and two copies of the bFS gene, which was cloned by restriction enzyme digestion and ligation. The promoter controlling gene expression is the strong promoter T7, and the replicon of the plasmid is the p15A replicon. The plasmid backbone was amplified using pMH1 as a template with primers pE-FL-1-lac-F / pE-FL-1-T7-R. The target sequence (AvrII-pT7-DXS-idi-ispA-bFS-bFS-MluI in sequential connection) was obtained by gene synthesis, and then the target plasmid was obtained by restriction enzyme digestion and ligation with the plasmid backbone. The positive clone was verified to be correct by sequencing.

[0141] The plasmids pMH1, pFZ81, and pFZ71 used in this example were all from the literature (Zhu F, et al., 2014. In vitro reconstitution of mevalonate pathway and targeted engineering of farnesene overproduction in Escherichia coli. Biotechnol Bioeng. 111(7):1396 - 405.).

[0142] Primer Sequence (5’-3’) pE-FL-1-lac-F AAacgcgtGGATCCACTAGTTCTAGAGCGG pE-FL-1-T7-R cctaggGCCTGGGGTGCCTAATGAGTGAGCTAACTC

[0143]

[0144] The plasmid pE-FL-1-lac contains one copy of DXS, idi, ispA and two copies of the bFS gene, which are cloned by the method of enzyme digestion and ligation. The promoter controlling gene expression is replaced with the medium-strength promoter lac, and the replicon of the plasmid is the p15A replicon. The plasmid backbone is amplified using pMH1 as a template with primers pE-FL-1-lac-F / R. The target sequence (sequentially linked with AvrII-DXS-idi-ispA-bFS-bFS-MluI) is obtained by gene synthesis, and then the target plasmid is obtained by enzyme digestion and ligation with the plasmid backbone. The positive clone is verified to be correct by sequencing.

[0145] Primer Sequence (5’-3’) pE-FL-1-lac-F AAacgcgtGGATCCACTAGTTCTAGAGCGG pE-FL-1-lac-R ATcctaggTTTATATTCCTCCTAGTCGACTCTAGAGGATC

[0146]

[0147] Plasmid pE-FL-2 contains one copy of crtE, crtB, crtI, and one copy of the bFS gene. The promoter controlling gene expression is the moderately strong lac promoter, and the replicon of the plasmid is the pBBR1MCS replicon. The vector backbone was obtained by amplifying with primers pE-F-2-F / R using pFZ81 as a template. The target sequence was synthesized by gene synthesis (synthesized in the order of AvrII-crtE-crtB-crtI-bFS-SpeI), and then the target plasmid was obtained by restriction enzyme digestion and ligation with the plasmid backbone. The positive clone was verified to be correct by sequencing.

[0148] Primer Sequence (5’-3’) pE-F-2-F ACTAGTGAGCTCCAATTCGCCCTATA pE-F-2-R ATcctaggGGTTAATTCCTCCTACTGCAGG

[0149]

[0150] Plasmid pE-FL-3-T7 contains two copies of the bFS gene, as well as one copy of crtE and crtI, and is cloned by restriction enzyme digestion and ligation methods. The strong promoter T7 controls gene expression in this plasmid, and the replicon of the plasmid is the high-copy replicon pBBR3. The plasmid backbone was obtained by amplifying with primers pE-FL-3-T7-F / R using pFZ71 as a template. The target sequence (sequentially linked in the order of AvrII-bFS-crtE-bFS-crtI-SpeI) was obtained by gene synthesis, and then the target plasmid was obtained by restriction enzyme digestion and ligation with the plasmid backbone. The positive clone was verified to be correct by sequencing.

[0151] Primer Sequence (5’-3’) pE-FL-3-T7-F ACTAGTCTCGAgcaccaccaccaccaccac pE-FL-3-T7-R CCTAGGatgtatatctccttcttaaagttaaacaaaatta

[0152]

[0153] Plasmid pE-FL-3-lac contains two copies of the bFS gene, as well as one copy of crtE and crtI, and is cloned by restriction enzyme digestion and ligation. The promoter controlling gene expression in this plasmid is the medium-strength lac promoter, and the replicon of the plasmid is the high-copy pBBR3 replicon. The plasmid backbone was obtained by amplifying with primers pE-FL-3-lac-F / R using pFZ71 as a template. The target sequence (sequentially linked in the order of AvrII-pLac-bFS-crtE-bFS-crtI-SpeI) was obtained by gene synthesis, and then the target plasmid was obtained by restriction enzyme digestion and ligation with the plasmid backbone. The positive clone was verified to be correct by sequencing.

[0154] Primer Sequence (5’-3’) pE-FL-3-lac-F ACTAGTCTCGAgcaccaccaccaccaccac pE-FL-3-lac-R CCTAGGatttcgcgggatcgagatctcg

[0155]

[0156] The plasmids pE-FL-1-T7, pE-FL-2, and pE-FL-3-T7 were transferred into Escherichia coli BL21(DE3) to obtain strain JFL-1.

