Antisense oligonucleotides and their application in the treatment of Pendred syndrome

Abstract

The present invention relates to the field of medicine. Specifically, the present invention relates to novel antisense oligonucleotides that prevent or reduce exon 8 skipping of the SLC26A4 gene during pre-mRNA splicing, and their use in the treatment of Pendred syndrome.

Description

[0001] Cross - reference to related applications

[0002] This application claims priority to U.S. Provisional Patent Application No. 62 / 975,337, filed on February 12, 2020, the entire content of which is incorporated herein by reference.

[0003] Sequence listing

[0004] This application contains a sequence listing that has been electronically submitted in ASCII format and is incorporated herein by reference in its entirety. The ASCII copy was created on February 10, 2021, named 13365_0018-00304_SL.txt, and is 16,709 bytes in size. Technical Field

[0005] The present invention relates to novel antisense oligonucleotides ("ASOs") that prevent or reduce exon skipping during pre-mRNA splicing, pharmaceutical compositions comprising the ASOs, and their uses. Background Art

[0006] Pendred syndrome is a sensorineural hearing loss disorder. It is one of the most common causes of syndromic deafness, accounting for approximately 4-10% of all cases of hereditary deafness. Patients with Pendred syndrome have malformed inner ears, including enlarged vestibular aqueducts. Sometimes a Mondini cochlea can also develop, in which the cochlea and the interscalar septum are completely or partially replaced by fluid-filled cavities. Although the hearing loss caused by this syndrome is usually congenital, some rare cases develop in later childhood. Some patients (50-83%) also develop goiter, although this is variable as it depends on other factors such as nutritional intake. Wemeau and Kopp, (2017) Best Prac. & Res. Clin. Endocrinology & Metabolism 31, 213-224.

[0007] Early treatment of Pendred syndrome is crucial for congenital cases to ensure language acquisition and communication skills. Current treatment options for Pendred syndrome include hearing support devices such as hearing aids, which can assist with mild hearing impairment. However, for patients with severe deafness, cochlear implant may be recommended. The implantation process may lead to cerebrospinal fluid leakage in patients with Mondini cochlea. Wemeau and Kopp, (2017) Best Prac. & Res. Clin. Endocrinology & Metabolism 31, 213-224. Currently, there are no medications available for the treatment of Pendred syndrome, nor are there treatment options targeting the underlying genetic causes of Pendred syndrome.

[0008] Pendred syndrome is an autosomal recessive genetic disorder characterized by bi-allelic mutations in the SLC26A4 gene that encodes pendrin. Pendrin is a multifunctional anion exchanger protein expressed in the inner ear and thyroid. Due to its affinity for chloride, iodide, and other anions, pendrin maintains the composition and potential of endolymph by facilitating the exchange of chloride and bicarbonate in the inner ear. Wemeau and Kopp, (2017) Best Prac. & Res. Clin. Endocrinology & Metabolism 31, 213-224. The SLC26A4 gene mutation (c.919-2A>G) causes exon 8 skipping during the processing of SLC26A4 pre-mRNA. This mutation, also known as IVS7-2A>G, is one of the most common mutations in the East Asian population with hearing loss.

[0009] In eukaryotic genes that contain coding sequences (exons) and non-coding sequences (introns), the non-coding introns are excised from the pre-mRNA transcript, and the coding exons are spliced together to form mRNA. If an intron is retained or an exon is missed in the final mRNA transcript, the mRNA reading frame may be disrupted during the translation of mRNA. This may lead to the production of a non-functional polypeptide sequence or a premature stop codon. Alternative splicing further complicates the splicing process, where the same pre-mRNA sequence can be spliced into different exon combinations to form multiple mRNA sequences.

[0010] The splicing of precursor mRNA is a complex process that involves a multi-megadalton ribonucleoprotein complex called the spliceosome. The spliceosome recognizes specific sequences in the precursor mRNA to precisely excise introns and ligate exons. The spliceosome utilizes three conserved RNA sequences to catalyze the excision of introns in two transesterification reactions. These RNA sequences are the 5′ splice site, the 3′ splice site, and the branch site. Will and Luhrmann, (2011) Cold Spring Harb. Perspect. Biol. 3, a003707.

[0011] Splicing begins with the 2′OH group of the branch site, which binds to the 5′ splice site through a nucleophilic attack, causing cleavage of the 5′ exon of the 5′ splice site and formation of a lariat. Then, the 3′OH group of the 5′ exon attacks the 3′ exon of the 3′ splice site, ligating the 5′ exon and the 3′ exon and cleaving the intron lariat. Will and Luhrmann, (2011) Cold Spring Harb. Perspect. Biol 3, a003707. Since the splicing process is completely dependent on the spliceosome recognition sites, the 5′ and 3′ splice sites, and the branch site, mutations in any of these sites will disrupt the splicing process.

