A genetically engineered bacterium with high yield of l-cysteine, a construction method and application thereof

Abstract

The present application relates to a kind of genetically engineered bacteria of high-yield L-cysteine, construction method, and its application in the microbial fermentation preparation L-cysteine in L-cysteine. The present application is integrated by Esa quorum sensing system and lactose operon system, constructs a multifunctional QSI dynamic regulation system, realizes the coupling of target gene expression and cell growth, and is applied to the biosynthesis of L-cysteine, and obtains a high-yield L-cysteine of escherichia coli gene engineering strain. In addition, the QSI dynamic control system constructed in the present application dynamically controls lactose operon system using quorum sensing system, replaces the addition of traditional inducer IPTG, effectively saves the cost of industrial production and reduces the toxicity influence of inducer IPTG to cell, and has good production application value.

Description

(I) Technical Field

[0001] This invention belongs to the field of metabolic engineering, specifically relating to a genetically engineered bacterium that produces high levels of L-cysteine, its construction method, and its application in the microbial fermentation preparation of L-cysteine. (II) Background Technology

[0002] L-cysteine ​​(L-Cys) is a common sulfur donor in organisms, and its L-form possesses biological activity. L-Cys is an important component of methionine, thiamine, and glutathione, all common substances in organisms. L-Cys plays a crucial role in protein folding, assembly, and signal transduction through disulfide bond formation and protein persulfation. Furthermore, L-Cys protects cells under oxidative stress. As an important amino acid in organisms, L-Cys has wide applications in the pharmaceutical, food, cosmetic, and animal feed industries. For example, L-cysteine-derived drugs have antitussive, antipyretic, anti-inflammatory, expectorant, and antibacterial effects, and can also prevent and treat skin diseases and mitigate the damage caused by chemotherapy. L-Cys is also widely used as a food additive, such as a bread additive, flavor enhancer, and colorant.

[0003] Compared to the cumbersome steps and environmental pollution associated with industrial methods of L-Cys production, microbial fermentation has become a promising production technology. However, due to the cytotoxicity of L-Cys and its physicochemical properties, such as reducing iron and driving Fenton chemistry, bacteria strictly regulate their cytoplasmic levels, resulting in very low levels of primitive L-Cys accumulation in wild-type E. coli. Therefore, microbial fermentation still faces significant challenges. The biosynthetic pathways and regulatory mechanisms of L-Cys have been extensively studied. Therefore, modifying L-Cys-producing strains using biotechnology such as genetic engineering and metabolic engineering to reduce L-Cys toxicity and increase the flux of L-Cys metabolic pathways is an effective strategy for obtaining high-yielding L-Cys strains.

[0004] Metabolic engineering controls microbial cellular metabolism to maximize the production of value-added products, but it can also lead to imbalances in cellular metabolic networks, thereby reducing productivity and yield. Metabolic fluxes can be rebalanced through dynamic regulation, and quorum sensing (QS) systems are considered autoinducible systems regulated by cell density. Specific signaling molecules accumulate in cells, inducing the activation of QS circuits, which can be used to dynamically regulate the expression of target genes. Quorum sensing controls cell density-dependent processes in bacteria and has been applied to induce recombinant protein expression, control lysine residues, and balance multiple cell populations. The Esa quorum sensing system has been used to downregulate competing metabolic pathways and control lacI expression. The small molecule AHL is produced by the AHL synthase EsaI. At low AHL concentration levels, the transcriptional regulator EsaR can interact with the promoter P esaS EsaR binds to and activates the transcription of AHL. As cells grow, AHL gradually accumulates, and EsaR can bind to AHL to form a complex. The formation of this complex leads to the loss of EsaR's activation of the PesaS promoter, thus preventing the transcription of the PesaS promoter and resulting in downregulation of its expression level.

[0005] In many engineered strains, promoter P Trc It is typically used to drive gene overexpression. P Trc It is a common heterozygous promoter whose transcription is repressed by the LacI protein. Under IPTG induction, the repressor protein LacI can bind to IPTG to form a complex, preventing further binding with P. Trc The lactose operon binding site on the promoter binds, thereby leading to P Trc Transcription by the promoter. However, using inducers for gene expression also has some drawbacks. For example, in large-scale industrial production, the cost of using inducers is high, and such induction is irreversible; once added, it remains in the medium for a long time, only providing a single-use control effect. Furthermore, regularly monitoring cell growth to determine the optimal induction time is cumbersome. These drawbacks pose certain obstacles to the industrialization of traditional synthetic biology. (III) Summary of the Invention

[0006] To address the aforementioned issues, this patent constructs a QSI dynamic regulation system and applies it to an engineered strain of Escherichia coli that produces L-cysteine, resulting in a genetically engineered bacterium that produces high levels of L-cysteine.

[0007] To achieve the above-mentioned objectives of this invention, the technical solution adopted by this invention is as follows:

[0008] A genetically engineered bacterium that produces high levels of L-cysteine ​​was constructed using the following method:

[0009] (1) Using strain E. coil W3110 as the chassis strain, the lacI gene in its genome was replaced with the transcriptional regulator esaR. I70V And AHL synthase esaI, in the esaR gene I70V Add a terminator T afterward lpd Add a terminator T after the esaI gene rpoC The strain E. coil W3110::esaR was obtained. I70V ::esaIΔlacI;

[0010] (2) The strain E. coil W3110::esaR I70V The promoters of the cysM and nrdH genes of ::esaIΔlacI are replaced with P Trc Promoter, obtained strain E. coilW3110EYC::esaR I70V ::esaI::cysM::nrdHΔlacI;

[0011] (3) Plasmid pTrc99a-P Trc The promoter of the lacI gene on -cysE-ydeD-serC-cysB is replaced with P. esaS Furthermore, an LAA degradation tag was added before the stop codon of the lacI gene to construct the fermentation plasmid pTrc99a-P. esaS -lacI(LAA)-P Trc -cysE-ydeD-serC-cysB, which is introduced into the strain obtained in step (2), yields E.coilW3110::esaR I70V ::esaI::P Trc -cysM::P Trc -nrdHΔlacI / pTrc99a-P esaS -lacI(LAA)-P Trc -cysE-ydeD-serC-cysB is the genetically engineered bacterium that produces high levels of L-cysteine.