[0157] The plasmids pE-FL-1-T7, pE-FL-2, and pE-FL-3-T7 were transferred into Escherichia coli MG1655(DE3) to obtain strain JFL-2.

[0158] The plasmids pE-FL-1-lac, pE-FL-2, and pE-FL-3-lac were transferred into probiotic Escherichia coli nissle-1917 to obtain strain JFL-3.

[0159] Example 13 Fermentation of Recombinant Escherichia coli for Co-Synthesis of Farnesene and Lycopene

[0160] The strains were subjected to shake flask fermentation according to the fermentation method in the literature (Zhu F, et al., 2014. In vitro reconstitution of mevalonate pathway and targeted engineering of farnesene overproduction in Escherichia coli. Biotechnol Bioeng. 111(7):1396 - 405.). The results showed that the production of farnesene and lycopene could be detected in strains JFL-1, 2, and 3.

[0161] The yield of farnesene could reach 1.8 g / L and the yield of lycopene could reach 150 mg / L 48 hours after induction of JFL-1.

[0162] The yield of farnesene could reach 2.0 g / L and the yield of lycopene could reach 190 mg / L 48 hours after induction of JFL-2.

[0163] The yield of farnesene could reach 1.2 g / L and the yield of lycopene could reach 125 mg / L 48 hours after induction of JFL-3.

[0164] Example 14 Construction of Recombinant Streptomyces for Co-Synthesis of Farnesene and Lycopene

[0165] Similar to the E. coli modification, overexpress the rate-limiting enzymes DXS (the gene encoding this enzyme has the number ACT42267.1 in the genebank library and is synthesized by optimizing the codons according to Streptomyces) and IDI (the number in the genebank library is ACT44538.1, synthesized by optimizing the codons according to Streptomyces) of the MEP pathway to increase the flux of the MEP pathway. On this basis, introduce ispA, the farnesene synthase gene bFS (the amino acid sequence is the same as that of the farnesene synthase used in the construction of the Saccharomyces cerevisiae strain, and the codons are optimized according to Streptomyces), and the lycopene synthesis genes crtE, crtB, and crtI (the amino acid sequences are the same as those of the lycopene synthesis genes used in the construction of the Saccharomyces cerevisiae strain, and the codons are optimized according to Streptomyces). The optimized sequences of each gene are as follows.

[0166]

[0167] Streptomyces IDI: atgcagaccgagcacgtcatcctgctgaacgcccagggcgtcccgaccggcaccctggagaagtacgccgcccacaccgccgacacccgcctgcacctggccttctcctcctggctgttcaacgccaagggccagctgctggtcacccgccgcgccctgtccaagaaggcctggccgggcgtctggaccaactccgtctgcggccacccccagctgggcgaatccaacgaggacgccgtcatccgccgctgccgctacgagctgggcgtcgaaatcaccccccccgagtccatctaccccgacttccgctaccgcgccaccgacccgtccggcatcgtcgaaaacgaggtctgcccggtcttcgccgcccgcaccacctccgccctgcagatcaacgacgacgaggtcatggactaccagtggtgcgacctggccgacgtcctgcacggcatcgacgccaccccctgggccttctccccgtggatggtcatgcaggccaccaaccgcgaggcccgcaagcgcctgtccgccttcacccagctgaagtga。

[0168] Streptomyces ispA: atggacttcccccagcagctggaggcctgcgtcaagcaggccaaccaggccctgtcccgcttcatcgcccccctgccgttccagaacaccccggtcgtcgagaccatgcagtacggcgccctgctgggcggcaagcgcctgcgcccgttcctggtctacgccaccggccacatgttcggcgtctccaccaacaccctggacgcccccgccgccgccgtcgagtgcatccacgcctactccctgatccacgacgacctgcccgccatggacgacgacgacctgcgccgcggcctgccgacctgccacgtcaagttcggcgaggccaacgccatcctggccggcgacgccctgcagaccctggccttctccatcctgtccgacgccgacatgccggaggtctccgaccgcgaccgcatctccatgatctccgagctggcctccgcctccggcatcgccggcatgtgcggcggccaggccctggacctggacgccgagggcaagcacgtccccctggacgccctggagcgcatccaccgccacaagaccggcgccctgatccgcgccgccgtccgcctgggcgccctgtccgccggcgacaagggccgccgcgccctgccggtcctggacaagtacgccgagtccatcggcctggccttccaggtccaggacgacatcctggacgtcgtcggcgacaccgccaccctgggcaagcgccagggcgccgaccagcagctgggcaagtccacctaccccgccctgctgggcctggagcaggcccgcaagaaggcccgcgacctgatcgacgacgcccgccagtccctgaagcagctggccgagcagtccctggacacctccgccctggaggccctggccgactacatcatccagcgcaacaagtga。