[0012] In Pendred syndrome, the (c.919-2A>G) mutation in SLC26A4 affects the splicing process of SLC26A4 precursor mRNA, causing exon 8 skipping. Exon 8 is erroneously removed from the final mRNA transcript, causing a frameshift during translation, thereby producing a truncated and dysfunctional pendrin peptide. Wemeau and Kopp, (2017) Best Prac. & Res. Clin. Endocrinology & Metabolism 31, 213-224.

[0013] ASOs are a class of polynucleotides designed to specifically bind to target nucleotide sequences, thereby affecting one or more aspects of gene expression, such as transcription, splicing, stability, and / or translation. ASOs can target RNA or DNA. RNA-targeted ASOs can bind to the target mRNA sequence, thereby affecting mRNA stability or translation on ribosomes.

[0014] ASOs that bind to target sequences in pre-mRNA transcripts can affect the splicing process. In some cases, ASOs can be used to induce exon skipping during pre-mRNA splicing. For example, Duchenne muscular dystrophy (DMD) is caused by mutations that alter the reading frame of dystrophin mRNA during translation, resulting in premature stop codons and truncated dystrophin. ASOs can be used to correct the reading frame by inducing exon skipping during splicing. Removing one exon in the correct number of base pairs results in a shorter mRNA transcript, but the reading frame may be corrected. Since the dystrophin RNA consists of 79 exons, skipping one or several exons during splicing still results in a partially functional protein. Shimo et al., (2015) Duchenne Muscular Dystrophy 143-155. The FDA approved an exon-skipping drug called Exondys 51 (eteplirsen) in 2016 for the treatment of DMD. Dowling, (2016) Nature Review Neurology 12, 675-676.

[0015] In other cases, ASOs can be used to prevent or reduce exon skipping during pre-mRNA splicing. For example, the ASO drug nusinersen reduces the skipping of exon 7 during the splicing of the SMN2 gene to treat spinal muscular atrophy. Son and Yokota, (2018) Exon Skipping & Inclusion Therapies, 57-68. However, there is still a need for ASOs that can successfully prevent or reduce exon 8 skipping during the pre-mRNA splicing of SLC26A4 and their use in treating related diseases, such as Pendred syndrome. SUMMARY OF THE INVENTION

[0016] The present invention relates to ASOs, methods of using the ASOs to prevent or reduce exon skipping during pre-mRNA splicing, pharmaceutical compositions comprising the ASOs, and methods of using the compositions to treat hearing loss in Pendred syndrome.

[0017] In one embodiment, the present invention provides an ASO having a length of 10-30 nucleotides, which comprises all or part of SEQ ID NO.1.

[0018] In one embodiment, the present invention provides an ASO, wherein the ASO is:

[0019] a. HUA0003-1027 (5′-tagtactaagaggaacac-3′) (SEQ ID NO.2);

[0020] b. HUA0003-1029 (5′-attagtactaagaggaacac-3′) (SEQ ID NO.3);

[0021] c. HUA0003-1030 (5′-tattagtactaagaggaacac-3′) (SEQ ID NO.4);

[0022] d. HUA0003-1031 (5′-gtattagtactaagaggaacac-3′) (SEQ ID NO.5);

[0023] e. HUA0003-1032 (5′-tgtattagtactaagaggaacac-3′) (SEQ ID NO.6);

[0024] f. HUA0003-0930 (5′-tattagtactaagaggaacacc-3′) (SEQ ID NO.7);

[0025] g. HUA0003-0929 (5′-attagtactaagaggaacacc-3′) (SEQ ID NO.8);

[0026] h. HUA0003-0928 (5′-ttagtactaagaggaacacc-3′) (SEQ ID NO.9); or

[0027] i. HUA0003-0931 (5′-gtattagtactaagaggaacacc-3′) (SEQ ID NO.10).

[0028] In one embodiment, the present invention provides an ASO as described above, which comprises a non-natural backbone.

[0029] In one embodiment, the present invention provides an ASO as described above, which comprises a modified glycosyl group.

[0030] In one embodiment, the present invention provides an ASO as described above, which comprises 2′-O-methoxyethyl ribose groups.

[0031] In one embodiment, the present invention provides an ASO as described above, which comprises a modified phosphate ester.

[0032] In one embodiment, the present invention provides an ASO as described above, which comprises phosphorothioate.

[0033] In one embodiment, the present invention provides an ASO as described above, which comprises a modified nitrogenous base.