[0012] The strain constructed in this invention can dynamically activate P-receptor cells based on its own cell density. TrcThe expression of target genes under promoter control achieves the following objectives: In the early stage of cell growth, when cell density is low, the expression of genes involved in L-cysteine ​​synthesis, controlled by the QSI system, is suppressed, and the cellular metabolic flux is mainly used for cell growth; as the cells grow and cell density increases, the expression of genes involved in L-cysteine ​​synthesis, controlled by the QSI system, is gradually activated, and fermentation begins to enter the production stage, thereby achieving dynamic separation of cell growth and product generation. This dynamic regulation strategy has a positive impact on the performance of engineered strains that produce toxic compounds.

[0013] The transcriptional regulator esaR I70V The sequence is shown in SEQ ID NO.1, and the sequence of the AHL synthase esaI is shown in SEQ ID NO.2. Specifically, the promoter P... esaS The sequence is shown in SEQ ID NO.3, the sequence of the degradation tag LAA is shown in SEQ ID NO.4, and the terminator T rpoC The sequence is shown in SEQ ID NO.5, T lpd The sequence of the terminator is shown in SEQ ID NO.6.

[0014] The present invention also relates to a method for constructing the genetically engineered bacterium that produces high levels of L-cysteine, the method being as follows:

[0015] (1) Using strain E. coil W3110 as the chassis strain, CRISPR-Cas9 gene editing technology was applied to replace the lacI gene in its genome with the transcriptional regulator esaR. I70V And AHL synthase esaI, in the esaR gene I70V Add a terminator T afterward lpd Add a terminator T after the esaI gene rpoC The strain E. coil W3110::esaR was obtained. I70V ::esaIΔlacI;

[0016] (2) Using CRISPR-Cas9 gene editing technology, strain E. coil W3110::esaR I70V The promoters of the cysM and nrdH genes of ::esaIΔlacI are replaced with P Trc Promoter, obtained strain E. coilW3110EYC::esaR I70V ::esaI::cysM::nrdHΔlacI;

[0017] (3) Plasmid pTrc99a-P TrcThe promoter of the lacI gene on -cysE-ydeD-serC-cysB is replaced with P. esaS Furthermore, an LAA degradation tag was added before the stop codon of the lacI gene to construct the fermentation plasmid pTrc99a-P. esaS -lacI(LAA)-P Trc -cysE-ydeD-serC-cysB, which is introduced into the strain obtained in step (2), yields E.coilW3110::esaR I70V ::esaI::P Trc -cysM::P Trc -nrdHΔlacI / pTrc99a-P esaS -lacI(LAA)-P Trc -cysE-ydeD-serC-cysB is the genetically engineered bacterium that produces high levels of L-cysteine.

[0018] The transcriptional regulator esaR I70V The sequence of the AHL synthase esaI is shown in SEQ ID NO.1, and the sequence of the AHL synthase esaI is shown in SEQ ID NO.2.

[0019] Specifically, the promoter P esaS The sequence is shown in SEQ ID NO.3, the sequence of the degradation tag LAA is shown in SEQ ID NO.4, and the terminator T rpoC The sequence is shown in SEQ ID NO.5, T lpd The sequence of the terminator is shown in SEQ ID NO.6.

[0020] This invention also relates to the application of the genetically engineered bacteria in the microbial fermentation preparation of L-cysteine.

[0021] Specifically, the application involves inoculating the genetically engineered bacteria into a fermentation medium and fermenting it at 26–37°C and 200–800 rpm for 60–72 hours. After fermentation, the supernatant of the fermentation broth is taken and purified to obtain L-cysteine.

[0022] The fermentation medium consists of the following components: 30 g / L glucose, 10 g / L (NH4)2SO4, 1 g / L KH2PO4, 10 g / L Na2S2O3, 5 g / L yeast extract, 1 g / L Na2HPO4, 1 g / L peptone, and 1 ml / L trace element solution in deionized water at a natural pH. The trace element solution consists of: 0.15 g / L Na2MoO4·2H2O, 2.5 g / L H3BO3, 0.7 g / L CoCl2·6H2O, 0.25 g / L CuSO4·5H2O, 1.6 g / L MnCl2·4H2O, and 0.3 g / L ZnSO4·7H2O in deionized water.

[0023] Before fermentation, the genetically engineered bacteria are usually inoculated into 10 ml LB medium test tubes and cultured on a shaker at 37°C and 180 rpm for 12 h. Then, they are inoculated into 100 ml of secondary seed culture fermentation medium at a volume concentration of 1% and cultured on a shaker at 30°C and 180 rpm for 12 h. Finally, they are inoculated into the fermentation medium of the fermenter at a volume concentration of 10% and cultured.

[0024] The beneficial effects of this invention are mainly reflected in the following aspects: By integrating the Esa quorum sensing system and the lactose operon system, a multifunctional QSI dynamic regulation system was constructed, realizing the coupling of target gene expression and cell growth. This system was then applied to the biosynthesis of L-cysteine, resulting in a high-yield L-cysteine-producing *E. coli* genetically engineered strain. Furthermore, the QSI dynamic control system constructed in this invention utilizes the quorum sensing system to dynamically control the lactose operon system, replacing the traditional addition of the inducer IPTG. This effectively saves on industrial production costs and reduces the toxic effects of IPTG on cells, demonstrating significant value for production applications. (iv) Description of the attached drawings

[0025] Figure 1 For Example 2, strain E. coil W3110::esaR was constructed. I70V ::esaIΔlacI / pTrc99a-P esaS -eGFP OD 600 and fluorescence intensity change curve;

[0026] Figure 2 For Example 3, strain E. coil W3110::esaR was constructed. I70V ::esaIΔlacI / pTrc99a-P esaS OD of -eGFP(LVA) 600 and fluorescence intensity change curve;

[0027] Figure 3 For Example 4, strain E. coil W3110::esaR was constructed. I70V ::esaIΔlacI / pTrc99a-P esaS -lacI(LAA)-T lpd -P esaS -eGFP(LVA)-T rpoC -P Trc -mCherry and E.coil W3110::esaR I70V ::esaIΔlacI / pTrc99a-ΔlacI-P esaS -eGFP(LVA)-T rpoC -P Trc -mCherry's OD 600 and fluorescence intensity change curve;

[0028] Figure 4 The engineered bacterium E. coil W3110EYC / pTrc99a-P constructed in Example 5 Trc -cysE-ydeD-serC-cysB and E.coil W3110EYC::esaR I70V ::esaIΔlacI / pTrc99a-P esaS -lacI(LAA)-P Trc -cysE-ydeD-serC-cysB's OD 600 and the L-cysteine ​​content in the fermentation broth supernatant;

[0029] Figure 5 For Example 6, an engineered bacterium E. coil W3110EYC::esaR was constructed. I70V ::esaI::cysMΔlacI / pTrc99a-P esaS -lacI(LAA)-P Trc -cysE-ydeD-serC-cysB's OD 600 and the L-cysteine ​​content in the fermentation broth supernatant;

[0030] Figure 6 For Example 7, an engineered bacterium E. coil W3110EYC::esaR was constructed. I70V ::esaI::cysM::nrdHΔlacI / pTrc99a-P esaS -lacI(LAA)-P Trc -cysE-ydeD-serC-cysB's OD 600 And the L-cysteine ​​content in the supernatant of the fermentation broth. (V) Detailed Implementation

[0031] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto:

[0032] The parent strain of this invention, E. coli W310 EYC, was obtained from the China Center for Type Culture Collection (CCTCCNO: M 20191026) and has been disclosed in CN 111019877A.