[0169]

[0170] Streptomyces crtE: atgaccgtctgcgccaagaagcacgtccacctgacccgcgacgccgccgaacagctgctggccgacatcgaccgccgcctggaccagctgctgcccgtcgaaggcgagcgcgacgtcgtcggcgccgccatgcgcgagggcgccctggccccgggcaagcgcatccgcccgatgctgctgctgctgaccgcccgcgacctgggctgcgccgtctcccacgacggcctgctggacctggcctgcgccgtcgaaatggtccacgccgcctccctgatcctggacgacatgccctgcatggacgacgccaagctgcgccgcggccgcccgaccatccactcccactacggcgagcacgtcgccatcctggccgccgtcgccctgctgtccaaggccttcggcgtcatcgccgacgccgacggcctgaccccgctggccaagaaccgcgccgtctccgagctgtccaacgccatcggcatgcagggcctggtccagggccagttcaaggacctgtccgagggcgacaagccccgctccgccgaagccatcctgatgaccaaccacttcaagacctccaccctgttctgcgcctccatgcagatggcctccatcgtcgccaacgcctcctccgaggcccgcgactgcctgcaccgcttctccctggacctgggccaggccttccagctgctggacgacctgaccgacggcatgaccgacaccggcaaggactccaaccaggacgccggcaagtccaccctggtcaacctgctgggcccccgcgccgtcgaagagcgcctgcgccagcacctgcagctggcctccgagcacctgtccgccgcctgccagcacggccacgccacccagcacttcatccaggcctggttcgacaagaagctggccgccgtgtcctga。

[0171] crtB - Streptomyces: atgtcccagccgccgctgctggaccacgccacccagaccatggccaacggctccaagtccttcgccaccgccgccaagctgttcgacccggccacccgccgctccgtcctgatgctgtacacctggtgccgccactgcgacgacgtcatcgacgaccagacccacggcttcgcctccgaggccgccgccgaggaggaagccacccagcgcctggcccgcctgcgcaccctgaccctggccgccttcgagggcgccgaaatgcaggaccccgccttcgccgccttccaggaggtcgccctgacccacggcatcaccccgcgcatggccctggaccacctggacggcttcgccatggacgtcgcccagacccgctacgtcaccttcgaggacaccctgcgctactgctaccacgtcgccggcgtcgtcggcctgatgatggcccgcgtcatgggcgtccgcgacgagcgcgtcctggaccgcgcctgcgacctgggcctggccttccagctgaccaacatcgcccgcgacatcatcgacgacgccgccatcgaccgctgctacctgccggccgagtggctgcaggacgccggcctgaccccggaaaactacgccgcccgcgagaaccgcgccgccctggcccgcgtcgccgagcgcctgatcgacgccgccgaaccgtactacatctcctcccaggccggcctgcacgacctgccgccgcgctgcgcctgggccatcgccaccgcccgctccgtctaccgcgagatcggcatcaaggtcaaggccgccggcggctccgcctgggaccgccgccagcacacctccaagggcgagaagatcgccatgctgatggccgccccgggccaggtcatccgcgccaagaccacccgcgtcaccccgcgcccggccggcctgtggcagcgcccggtctga。

[0172]

[0173] Plasmid pS-FL-1 contains one copy of DXS, idi, ispA, and one copy of the bFS gene, one copy of crtE, and one copy of crtI, one copy of crtE, crtB, and crtI, and two copies of bFS. These genes were cloned onto pIB139 using restriction enzyme digestion and ligation methods. The promoter controlling the expression of one copy of DXS, idi, ispA, and one copy of the bFS gene, one copy of crtE, and one copy of crtI is the strong promoter kasOp*. The promoter controlling the expression of one copy of crtE, crtB, crtI, and two copies of bFS is the low-intensity promoter ermE. The plasmid contains the attP site and Int integrase and is resistant to apramycin. Using pIB139 (Wilkinson CJ, Hughes-Thomas ZA, Martin CJ, Bohm I, Mironenko T, Deacon M, et al. Increasing the efficiency of heterologous promoters in actinomycetes. J Mol Microbiol Biotechnol 2002;4:417–26.) as a template, the plasmid backbone was amplified using primers pS-FL-1-F / R. The target sequence (AvrII-kasOp*-DXS-idi-ispA-bFS-crtE-crtI-PermE-crtE-bFS-crtB-crtI-bFS-SpeI in sequence connection, with each sequence as above) was obtained by gene synthesis. Subsequently, the target plasmid was obtained by restriction enzyme digestion and ligation with the plasmid backbone. The positive clones were verified to be correct by sequencing.