[0034] In one embodiment, the present invention provides an ASO as described above, which comprises a 5-methylcytosine base.

[0035] In one embodiment, the present invention provides an ASO as described above, which further comprises a pharmaceutically acceptable carrier or excipient.

[0036] In one embodiment, the present invention provides a method for preventing or reducing exon 8 skipping in the SLC26A4 gene during pre-mRNA splicing, comprising introducing a nucleic acid molecule into a cell, wherein the nucleic acid molecule is an ASO comprising all or part of SEQ ID NO.1, wherein the ASO hybridizes to the intron 8 target region of the SLC26A4 gene, and wherein the ASO prevents or reduces exon 8 skipping during pre-mRNA splicing of the SLC26A4 gene.

[0037] In one embodiment, the present invention provides a method for preventing or reducing exon 8 skipping in the SLC26A4 gene during pre-mRNA splicing as described above, wherein the ASO is:

[0038] a. HUA0003-1027 (5′-tagtactaagaggaacac-3′) (SEQ ID NO.2);

[0039] b. HUA0003-1029 (5′-attagtactaagaggaacac-3′) (SEQ ID NO.3);

[0040] c. HUA0003-1030 (5′-tattagtactaagaggaacac-3′) (SEQ ID NO.4);

[0041] d. HUA0003-1031 (5′-gtattagtactaagaggaacac-3′) (SEQ ID NO.5);

[0042] e. HUA0003-1032 (5′-tgtattagtactaagaggaacac-3′) (SEQ ID NO.6);

[0043] f. HUA0003-0930 (5′-tattagtactaagaggaacacc-3′) (SEQ ID NO.7);

[0044] g. HUA0003-0929 (5′-attagtactaagaggaacacc-3′) (SEQ ID NO.8);

[0045] h. HUA0003-0928 (5′-ttagtactaagaggaacacc-3′) (SEQ ID NO.9); or

[0046] i. HUA0003-0931 (5′-gtattagtactaagaggaacacc-3′) (SEQ ID NO.10).

[0047] In one embodiment, the present invention provides a method for preventing or reducing exon 8 skipping in the SLC26A4 gene during pre-mRNA splicing as described above, wherein the cell is an animal cell.

[0048] In one embodiment, the present invention provides a method for preventing or reducing exon 8 skipping in the SLC26A4 gene during pre-mRNA splicing as described above, wherein the cell is a human cell.

[0049] In one embodiment, the present invention provides a method for preventing or reducing exon 8 skipping in the SLC26A4 gene during pre-mRNA splicing as described above, wherein the nucleic acid molecule is introduced into the cell through an expression vector.

[0050] In one embodiment, the present invention provides a method for preventing or reducing exon 8 skipping in the SLC26A4 gene during pre-mRNA splicing as described above, wherein the expression vector is a pCI-neo expression vector.

[0051] In one embodiment, the present invention provides a method for treating hearing loss in a subject suffering from Pendred syndrome, comprising administering a therapeutically effective amount of an ASO, wherein the ASO comprises all or part of SEQ ID NO.1.

[0052] In one embodiment, the present invention provides a method for treating hearing loss in a subject suffering from Pendred syndrome as described above, wherein the administered ASO is:

[0053] a. HUA0003-1027 (5′-tagtactaagaggaacac-3′) (SEQ ID NO.2);

[0054] b. HUA0003-1029 (5′-attagtactaagaggaacac-3′) (SEQ ID NO.3);

[0055] c. HUA0003-1030 (5′-tattagtactaagaggaacac-3′) (SEQ ID NO.4);

[0056] d. HUA0003-1031 (5′-gtattagtactaagaggaacac-3′) (SEQ ID NO.5);

[0057] e. HUA0003-1032 (5′-tgtattagtactaagaggaacac-3′) (SEQ ID NO.6);

[0058] f. HUA0003-0930 (5′-tattagtactaagaggaacacc-3′) (SEQ ID NO.7);

[0059] g. HUA0003-0929 (5′-attagtactaagaggaacacc-3′) (SEQ ID NO.8);

[0060] h. HUA0003-0928 (5′-ttagtactaagaggaacacc-3′) (SEQ ID NO.9); or

[0061] i. HUA0003-0931 (5′-gtattagtactaagaggaacacc-3′) (SEQ ID NO.10).

[0062] In one embodiment, the present invention provides a method for treating hearing loss in a subject suffering from Pendred syndrome as described above, wherein the ASO is administered by parenteral administration.

[0063] In one embodiment, the present invention provides a compound for use in a method of preventing or reducing exon 8 skipping in the SLC26A4 gene during pre-mRNA splicing, the method comprising introducing a nucleic acid molecule into a cell, wherein the nucleic acid molecule is an ASO comprising all or part of SEQ ID NO.1.