[0033] The strain E. coli W3110 was deposited at the Coli Genetic Stock Center (CGSC) of Yale University on August 5, 1975, with accession number CGSC#4474, and has been disclosed in patents US 2009 / 0298135A1 and US2010 / 0248311A1.

[0034] In the examples, the final concentration of kanamycin in the culture medium was 0.05 g / L, the final concentration of spectinomycin in the culture medium was 0.05 g / L, and the final concentration of ampicillin in the culture medium was 0.1 g / L.

[0035] LB medium composition: 10 g / L peptone, 5 g / L yeast extract, 5 g / L sodium chloride, solvent: deionized water, pH: natural. LB solid medium is LB liquid medium with 2 g / L agar powder added to the final concentration.

[0036] Example 1: Determination of L-cysteine ​​content

[0037] (1) Fermentation broth treatment: Take 1 mL of bacterial culture into a 2 mL EP tube, centrifuge at 12000 rpm for 1 min, and separate the supernatant and precipitate. The supernatant is used for the detection of L-cysteine ​​and other metabolites.

[0038] (2) Derivatization reaction system: Weigh 0.27 g of 4-chloro-3,5,-dinitrotrifluorotoluene (1,3-Dinitro-2-chloro-5-trifluoromethylbenzene, CNBF) and dissolve it in 10 mL of HPLC-grade pure acetonitrile as solution I; use 0.2 M boric acid solution and 0.05 M borax solution as mother solutions, mix them in a 4:1 volume ratio to prepare a standard buffer solution with pH = 9.0, denoted as solution II. Dilute the sample to a concentration of 0 to 5 g / L, and mix them at a ratio of 100 μL sample, 300 μL solution I, and 500 μL solution II. React the mixture in a constant temperature shaker at 60 °C and 600 rpm for 1 h. After the reaction is complete, filter the sample through a membrane and place it in an HPLC bottle for analysis.

[0039] (3) Liquid chromatography: The instrument used was a Thermo Fisher UPLC (ultra-high pressure liquid chromatograph). The column was a C18 column (4.6 × 250 mm, 5 μm); the UV detector wavelength was 260 nm; the injection volume was 10 μL; the column temperature was 30℃; the flow rate was 0.8 mL / min; the mobile phase consisted of two phases, A and B. Phase A was pure acetonitrile, and phase B was 50 mM HAc-NaAc buffer: acetonitrile: triethylamine = 82.8:17:0.2, pH = 4.9. The gradient elution program is shown in Table 1.

[0040] Table 1: Gradient elution procedure

[0041]

[0042]

[0043] Example 2: Construction of the Esa swarm sensing system

[0044] Using E. coli W3110 as the starting strain, CRISPR-Cas9-mediated gene editing technology was used to replace the lacI gene in its genome with the transcriptional regulator esaR. I70V And AHL synthase esaI.

[0045] (1) Construction of pTarget plasmid: Using pTarget F plasmid (Addgene Plasmid#62226) as a template, PCR amplification was performed using QSIpT TB F and QSI pT TB R as primers. The PCR product was digested with DpnI. The digested product was transferred into E. coli DH5α, plated on spectinomycin (SD) plates, and single colonies were picked and sequenced using validation primers PTD YZ F and PTD YZ R to screen for successfully mutated pTarget-QSI plasmids. Using pTarget-QSI plasmid as a template, the plasmid pTarget-QSI was linearized using primers pTline F and pTline R.

[0046] (2) Construction of pTD plasmid: Using the E. coli W3110 genome as a template, the upstream homologous arm Donor-up was amplified using QSI up F and QSI up R as primers; the downstream homologous arm Donor-down was amplified using QSI down F and QSI down R as primers; using plasmid pTrc99a as a template, the terminator rrnBT12 fragment Donor-rrnBT12 was amplified using QSI rrnBT12 F and QSI rrnBT12 R as primers.

[0047] The DNA fragment esaI was obtained through gene synthesis. The esaI gene sequence is shown in SEQ ID NO.2. Using the esaI fragment as a template, and QSI esaI F and QSI esaI R as primers, the esaI fragment Donor-esaI was amplified. The esaI promoter apFAB296 and RBS apFAB700 were designed on primers QSI rrnBT12 R and QSI esaI F, and the esaI terminator T... rpoC Designed on primer QSI esaR F); DNA fragment esaR was obtained through gene synthesis. I70V Gene esaR I70V The sequence is shown in SEQ ID NO.1. The fragment esaR... I70V Using QSI esaR F and QSI esaR R as templates, esaR was amplified to obtain the desired amplification. I70V Donor-esaR clip I70V (gene esaR) I70V promoter P esaR (apFAB104), RBS was designed on primers QSIesaI R and QSIesaR F, gene esaR I70V Termination T lpd The primers were designed on QSI esaR R and QSI down F. PCR products were detected and purified by 1.0% agarose gel electrophoresis. The five recovered DNA fragments were Donor-up, Donor-down, Donor-rrnBT12, Donor-esaI, and Donor-esaR. I70V The Donor fragment was fused into a complete fragment using fusion PCR in the order described above. The fragment was detected by 1.0% agarose gel electrophoresis and purified by gel extraction. Following the instructions of the Onestep Cloning Kit (Vazyme Biotech, Nanjing, China), the linearized pTarget-QSI plasmid was ligated to the Donor fragment, transformed into E. coli DH5α, plated on SD plates, and single colonies were picked and sequenced using validation primers PTD YZ F and PTD YZ R to verify and screen for successfully cloned pTD-QSI plasmids.