[0174] Primer Sequence (5’-3’) pS-FL-1-F ACTAGTcatatgttggggatcctctagag pS-FL-1-R cctaggatgcatactagagtcgacctg

[0175] AvrII-kasOp*-DXS-idi-ispA-bFS-crtE-crtI-PermE-crtE-bFS-crtB-crtI-bFS-SpeI:

[0176] AvrII: cctagg;

[0177] kasOp*: ggaacgatcgttggctgtgttcacattcgaaccgtctctgctttgacaacatgctgtgcggtgttgtaaagtcgtggccaggagaatacgacaggtatctgaaaggggatacgccat;

[0178] PermE: gcgagtgtccgttcgagtggcggcttgcgcccgatgctagtcgcggttgatcggcgatcgcaggtgcacgcggtcgatcttgacggctggcgagaggtgcggggaggatctgaccgacgcggtccacacgtggcaccgcgatgctgttgtgggcacaatcgtgccggttggtaggatcca;

[0179] SpeI: actagt.

[0180] Plasmid pS-FL-2 contains one copy of DXS, idi, ispA, and one copy of the bFS gene, one copy of crtE, and one copy of crtI, one copy of crtE, crtB, crtI, and two copies of bFS. These genes were cloned onto pIB139 using restriction enzyme digestion and ligation methods. The promoter controlling the expression of one copy of DXS, idi, and one copy of the bFS gene, one copy of crtE, and one copy of crtI gene is the strong promoter kasOp*. The promoter controlling the expression of one copy of crtE, crtB, crtI, and two copies of bFS genes is the thiostrepton-inducible promoter TipA. The plasmid contains the attP site and Int integrase and is resistant to apramycin. The plasmid backbone was obtained by amplifying with primers pS-FL-2-F / R using pIB139 as a template. The target sequence (AvrII-kasOp*-DXS-idi-ispA-bFS-crtE-crtI-TipA-crtE-bFS-crtB-crtI-bFS-SpeI in sequence, and each sequence is as above) was obtained by gene synthesis. Subsequently, the target plasmid was obtained by restriction enzyme digestion and ligation with the plasmid backbone. The positive clone was verified to be correct by sequencing.

[0181] Primer Sequence (5’-3’) pS-FL-2-F ACTAGTcatatgttggggatcctctagag pS-FL-2-R cctaggatgcatactagagtcgacctg

[0182] tipA: ccggatcggggatctgggctgagggagccgacggcacgcggcggctcacggcgtggcacgcggaacgtccgggcttgcacctcacgtcacgtgaggaggcagcgtggacggcgtcagagaagggagcggacat.

[0183] The plasmid pS-FL-1 was transferred into Streptomyces albus J1074 by the conjugation method reported in the literature (Tan, Gao-Yi et al. “Heterologous Biosynthesis of Spinosad: An Omics-Guided Large Polyketide Synthase Gene Cluster Reconstitution in Streptomyces.” ACS synthetic biology vol.6, 6(2017):995-1005. doi:10.1021 / acssynbio.6b00330). Positive conjugants were selected for verification, and the successfully verified conjugants were named JS-1.

[0184] The plasmid pS-FL-2 was transferred into Streptomyces albus J1074 by the conjugation method. Positive conjugants were selected for verification, and the successfully verified conjugants were named JS-2.

[0185] Example 15 Fermentation of Recombinant Streptomyces for the Co-Synthesis of Farnesene and Lycopene

[0186] The JS-1 strain was streaked for culture, and seed flask culture was carried out in TSB medium at a culture temperature of 30 °C and a culture rotation speed of 220 rpm. After culturing for two days, it was transferred to a new fermentation medium (beef extract (1%), glycerol (1%), magnesium sulfate heptahydrate (0.2%), sodium chloride (0.2%), soluble starch (3%), yeast extract (0.05%), Difco select soytone (1.5%), dolphin peptone (0.65%), calcium carbonate (0.24%), glucose (4%)) covered with 20% IPM at an inoculation amount of 10%, and continued to be cultured for 8 days before detection. The results showed that the production of farnesene and lycopene could be detected in the strain JS-1. The farnesene yield was 3 g / L, and the lycopene yield was 200 mg / L.

[0187] The JS-2 strain was streaked for culture, and seed flask culture was carried out in TSB medium at a culture temperature of 30 °C and a culture rotation speed of 220 rpm. After culturing for two days, it was transferred to a new fermentation medium covered with 20% IPM at an inoculation amount of 10%, and thiostrepton was added for induction, and continued to be cultured for 8 days before detection. The results showed that the production of farnesene and lycopene could be detected in the strain JS-2. The farnesene yield was 3.8 g / L, and the lycopene yield was 105 mg / L.

[0188] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention. Sequence Listing <110> Wuhan Hesheng Technology Co., Ltd. <120> A recombinant microorganism for producing farnesene and lycopene <160> 4 <170> SIPOSequenceListing 1.0 <210> 1 <211> 574 <212> PRT <213> Chamomile (Matricaria Chamomilla) <400> 1 Met Ser Thr Ile Pro Val Ser Ser Val Ser Ser Ser Ser Ser Ser Ala Ser 1 5 10 15 Pro Leu Val Leu Asp Asp Lys Leu Ser Thr Lys Gln Asp Val Val Arg 20 25 30 His Thr Thr Asn Phe Ser Ala Ser Ile Trp Gly Asp Gln Phe Leu Thr 35 40 45 Tyr His Glu Pro Glu Asp Leu Val Ile Lys Lys Gln Gln Val Glu Gln 50 55 60 Leu Lys Glu Glu Val Lys Lys Glu Leu Met Ala Ile Lys Gly Ser Asn 65 70 75 80 Asp Pro Gln Gln His Ile Lys Leu Met Glu Leu Ile Asp Ser Val Gln 85 90 95 Arg Leu Gly Ile Ala Tyr His Phe Glu Glu Glu Ile Glu Glu Ala Leu 100 105 110 Gln His Ile His Val Thr Tyr Gly Glu His Trp Val Asp Lys Glu Asn 115 120 125 Leu Gln Ser Val Ser Leu Trp Phe Arg Leu Leu Arg Gln Gln Gly Phe 130 135 140 Asn Val Ser Ser Gly Val Phe Lys Asp Tyr Met Asp Glu Lys Gly Asn 145 150 155 160 Phe Lys Glu Ser Leu Cys Asn Asp Ala Gln Gly Ile Leu Ala Leu Tyr 165 170 175 Glu Ala Ala Tyr Met Arg Val Glu Gly Glu Thr Arg Leu Asp Lys Ala 180 185 190 Leu Glu Phe Thr Lys Val His Leu Asp Ile Ile Ser Lys Asp Pro Ser 195 200 205 Cys Asp Ser Tyr Leu Arg Thr Arg Val His Gln Ala Leu Lys Gln Pro 210 215 220 Leu Arg Arg Arg Leu Ala Arg Ile Glu Ala Leu His Tyr Met Pro Val 225 230 235 240 Tyr Gln Gln Asp Ser Ser His Asn Glu Val Leu Leu Lys Leu Ala Lys 245 250 255 Val Asp Phe Ser Val Leu Gln Ser Met His Lys Lys Glu Leu Ser His 260 265 270 Ile Cys Lys Trp Trp Lys Asp Leu Asp Leu Gln Asn Lys Leu Pro Tyr 275 280 285 Val Arg Asp Arg Val Val Glu Gly Tyr Phe Trp Ile Leu Ser Ile Tyr 290 295 300 Tyr Glu Pro Gln His Ala Arg Thr Arg Met Phe Leu Met Lys Ser Cys 305 310 315 320 Met Trp Leu Val Val Leu Asp Asp Thr Phe Asp Asn Tyr Gly Thr Tyr 325 330 335 Glu Glu Leu Glu Ile Phe Ala Gln Ala Val Glu Arg Trp Ser Ile Ser 340 345 350 Cys Met Asp Met Leu Pro Glu Tyr Met Lys Leu Ile Tyr Gln Glu Leu 355 360 365 Val Asn Leu His Val Asp Met Glu Glu Ser Leu Glu Lys Glu Gly Lys 370 375 380 Thr Tyr Gln Ile His Tyr Val Lys Glu Met Ala Lys Glu Leu Val Arg 385 390 395 400 Asn Tyr Leu Val Glu Ala Arg Trp Leu Lys Glu Gly Tyr Met Pro Thr 405 410 415 Leu Glu Glu Tyr Met Ser Val Ser Met Val Thr Gly Thr Tyr Gly Leu 420 425 430 Met Thr Ala Arg Ser Tyr Val Gly Arg Asp Asp Ile Val Thr Glu Asp 435 440 445 Thr Phe Lys Trp Val Ser Ser Tyr Pro Pro Ile Val Lys Ala Ser Cys 450 455 460 Val Ile Val Arg Leu Met Asp Asp Ile Val Ser His Lys Glu Glu Gln 465 470 475 480 Glu Arg Gly His Val Ala Ser Ser Ile Glu Cys Tyr Ser Lys Glu Ser 485 490 495 Gly Ala Thr Glu Glu Glu Ala Cys Glu Tyr Ile Ser Ser Lys Val Glu 500 505 510 Asp Ala Trp Lys Val Ile Asn Arg Glu Ser Leu Arg Pro Thr Ala Val 515 520 525 Pro Phe Pro Leu Leu Met Pro Ala Ile Asn Leu Ala Arg Met Cys Glu 530 535 540 Val Leu Tyr Ser Val Asn Asp Gly Phe Thr His Ala Glu Gly Asp