[0048] (3) Preparation of electrocompetent cells: The pCas plasmid (Addgene Plasmid #62225) was introduced into E. coli W3110. For detailed procedures, please refer to the description in (Molecular Cloning: A Laboratory Manual, 3rd Edition, 99-102). Single clones were selected and placed into 10 ml LB tubes containing 0.05 g / L kanamycin and cultured overnight at 30°C. Then, 1% (v / v) inoculum was added to 250 ml shake flasks containing 50 ml LB medium, and 500 μl of 1 mol / L L-arabinose was added. The flasks were cultured at 150 rpm and 30°C until OD reached the target cell count. 600 Cells were collected by centrifugation at 4000 rpm and 4°C for 10 min to prepare electrocompetent cells. For detailed procedures, please refer to the description in (Molecular Cloning: A Laboratory Manual, 3rd Edition, 99-102).

[0049] (4) Electroporation transformation: 150 ng of pTD-QSI plasmid was slowly mixed with 200 μl of E. coli W3110 electroporation competent cells and transferred to a pre-cooled 2 mm electroporation cuvette. After incubation on ice for about 1 min, electroporation transformation was performed using a MicroPluser™ (BIO-RAD) electroporator. Immediately after electroporation, 1 mL of LB medium was added and gently aspirated, then transferred to a 1.5 mL centrifuge tube. After recovery at 30°C for 2–3 h, the cells were plated on LB agar plates containing 0.05 g / L kanamycin and 0.05 mg / L spectinomycin. The plates were incubated upside down at 30°C for 18–20 h. Colony PCR verification was performed using QSI VF and QSI VR as genomic verification primers to screen E. coli W3110::esaI::esaR cells. I70V ΔlacI positive colonies.

[0050] (5) Elimination of pTD and pCas plasmids: Select positive single colonies and inoculate them into LB tubes containing 1 mM IPTG and 0.05 g / L kanamycin. Incubate overnight at 30°C. Streak the bacterial culture onto LB plates containing 0.05 mg / L kanamycin and incubate at 30°C for 24 h. Select single colonies and lightly spot them onto LB plates containing 0.05 g / L kanamycin for preservation. Streak them onto LB plates containing 0.05 g / L spectinomycin for verification. Single colonies that cannot grow on LB plates containing 0.05 g / L spectinomycin have successfully eliminated the pTD-QSI plasmid. Single colonies successfully eliminated from the pTD-QSI plasmid were picked and placed in LB tubes and incubated overnight at 37°C. The next day, the bacterial culture was streaked onto LB agar plates and incubated at 37°C for 12 hours. Single colonies were then lightly spotted onto antibiotic-free LB agar plates for preservation and streaked onto LB agar plates containing 0.05 g / L kanamycin. Single colonies that could not be streaked onto LB agar plates containing 0.05 g / L kanamycin had their pCas plasmid successfully eliminated, resulting in the plasmid-free strain *E. coilW3110::esaI::esaR*. I70V ΔlacI.

[0051] (6) Construct pTrc99a-P esaS -eGFP plasmid: DNA fragment P obtained through gene synthesis esaS Promoter P esaS The sequence is shown in SEQ ID NO.3. Fragment P... esaS For template, pR1 P esaS F and pR1 P esaS R is a primer, and Donor-P is obtained through amplification. esaS The eGFP fragment was amplified using pET28a-eGFP plasmid as a template and pR1 eGFP F and pR1 eGFP R as primers. Linearized pTrc99a was amplified using pTrc99a as a template and pR1 pline F and pR1 pline R as primers. The PCR products were detected and purified by 1.0% agarose gel electrophoresis. The two recovered DNA fragments were fused into a single complete pTrc99a fragment by fusion PCR. esaS -eGFP fragment. The fragment was detected by 1.0% agarose gel electrophoresis and purified by gel excision. The linearized pTrc99a plasmid was then cloned with the target fragment using a one-step cloning kit. esaS -eGFP ligation was performed, and the cells were transformed into E. coli DH5α. The cells were plated on Amp plates, and single colonies were picked and sequenced using validation primers pR1 VF and pR1 VR to screen for successfully cloned pTrc99a-P. esaS -eGFP plasmid.

[0052] (7) Importing and validation plasmid: Preparation of E.coilW3110::esaI::esaRI70V The ΔlacI chemical transformation of competent cells was described in detail in (Molecular Cloning: A Laboratory Manual, 3rd Edition, pp. 99-102). The constructed plasmid pTrc99a-P esaS -eGFP-introduced strain E.coilW3110::esaI::esaR I70V ΔlacI, yielding E.coilW3110::esaI::esaR I70V ΔlacI / pTrc99a-P esaS -eGFP.

[0053] (8) Fluorescence detection: E. coil W3110::esaI::esaR I70V ΔlacI / pTrc99a-P esaS Single colonies of -eGFP were picked and inoculated into 5 mL of LB medium and incubated overnight at 37°C and 200 rpm. The next day, the culture was transferred to 10 mL of LB medium and incubated at 37°C and 200 rpm for 12 h. 1 mL of the pre-culture was then inoculated into a 500 mL shake flask containing 50 mL of SM medium and fermented at 30°C and 220 rpm. During fermentation, 1 mL of the bacterial suspension was collected every 2 h into an EP tube and centrifuged at 12000 × g for 1 min to separate the supernatant and precipitate. The suspension was reselected twice with PBS solution, and the suspension was used to detect bacterial OD. 600 Simultaneously, 200 μl of the suspension was added to a 96-well plate (Cell Culture Plate, Shanghai Wohong Biotechnology C., Ltd.) for eGFP fluorescence detection; the excitation wavelength was 488 nm; the emission wavelength was 520 nm, and the OD value was [missing value]. 600 And the fluorescence intensity change curve as shown Figure 1 As shown.

[0054] The sequence of the promoter apFAB296 is shown in SEQ ID NO.7, the sequence of the RBS apFAB700 is shown in SEQ ID NO.8, the sequence of the promoter apFAB104 is shown in SEQ ID NO.9, and the sequence of the terminator rrnBT12 is shown in SEQ ID NO.10.

[0055] from Figure 1 The changes in light intensity of the strains indicate that heterologous expression of genes esaRI70V and esaI in E. coli can promote the promoter P esaSTranscription of P. However, as cell density increases, the intensity of the green fluorescent protein decreases to almost nothing. A possible reason for this phenomenon is that while increased cell density inhibits P... esaS Transcription of the promoter, but at low cell density, P esaS The fluorescent protein expressed by the promoter remains within the cell. Green fluorescent protein has a long half-life, resulting in limited gene downregulation. Therefore, shortening the half-life of the target protein is necessary to achieve downregulation of the target gene's expression level.