Met 545 550 555 560 Lys Ser Tyr Met Lys Ser Tyr Phe Val His Pro Met Val Ile 565 570 <210> 2 <211> 302 <212> PRT <213> Pantoea ananas <400> 2 Met Thr Val Cys Ala Lys Lys His Val His Leu Thr Arg Asp Ala Ala 1 5 10 15 Glu Gln Leu Leu Ala Asp Ile Asp Arg Arg Leu Asp Gln Leu Leu Pro 20 25 30 Val Glu Gly Glu Arg Asp Val Val Gly Ala Ala Met Arg Glu Gly Ala 35 40 45 Leu Ala Pro Gly Lys Arg Ile Arg Pro Met Leu Leu Leu Leu Thr Ala 50 55 60 Arg Asp Leu Gly Cys Ala Val Ser His Asp Gly Leu Leu Asp Leu Ala 65 70 75 80 Cys Ala Val Glu Met Val His Ala Ala Ser Leu Ile Leu Asp Asp Met 85 90 95 Pro Cys Met Asp Asp Ala Lys Leu Arg Arg Gly Arg Pro Thr Ile His 100 105 110 Ser His Tyr Gly Glu His Val Ala Ile Leu Ala Ala Val Ala Leu Leu 115 120 125 Ser Lys Ala Phe Gly Val Ile Ala Asp Ala Asp Gly Leu Thr Pro Leu 130 135 140 Ala Lys Asn Arg Ala Val Ser Glu Leu Ser Asn Ala Ile Gly Met Gln 145 150 155 160 Gly Leu Val Gln Gly Gln Phe Lys Asp Leu Ser Glu Gly Asp Lys Pro 165 170 175 Arg Ser Ala Glu Ala Ile Leu Met Thr Asn His Phe Lys Thr Ser Thr 180 185 190 Leu Phe Cys Ala Ser Met Gln Met Ala Ser Ile Val Ala Asn Ala Ser 195 200 205 Ser Glu Ala Arg Asp Cys Leu His Arg Phe Ser Leu Asp Leu Gly Gln 210 215 220 Ala Phe Gln Leu Leu Asp Asp Leu Thr Asp Gly Met Thr Asp Thr Gly 225 230 235 240 Lys Asp Ser Asn Gln Asp Ala Gly Lys Ser Thr Leu Val Asn Leu Leu 245 250 255 Gly Pro Arg Ala Val Glu Glu Arg Leu Arg Gln His Leu Gln Leu Ala 260 265 270 Ser Glu His Leu Ser Ala Ala Cys Gln His Gly His Ala Thr Gln His 275 280 285 Phe Ile Gln Ala Trp Phe Asp Lys Lys Leu Ala Ala Val Ser 290 295 300 <210> 3 <211> 309 <212> PRT <213> Pantoea agglomerans <400> 3 Met Ser Gln Pro Pro Leu Leu Asp His Ala Thr Gln Thr Met Ala Asn 1 5 10 15 Gly Ser Lys Ser Phe Ala Thr Ala Ala Lys Leu Phe Asp Pro Ala Thr 20 25 30 Arg Arg Ser Val Leu Met Leu Tyr Thr Trp Cys Arg His Cys Asp Asp 35 40 45 Val Ile Asp Asp Gln Thr His Gly Phe Ala Ser Glu Ala Ala Ala Glu 50 55 60 Glu Glu Ala Thr Gln Arg Leu Ala Arg Leu Arg Thr Leu Thr Leu Ala 65 70 75 80 Ala Phe Glu Gly Ala Glu Met Gln Asp Pro Ala Phe Ala Ala Phe Gln 85 90 95 Glu Val Ala Leu Thr His Gly Ile Thr Pro Arg Met Ala Leu Asp His 100 105 110 Leu Asp Gly Phe Ala Met Asp Val Ala Gln Thr Arg Tyr Val Thr Phe 115 120 125 Glu Asp Thr Leu Arg Tyr Cys Tyr His Val Ala Gly Val Val Gly Leu 130 135 140 Met Met Ala Arg Val Met Gly Val Arg Asp Glu Arg Val Leu Asp Arg 145 150 155 160 Ala Cys Asp Leu Gly Leu Ala Phe Gln Leu Thr Asn Ile Ala Arg Asp 165 170 175 Ile Ile Asp Asp Ala Ala Ile Asp Arg Cys Tyr Leu Pro Ala Glu Trp 180 185 190 Leu Gln Asp Ala Gly Leu Thr Pro Glu Asn Tyr Ala Ala Arg Glu Asn 195 200 205 Arg Ala Ala Leu Ala Arg Val Ala Glu Arg Leu Ile Asp Ala Ala Glu 210 215 220 Pro Tyr Tyr Ile Ser Ser Gln Ala Gly Leu His Asp Leu Pro Pro Arg 225 230 235 240 Cys Ala Trp Ala Ile Ala Thr Ala Arg Ser Val Tyr Arg Glu Ile Gly 245 250 255 Ile Lys Val Lys Ala Ala Gly Gly Ser Ala Trp Asp Arg Arg Gln His 260 265 270 Thr Ser Lys Gly Glu Lys Ile Ala Met Leu Met Ala