[0056] Table 2: Primers for Example 2

[0057]

[0058]

[0059] Example 3: Plasmid pTrc99a-P esaS Adding the degradation tag LVA to the C-terminus of eGFP yields the reporter plasmid pTrc99a-P. esaS -eGFP(LVA)

[0060] (1) Construction of pTrc99a-PesaS-eGFP(LVA) plasmid: using plasmid pTrc99a-P esaS Using -eGFP as a template, PCR mutation amplification was performed with pR1*TB F and pR1*TB R as primers to obtain pTrc99a-P. esaS -eGFP(LVA). The PCR product was digested with DpnI at 37°C for 3 hours and then transformed into DH5α competent cells by chemical transformation. Positive clones were selected by colony PCR using primers pR1VF and pR1VR, and the clones were confirmed by sequencing to be pTrc99a-P. esaS -eGFP(LVA) plasmid. Primers are shown in Table 3.

[0061] (2) Plasmid introduction: Preparation of E. coilW3110::esaR I70V The chemical transformation of competent cells using ::esaIΔlacI is described in detail in (Molecular Cloning: A Laboratory Manual, 3rd Edition, 99-102). The constructed plasmid pTrc99a-P esaS -eGFP(LVA) was transformed into strain E. coilW3110::esaR via chemical transformation. I70V In ::esaIΔlacI competent cells, E. coilW3110::esaR was prepared. I70V ::esaIΔlacI / pTrc99a-PesaS -eGFP(LVA).

[0062] (3) Fluorescence detection: The constructed production strain E. coilW3110::esaR I70V ::esaIΔlacI / pTrc99a-P esaS -eGFP(LVA) was picked and inoculated into 10 mL of LB medium. The fermentation verification method was the same as in Example 2(8). Its OD 600 And the fluorescence intensity change curve as shown Figure 2 As shown.

[0063] The degradation tag LVA sequence is shown in SEQ ID NO.11.

[0064] like Figure 2 As shown, adding the degradation tag LVA to the end of green fluorescent protein significantly reduced the fluorescence intensity of cells as they grew. These results demonstrate that the use of degradation tags significantly reduces the half-life of green fluorescent protein and that downregulating gene expression levels via quorum sensing is feasible.

[0065] Table 3: Primers for Example 3

[0066] Primer name Sequence (5'-3') pR1*TB F cgacgaaaactacgctctggttgctTGAGGCTGTTTTGGCGG pR1*TB R gagcgtagttttcgtcgttagcagcCTTGTACAGTTCGTCCATACCCAG pR1 VF ccaatgcttctggcgtcaggc pR1 VR TCGCATGGGGAGACCCCACACTACC

[0067] Example 4: Construction of effective strains

[0068] E.coilW3110::esaR I70V ::esaIΔlacI / pTrc99a-P esaS -lacI(LAA)-T lpd -P esaS -eGFP(LVA)-T rpoC -P Trc -mCherry

[0069] (1) Construction of plasmid pTrc99a-P esaS -lacI(LAA)-T lpd -P esaS -eGFP(LVA)-T rpoC -P Trc -mCherry: pTrc99a was linearized using pR2 pline F and pR2 pline R as primers. The PCR product was digested with DpnI at 37°C for 3 hours, and the DNA fragments were recovered using a Clean Up kit. esaS (lacI)F and pR2 P esaS (lacI)R was used as a primer to amplify P. esaSThe (lacI) fragment was amplified using pR2 lacI F and pR2 lacI R as primers to obtain the lacI fragment (lacI terminator T). lpd The degradation peptide LAA was designed on pR2 lacI R and pR2 eGFP F; using pR2 eGFP F and pR2 eGFP R as primers, pTrc99a-P esaS Using -eGFP(LVA) as a template, P was amplified. esaS The -eGFP(LVA) fragment was amplified using pR2 mCherry F and pR2 mCherry R primers to obtain the mCherry fragment. The five recovered DNA fragments were then fused into a complete P-cell by fusion PCR. esaS -lacI(LAA)-T lpd -P esaS -eGFP(LVA)-T rpoC -P Trc -mCherry fragment. The fragment was detected by 1.0% agarose gel electrophoresis and purified by gel extraction. The linearized pTrc99a plasmid was ligated to the target fragment using a one-step cloning kit, transformed into E. coli DH5α, plated on Amp plates, and single colonies were picked and sequenced using validation primers to verify and screen for successfully cloned plasmids. Primers are shown in Table 4.

[0070] (2) Plasmid introduction: Preparation of E. coilW3110::esaR I70V ::esaIΔlacI chemical transformation of competent cells, introduction of plasmid pTrc99a-P esaS -lacI(LAA)-T lpd -P esaS -eGFP(LVA)-T rpoC -P Trc -mCherry, obtained strain E. coilW3110::esaR I70V ::esaIΔlacI / pTrc99a-P esaS -lacI(LAA)-T lpd -P esaS -eGFP(LVA)-T rpoC -P Trc -mCherry.

[0071] (3) Fluorescence detection: The constructed production strain E. coilW3110::esaR I70V ::esaIΔlacI / pTrc99a-P esaS -lacI(LAA)-T lpd -P esaS -eGFP(LVA)-TrpoC -P Trc A single colony of *mCherry* was picked and inoculated into 10 mL of LB medium, and cultured using the same method as in Example 2(8). The fluorescence value of *mCherry* was detected using the following methods: excitation wavelength: 587 nm; emission wavelength: 610 nm. Its OD... 600 The fluorescence intensity curves in the fermentation broth supernatant are as follows: Figure 3 As shown.

[0072] from Figure 3 The results show that green fluorescent protein was used in the promoter P esaS Driven by this, the expression level was dynamically downregulated. Simultaneously, the expression of the LacI gene was also affected by P. esaS The promoter drives the downregulation of the lacI gene. Therefore, changes in the intensity of green fluorescent protein (GFP) were used to characterize the downregulation process. Simultaneously, the expression of red fluorescent protein (mCherry) showed a significant lag. Red fluorescent protein expression only began after 6 hours of culture, when the cells were in the mid-to-late logarithmic phase. This was mainly due to the decrease in lacI expression levels during mid-logarithmic growth. These results demonstrate that the QSI dynamic control system, composed of the Esa quorum sensing system and the lactose operon system, can effectively achieve self-induction of the strain, eliminating the need for the addition of the inducer IPTG. Trc Promoter-driven expression of target genes.