Ala Pro Gly Gln 275 280 285 Val Ile Arg Ala Lys Thr Thr Arg Val Thr Pro Arg Pro Ala Gly Leu 290 295 300 Trp Gln Arg Pro Val 305 <210> 4 <211> 582 <212> PRT <213> Blakeslea trispora <400> 4 Met Ser Asp Gln Lys Lys His Ile Val Val Ile Gly Ala Gly Ile Gly 1 5 10 15 Gly Thr Ala Thr Ala Ala Arg Leu Ala Arg Glu Gly Phe Arg Val Thr 20 25 30 Val Val Glu Lys Asn Asp Phe Ser Gly Gly Arg Cys Ser Phe Ile His 35 40 45 His Asp Gly His Arg Phe Asp Gln Gly Pro Ser Leu Tyr Leu Met Pro 50 55 60 Lys Leu Phe Glu Asp Ala Phe Ala Asp Leu Asp Glu Arg Ile Gly Asp 65 70 75 80 His Leu Asp Leu Leu Arg Cys Asp Asn Asn Tyr Lys Val His Phe Asp 85 90 95 Asp Gly Asp Ala Val Gln Leu Ser Ser Asp Leu Thr Lys Met Lys Gly 100 105 110 Glu Leu Asp Arg Ile Glu Gly Pro Leu Gly Phe Gly Arg Phe Leu Asp 115 120 125 Phe Met Lys Glu Thr His Val His Tyr Glu Gln Gly Thr Phe Ile Ala 130 135 140 Ile Lys Arg Asn Phe Glu Thr Ile Trp Asp Leu Ile Arg Leu Gln Tyr 145 150 155 160 Val Pro Glu Ile Phe Arg Leu His Leu Phe Gly Lys Ile Tyr Asp Arg 165 170 175 Ala Ser Lys Tyr Phe Gln Thr Lys Lys Met Arg Met Ala Phe Thr Phe 180 185 190 Gln Thr Met Tyr Met Gly Met Ser Pro Tyr Asp Ala Pro Ala Val Tyr 195 200 205 Ser Leu Leu Gln Tyr Thr Glu Phe Ala Glu Gly Ile Trp Tyr Pro Arg 210 215 220 Gly Gly Phe Asn Met Val Val Gln Lys Leu Glu Ser Ile Ala Ser Lys 225 230 235 240 Lys Tyr Gly Ala Glu Phe Arg Tyr Gln Ser Pro Val Ala Lys Ile Asn 245 250 255 Thr Val Asp Lys Asp Lys Arg Val Thr Gly Val Thr Leu Glu Ser Gly 260 265 270 Glu Val Ile Glu Ala Asp Ala Val Val Cys Asn Ala Asp Leu Val Tyr 275 280 285 Ala Tyr His His Leu Leu Pro Pro Cys Asn Trp Thr Lys Lys Thr Leu 290 295 300 Ala Ser Lys Lys Leu Thr Ser Ser Ser Ile Ser Phe Tyr Trp Ser Met 305 310 315 320 Ser Thr Lys Val Pro Gln Leu Asp Val His Asn Ile Phe Leu Ala Glu 325 330 335 Ala Tyr Lys Glu Ser Phe Asp Glu Ile Phe Asn Asp Phe Gly Leu Pro 340 345 350 Ser Glu Ala Ser Phe Tyr Val Asn Val Pro Ser Arg Ile Asp Glu Ser 355 360 365 Ala Ala Pro Pro Asn Lys Asp Ser Ile Ile Val Leu Val Pro Ile Gly 370 375 380 His Met Lys Ser Lys Thr Gly Asn Ser Ala Glu Glu Asn Tyr Pro Glu 385 390 395 400 Leu Val Asn Arg Ala Arg Lys Met Val Leu Glu Val Ile Glu Arg Arg 405 410 415 Leu Gly Val Asn Asn Phe Ala Asn Leu Ile Glu His Glu Glu Val Asn 420 425 430 Asp Pro Ser Val Trp Gln Ser Lys Phe Asn Leu Trp Arg Gly Ser Ile 435 440 445 Leu Gly Leu Ser His Asp Val Phe Gln Val Leu Trp Phe Arg Pro Ser 450 455 460 Thr Lys Asp Ser Thr Asn Arg Tyr Asp Asn Leu Phe Phe Val Gly Ala 465 470 475 480 Ser Thr His Pro Gly Thr Gly Val Pro Ile Val Leu Ala Gly Ser Lys 485 490 495 Leu Thr Ser Asp Gln Val Cys Lys Ser Phe Gly Gln Asn Pro Leu Pro 500 505 510 Arg Lys Leu Gln Asp Ser Gln Lys Lys Tyr Ala Pro Glu Gln Thr Arg 515 520 525 Lys Thr Glu Ser His Trp Ile Tyr Tyr Cys Leu Ala Cys Tyr Phe Val 530 535 540 Thr Phe Leu Phe Phe Tyr Phe Phe Pro Arg Asp Asp Thr Thr Thr Pro 545 550 555 560 Ala Ser Phe Ile Asn Gln Leu Leu Pro Asn Val Phe Gln Gly Gln Asn 565 570 575 Ser Asn Asp Ile Arg Ile 580