[0073] Table 4: Primers for Example 4

[0074]

[0075]

[0076] Example 5: Engineered strain

[0077] E.coilW3110EYC::esaR I70V ::esaIΔlacI / pTrc99a-P esaS -lacI(LAA)-P Trc Construction and fermentation of -cysE-ydeD-serC-cysB

[0078] Using E. coli W3110EYC as the starting strain, CRISPR-Cas9-mediated gene editing technology (Yu Jiang et al. 2015 Multigene Editing in the Escherichia coli Genome via the CRISPR-Cas9 System. Applied Environmental Microbiology. 81:2506-2514) was used to replace the lacI gene in its genome with the transcriptional regulator esaR. I70V And AHL synthase esaI.

[0079] (1) Preparation of electrocompetent cells: pCas plasmid (Addgene Plasmid#62225) was introduced into E. coilW3110EYC, and single clones were selected and cultured overnight at 30°C in 10ml LB tubes containing 0.05g / L kanamycin. Then, 1% (v / v) inoculum was added to 250mL shake flasks containing 50mL LB medium, and 500μl of 1mol / L L-arabinose was added. The cells were cultured at 30°C and 150rpm until OD. 600 The concentration of the target material is 0.4–0.6; the cells are collected by centrifugation at 4000 rpm and 4°C for 10 min to prepare electrocompetent cells. For detailed procedures, please refer to the description in (Molecular Cloning: A Laboratory Manual, 3rd Edition, 99–102).

[0080] (2) Electroporation transformation: Take 150 ng of plasmid pTD-QSI from Example 2 (3) and slowly mix it with 200 μl of E. coilW3110EYC / pCas electroporation competent cells. Transfer the mixture into a pre-cooled 2 mm electroporation cuvette and incubate on ice for about 1 min. Perform electroporation transformation using an electroporator (MicroPluser™, BIO-RAD). Immediately after electroporation, add 1 mL of LB medium and gently aspirate it. Transfer the medium to a 1.5 mL centrifuge tube and thaw at 30°C for 2-3 h. Then, plate the mixture onto LB plates containing 0.05 g / L kanamycin and 0.05 mg / L spectinomycin. Incubate at 30°C upside down for 18-20 h. Pick single colonies for colony PCR verification and screen E. coilW3110EYC::esaI::esaR. I70V ΔlacI positive colonies.

[0081] (3) Elimination of pTD and pCas plasmids: Select positive single colonies and inoculate them into LB tubes containing 1 mM IPTG and 0.05 g / L kanamycin. Incubate overnight at 30°C. Streak the bacterial culture onto LB plates containing 0.05 mg / L kanamycin and incubate at 30°C for 24 h. Select single colonies and lightly spot them onto LB plates containing 0.05 g / L kanamycin for preservation. Streak them onto LB plates containing 0.05 g / L spectinomycin for verification. Single colonies that cannot grow on LB plates containing 0.05 g / L spectinomycin have had their pTD-QSI plasmids successfully eliminated. Single colonies successfully eliminated from the pTD-QSI plasmid were picked and incubated overnight at 37°C in LB broth tubes. The next day, the bacterial culture was streaked onto LB agar plates and incubated at 37°C for 12 hours. Single colonies were then lightly spotted onto antibiotic-free LB agar plates for preservation and streaked onto LB agar plates containing 0.05 g / L kanamycin. Single colonies that could not be streaked onto LB agar plates containing 0.05 g / L kanamycin had their pCas plasmid successfully eliminated, resulting in the plasmid-free strain *E. coilW3110EYC::esaR*. I70V ::esaIΔlacI.

[0082] (4) Construction of fermentation plasmid pTrc99a-P esaS -lacI(LAA)-P Trc -cysE-ydeD-serC-cysB: Using pFpline F and pFpline R as primers, the fermentation plasmid pTrc99a-P Trc -cysE-ydeD-serC-cysB linearization, PCR products were digested with DpnI at 37°C for 3 hours, and DNA fragments were recovered using a Clean Up kit. pF P esaS -lacI(LAA)F and pF P esaS Using -lacI(LAA)R as primers, P was amplified. esaS -lacI(LAA) fragment, linearized P using a one-step cloning kit Trc -cysE-ydeD-serC-cysB plasmid and target P esaS The -lacI(LAA) fragment was ligated, transformed into E. coli DH5α, plated on Amp plates, and single colonies were picked and sequenced using validation primers to screen for successfully cloned pTrc99a-P. esaS -lacI(LAA)-P Trc -cysE-ydeD-serC-cysB plasmid. Primers are shown in Table 5.

[0083] (5) Introduce fermentation plasmid: Introduce fermentation plasmid pTrc99a-P Trc -cysE-ydeD-serC-cysB and pTrc99a-P esaS-lacI(LAA)-P Trc -cysE-ydeD-serC-cysB were transformed into E. coilW3110EYC, respectively, to obtain the plasmid-containing strain E. coilW3110EYC / pTrc99a-P Trc -cysE-ydeD-serC-cysB and E.coilW3110EYC::esaR I70V ::esaIΔlacI / pTrc99a-P esaS -lacI(LAA)-P Trc -cysE-ydeD-serC-cysB. The implementation method is the same as in Example 2(7).

[0084] (6) Fermentation verification: The constructed E. coilW3110EYC / pTrc99a-P Trc -cysE-ydeD-serC-cysB and E.coilW3110EYC::esaR I70V ::esaIΔlacI / pTrc99a-P esaS -lacI(LAA)-P Trc A single colony of the -cysE-ydeD-serC-cysB production strain was inoculated into 10 mL of LB medium and incubated overnight at 37°C and 180 rpm. 1 mL of the pre-culture was then inoculated into a 500 mL shake flask containing 100 mL of SM medium and incubated at 30°C and 200 rpm for 12 h. Finally, 100 mL of the pre-culture was inoculated into a fermenter containing 1 L of SM medium and fermented at 25–37°C and 200–800 rpm. OD 600 =10~30, send to E.coilW3110EYC / pTrc99a-P Trc IPTG was added to strain -cysE-ydeD-serC-cysB to a final concentration of 0.1 mM, and the culture was continued for 60 h. The OD of the fermentation broth was measured after fermentation. 600 Then, take 1 mL of fermentation broth, centrifuge at 12000 rpm at room temperature for 3 min, and detect the OD according to the method in Example 1. 600 and the L-cysteine ​​content in the fermentation broth supernatant, such as Figure 4 As shown.

[0085] from Figure 4 It can be seen that applying the QSI dynamic control system to the engineered E. coli strain E. coli W3100EYC / pEACB, which produces L-cysteine, significantly increased the yield of L-cysteine. (Strain E. coli W3110EYC::esaR) I70V ::esaIΔlacI / pTrc99a-PesaS -lacI(LAA)-P Trc -cysE-ydeD-serC-cysB achieved an L-cysteine ​​accumulation of 9.183 g / L, compared to strain E. coilW3110EYC / pTrc99a-P Trc -cysE-ydeD-serC-cysB increased by 9%. Meanwhile, the OD of the new strain... 600 The result reached 25.92, an increase of 6%. These results indicate that the application of the QSI dynamic control system can effectively increase L-cysteine ​​production and contribute to cell growth.

[0086] Table 5: Primers for Example 5

[0087]

[0088]

[0089] Example 6: Construction of effective strains

[0090] E.coilW3110::esaR I70V ::esaI::P Trc -cysMΔlacI / pTrc99a-P esaS -lacI(LAA)-P Trc -cysE-ydeD-serC-cysB and its fermentation

[0091] (1) Construction of pTarget plasmid: Construct pTarget-cysM plasmid that can express sgRNA of the target gene cysM sequence. The construction method is the same as in Example 2(1). Using pTarget-cysM plasmid as template, the circular plasmid pTarget-cysM is linearized using primers pT line F and pT line R.

[0092] (2) Construction of pTD plasmid: Using the E. coli W3110 genome as a template, cysM up F and cysM up R, cysM down F and cysM down R as primers (Trc promoter designed on cysM up R and cysM down F), the construction steps are the same as in Example 2(2), to obtain pTD-cysM plasmid. Primers are shown in Table 6.

[0093] (3) Preparation of electrocompetent cells: pCas plasmid (Addgene Plasmid#62225) was introduced into E. coilW3110EYC::esaR I70V In ::esaIΔlacI, E.coilW3110EYC::esaR was prepared.I70V ::esaIΔlacI / pCas electrocompetent states were prepared using the same method as in Example 5(1).

[0094] (4) Electroporation: The plasmid pTD-cysM was electroporated into E.coilW3110EYC::esaR. I70V After electrocompetence was achieved, E. coilW3110::esaR was obtained. I70V ::esaI::P Trc -cysMΔlacI positive colonies were constructed using the same method as in Example 5(2).

[0095] (5) pTD and pCas plasmid elimination: The implementation method is the same as in Example 5(3), and the pTD and pCas plasmids are obtained by removing them. Trc plasmid-free strain E. coilW3110::esaR with promoter overexpression of the cysM gene I70V ::esaI::P Trc -cysMΔlacI.

[0096] (6) Introduce fermentation plasmid: Introduce fermentation plasmid pTrc99a-P esaS -lacI(LAA)-P Trc -cysE-ydeD-serC-cysB is converted to E.coilW3110::esaR I70V ::esaI::P Trc In -cysMΔlacI, the plasmid-containing strain E. coilW3110::esaR was obtained. I70V ::esaI::P Trc -cysMΔlacI / pTrc99a-P esaS -lacI(LAA)-P Trc -cysE-ydeD-serC-cysB. The implementation method is the same as in Example 5(5).

[0097] (7) Fermentation verification: The constructed E.coilW3110::esaR I70V ::esaI::P Trc -cysMΔlacI / pTrc99a-P esaS -lacI(LAA)-P Trc The -cysE-ydeD-serC-cysB production strain was tested and detected during fermentation according to the method in Example 5(6). OD 600 and the L-cysteine ​​content in the fermentation broth supernatant, such as Figure 5 As shown.

[0098] To further increase the L-cysteine ​​production of engineered *E. coli* strains using a QSI dynamic control system, the *cysM* gene was overexpressed. The *cysM* gene is involved in the thiosulfate assimilation pathway in L-cysteine ​​synthesis. Figure 5 It can be seen that by utilizing the promoter P Trc Overexpression of the cysM gene significantly increased L-cysteine ​​production. (E. coilW3110::esaR strain) I70V ::esaI::P Trc -cysMΔlacI / pTrc99a-P esaS -lacI(LAA)-P Trc -cysE-ydeD-serC-cysB achieved an L-cysteine ​​accumulation of 10.82 g / L, compared to the control strain E. coilW3110EYC::esaR I70V ::esaIΔlacI / pTrc99a-P esaS -lacI(LAA)-P Trc -cysE-ydeD-serC-cysB increased by 17%. This is because the cysM gene is affected by P. Trc The expression of L-cysteine ​​is driven by the promoter and therefore also controlled by the QSI dynamic control system. The results above indicate that overexpression of the cysM gene can effectively increase L-cysteine ​​production under the regulation of the QSI dynamic control system.

[0099] Table 6: Primers for Example 6

[0100]

[0101] Example 7: Construction of effective strains

[0102] E.coilW3110::esaR I70V ::esaI::P Trc -cysM::P Trc -nrdHΔlacI / pTrc99a-P esaS -lacI(LAA)-P Trc -cysE-ydeD-serC-cysB and its fermentation

[0103] (1) Construction of pTarget plasmid: Construct pTarget-nrdH plasmid that can express sgRNA of the target gene nrdH sequence. The construction method is the same as in Example 2(1).

[0104] (2) Construction of pTD plasmid: Using the E. coli W3110 genome as a template, nrdH up F and nrdH up R, nrdH down F and nrdH down R were used as primers (the Trc promoter was designed on nrdH up R and nrdH down F). The construction steps were the same as in Example 2(2), and the pTD-nrdH plasmid was obtained. The primers are shown in Table 7.

[0105] (3) Preparation of electrocompetent cells: pCas plasmid (Addgene Plasmid#62225) was introduced into E. coilW3110::esaR I70V ::esaI::P Trc In -cysMΔlacI, E.coilW3110::esaR was prepared. I70V ::esaI::P Trc -cysMΔlacI / pCas electrocompetent states were prepared using the same method as in Example 5(1).

[0106] (4) Electroporation: Plasmid pTD-nrdH was electroporated to E.coilW3110::esaR I70V ::esaI::P Trc After electrocompetentizing -cysMΔlacI / pCas, the resulting E.coilW3110::esaR was selected. I70V ::esaI::P Trc -cysM::P Trc -nrdHΔlacI positive colonies were constructed using the same method as in Example 5(2).

[0107] (5) pTD and pCas plasmid elimination: The implementation method is the same as in Example 5(3), to obtain pTD and pCas plasmids. Trc plasmid-free E.coilW3110::esaR with promoter overexpression of the nrdH gene I70V ::esaI::P Trc -cysM::P Trc -nrdHΔlacI.