Claims

1. A recombinant microorganism for producing farnesene and lycopene, characterized in that: It contains MVA pathway genes or MEP pathway genes, farnesene synthesis genes, and lycopene synthesis genes; The recombinant microorganism uses Saccharomyces cerevisiae, Escherichia coli, or Streptomyces as the host; When the recombinant microorganism uses Saccharomyces cerevisiae as the host, it is constructed by transferring the lycopene synthesis genes crtE, crtB, and crtI into a strain with high farnesene production. The strain with high farnesene production is: based on Saccharomyces cerevisiae CEN.PK2-1D, containing 5 coding genes of β-farnesene synthase shown in SEQ ID NO.1, containing additional MVA pathway genes ERG10, ERG13, tHMG1, ERG12, ERG8, MVD1, IDI1, and an additional ERG20 gene, and an additional tHMG1 gene; Or when the recombinant microorganism uses Escherichia coli as the host, it contains an additional 1 copy of DXS, idi, and ispA, 5 copies of the coding genes of β-farnesene synthase shown in SEQ ID NO.1, 1 copy of crtB, and 2 copies of crtE and crtI; Or when the recombinant microorganism uses Streptomyces as the host, it contains an additional 1 copy of DXS, idi, and ispA, 3 copies of the coding genes of β-farnesene synthase shown in SEQ ID NO.1, 1 copy of crtB, and 2 copies of crtE and crtI; Among them, the amino acid sequence of the GGPP synthase encoded by crtE is as shown in SEQ ID NO.2, the amino acid sequence of the phytoene synthase encoded by crtB is as shown in SEQ ID NO.3, and the amino acid sequence of the phytoene desaturase encoded by crtI is as shown in SEQ ID NO.4; The Accession / GENE id of ERG10, ERG13, tHMG1, ERG12, ERG8, MVD1, IDI1, and ERG20 in NCBI is shown in the following table. The numbers of the proteins encoded by DXS, idi, and ispA in the genebank database are ACT42267.1, ACT44538.1, and NP_414955.1, respectively.

2. The recombinant microorganism for producing farnesene and lycopene according to claim 1, characterized in that: One or more of the MVA pathway genes, farnesene synthesis genes, and lycopene synthesis genes exist in the recombinant microorganism in the form of a plasmid vector or are integrated into the genome of the recombinant microorganism.

3. The recombinant microorganism for producing farnesene and lycopene according to claim 1, wherein: The farnesene synthesis genes and lycopene synthesis genes are controlled by different promoters for expression.

4. The recombinant microorganism for producing farnesene and lycopene according to claim 3, characterized in that: The lycopene synthesis genes are controlled by an inducible promoter for expression.

5. The recombinant microorganism for producing farnesene and lycopene according to claim 1, wherein: When the recombinant microorganism is Saccharomyces cerevisiae, the GAL80 gene is knocked out.

6. Use of the recombinant microorganism for producing farnesene and lycopene according to any one of claims 1-5 in the production of farnesene and lycopene.

7. A method for producing farnesene and lycopene using the recombinant microorganism for producing farnesene and lycopene according to any one of claims 1 - 5, characterized in that: It includes the following steps: inoculating the recombinant microorganism into a fermentation medium for fermentation to obtain a culture product containing farnesene and lycopene.

8. The method according to claim 7, characterized in that: When the lycopene synthesis gene of the recombinant microorganism is controlled by an inducible promoter, the method for producing farnesene and lycopene comprises the following steps: inoculating the recombinant microorganism into a fermentation medium for fermentation, and after the farnesene yield reaches the highest level, adjusting the fermentation conditions to meet the induction conditions of the inducible promoter and then continuing the fermentation to obtain a culture product containing farnesene and lycopene.

Citation Information

Patent Citations

  • Recombinant microorganism and construction method thereof, and method for obtaining alpha-farnesene

    CN111019850A

  • Bacterial strain for producing lycopene and application of bacterial strain

    CN103243066A

  • Biological methods for preparing terpenes

    US20210079408A1