[0108] (6) Introduce fermentation plasmid: Introduce fermentation plasmid pTrc99a-P esaS -lacI(LAA)-P Trc -cysE-ydeD-serC-cysB is converted to E.coilW3110::esaR I70V ::esaI::P Trc -cysM::P Trc In -nrdHΔlacI, the plasmid-containing strain E. coilW3110::esaR was obtained. I70V::esaI::P Trc -cysM::P Trc -nrdHΔlacI / pTrc99a-P esaS -lacI(LAA)-P Trc -cysE-ydeD-serC-cysB. The implementation method is the same as in Example 5(5).

[0109] (7) Fermentation validation: The constructed production strain E. coilW3110::esaR was used. I70V ::esaI::P Trc -cysM::P Trc -nrdHΔlacI / pTrc99a-P esaS -lacI(LAA)-P Trc -cysE-ydeD-serC-cysB was fermented and tested according to the method in Example 5(6). OD 600 and the L-cysteine ​​content in the fermentation broth supernatant, such as Figure 6 As shown.

[0110] NrdH is a major pathway enzyme in the L-cysteine ​​thiosulfate assimilation pathway in *E. coli*. It converts the metabolic intermediate S-sulfocysteine ​​to L-cysteine. Figure 6 It can be seen that, using P Trc After overexpressing the nrdH gene in the promoter, the engineered strain E. coilW3110::esaR I70V ::esaI::P Trc -cysM::P Trc -nrdHΔlacI / pTrc99a-P esaS -lacI(LAA)-P Trc The L-cysteine ​​production of -cysE-ydeD-serC-cysB reached 11.86 g / L, compared to the control strain E. coilW3110::esaR I70V ::esaI::P Trc -cysMΔlacI / pTrc99a-P esaS -lacI(LAA)-P Trc -cysE-ydeD-serC-cysB, yield increased by 10%. These results demonstrate that using a QSI dynamic control system to regulate the expression of L-cysteine ​​synthesis genes can effectively enhance L-cysteine ​​accumulation, and the fermentation process does not require the addition of the inducer IPTG. The described QSI dynamic control strategy has broad prospects for engineering applications.

[0111] Table 7: Primers for Example 7

[0112]

Claims

1. A genetically engineered bacterium producing L-cysteine, constructed by the following method: (1) Using strain E. coil W3110 as the chassis strain, the lacI gene in its genome was replaced with the transcriptional regulator esaR. I70V And AHL synthase esaI, in the esaR gene I70V Add a terminator T afterward lpd Add a terminator T after the esaI gene rpoC The strain E. coil W3110::esaR was obtained. I70V ::esaIΔlacI; the transcriptional regulator esaR I70V The sequence of the AHL synthase esaI is shown in SEQ ID NO.1, and the sequence of the AHL synthase esaI is shown in SEQ ID NO.2; (2) The strain E. coil W3110::esaR I70V The promoters of the cysM and nrdH genes of ::esaIΔlacI are replaced with P Trc Promoter, obtained strain E. coilW3110EYC::esaR I70V ::esaI:: cysM::nrdHΔlacI; (3) Plasmid pTrc99a-P Trc The promoter of the lacI gene on -cysE-ydeD-serC-cysB is replaced with P. esaS Furthermore, an LAA degradation tag was added before the stop codon of the lacI gene to construct the fermentation plasmid pTrc99a-P. esaS -lacI(LAA)-P Trc -cysE-ydeD-serC-cysB, where LAA is a degradation tag, is introduced into the strain obtained in step (2) to obtain E.coilW3110::esaR I70V ::esaI::P Trc -cysM::P Trc -nrdHΔlacI / pTrc99a-P esaS -lacI(LAA)-P Trc -cysE-ydeD-serC-cysB, which is the genetically engineered bacterium that produces L-cysteine; the promoter P esaS The sequence is shown in SEQ ID NO.3, the sequence of the degradation tag LAA is shown in SEQ ID NO.4, and the terminator T rpoC The sequence is shown in SEQ ID NO.5, with the terminator T. lpd The sequence is shown in SEQ ID NO.

6.

2. The method for constructing the L-cysteine-producing genetically engineered bacteria as described in claim 1, characterized in that... The method is as follows: (1) Using strain E. coil W3110 as the chassis strain, CRISPR-Cas9 gene editing technology was applied to replace the lacI gene in its genome with the transcriptional regulator esaR. I70V And AHL synthase esaI, in the esaR gene I70V Add a terminator T afterward lpd Add a terminator T after the esaI gene rpoC The strain E. coil W3110::esaR was obtained. I70V ::esaIΔlacI; the transcriptional regulator esaR I70V The sequence of the AHL synthase esaI is shown in SEQ ID NO.1, and the sequence of the AHL synthase esaI is shown in SEQ ID NO.2; (2) Using CRISPR-Cas9 gene editing technology, the strain E. coil W3110::esaR was edited. I70V The promoters of the cysM and nrdH genes of ::esaIΔlacI are replaced with P Trc Promoter, obtained strain E. coilW3110EYC::esaR I70V ::esaI:: cysM::nrdHΔlacI; (3) Plasmid pTrc99a-P Trc The promoter of the lacI gene on -cysE-ydeD-serC-cysB is replaced with P. esaS Furthermore, an LAA degradation tag was added before the stop codon of the lacI gene to construct the fermentation plasmid pTrc99a-P. esaS -lacI(LAA)-P Trc -cysE-ydeD-serC-cysB, which is introduced into the strain obtained in step (2), yields E.coilW3110::esaR. I70V ::esaI::P Trc -cysM::P Trc -nrdHΔlacI / pTrc99a-P esaS -lacI(LAA)-P Trc -cysE-ydeD-serC-cysB, which is the genetically engineered bacterium that produces L-cysteine; the promoter P esaS The sequence is shown in SEQ ID NO.3, the sequence of the degradation tag LAA is shown in SEQ ID NO.4, and the terminator T rpoC The sequence is shown in SEQ ID NO.5, with the terminator T. lpd The sequence is shown in SEQ ID NO.

6.

3. The application of the genetically engineered bacteria according to claim 1 in the microbial fermentation preparation of L-cysteine, characterized in that... The application is as follows: the genetically engineered bacteria are inoculated into a fermentation medium and fermented at 26-37℃ and 200-800rpm for 60-72 h. After fermentation, the supernatant of the fermentation broth is taken and purified to obtain L-cysteine.

Images