[0064] In one embodiment, the present invention provides a compound as described above for use in a method of preventing or reducing exon 8 skipping in the SLC26A4 gene during pre-mRNA splicing, wherein the ASO is:

[0065] a. HUA0003 - 1027 (5′-tagtactaagaggaacac-3′) (SEQ ID NO.2);

[0066] b. HUA0003 - 1029 (5′-attagtactaagaggaacac-3′) (SEQ ID NO.3);

[0067] c. HUA0003 - 1030 (5′-tattagtactaagaggaacac-3′) (SEQ ID NO.4);

[0068] d. HUA0003 - 1031 (5′-gtattagtactaagaggaacac-3′) (SEQ ID NO.5);

[0069] e. HUA0003 - 1032 (5′-tgtattagtactaagaggaacac-3′) (SEQ ID NO.6);

[0070] f. HUA0003 - 0930 (5′-tattagtactaagaggaacacc-3′) (SEQ ID NO.7);

[0071] g. HUA0003 - 0929 (5′-attagtactaagaggaacacc-3′) (SEQ ID NO.8);

[0072] h. HUA0003 - 0928 (5′-ttagtactaagaggaacacc-3′) (SEQ ID NO.9); or

[0073] i. HUA0003 - 0931 (5′-gtattagtactaagaggaacacc-3′) (SEQ ID NO.10).

[0074] In one embodiment, the present invention provides a compound as described above for use in a method of preventing or reducing exon 8 skipping in the SLC26A4 gene during pre-mRNA splicing, wherein the cell is an animal cell.

[0075] In one embodiment, the present invention provides a compound as described above for use in a method of preventing or reducing exon 8 skipping in the SLC26A4 gene during pre-mRNA splicing, wherein the cell is a human cell.

[0076] In one embodiment, the present invention provides a compound as described above for use in a method of preventing or reducing exon 8 skipping in the SLC26A4 gene during pre-mRNA splicing, wherein the nucleic acid molecule is introduced into cells via an expression vector.

[0077] In one embodiment, the present invention provides a compound as described above for use in a method of preventing or reducing exon 8 skipping in the SLC26A4 gene during pre-mRNA splicing, wherein the expression vector is a pCI-neo expression vector.

[0078] In one embodiment, the present invention provides a compound for use in a method of treating hearing loss in a subject suffering from Pendred syndrome, the method comprising administering a therapeutically effective amount of an ASO, the ASO comprising all or part of SEQ ID NO.1.

[0079] In one embodiment, the present invention provides a compound as described above for use in a method of treating hearing loss in a subject suffering from Pendred syndrome, wherein the ASO is:

[0080] a. HUA0003-1027 (5′-tagtactaagaggaacac-3′) (SEQ ID NO.2);

[0081] b. HUA0003-1029 (5′-attagtactaagaggaacac-3′) (SEQ ID NO.3);

[0082] c. HUA0003-1030 (5′-tattagtactaagaggaacac-3′) (SEQ ID NO.4);

[0083] d. HUA0003-1031 (5′-gtattagtactaagaggaacac-3′) (SEQ ID NO.5);

[0084] e. HUA0003-1032 (5′-tgtattagtactaagaggaacac-3′) (SEQ ID NO.6);

[0085] f. HUA0003-0930 (5′-tattagtactaagaggaacacc-3′) (SEQ ID NO.7);

[0086] g. HUA0003-0929 (5′-attagtactaagaggaacacc-3′) (SEQ ID NO.8);

[0087] h. HUA0003-0928 (5′-ttagtactaagaggaacacc-3′) (SEQ ID NO.9); or

[0088] i. HUA0003-0931 (5′-gtattagtactaagaggaacacc-3′) (SEQ ID NO.10).

[0089] In one embodiment, the present invention provides a compound as described above for use in a method of treating hearing loss in a subject suffering from Pendred syndrome, wherein the ASO is administered by parenteral administration. BRIEF DESCRIPTION OF THE DRAWINGS

[0090] Figure 1 Shows the identification of ASOs that promote exon 8 inclusion of the SLC26A4 minigene c.919-2A>G mutation in vitro. The percentage of exon 8 inclusion in untreated cells (blank) was approximately 30%. The percentage of inclusion in cells treated with 10 nM control ASO (Con ASO) was approximately 26%. FL: full-length transcript, *: transcript retaining intron 7, Δ8: transcript with exon 8 skipping.

[0091] Figure 2 Shows the inclusion of exon 8 of the endogenous SLC26A4 c.919-2A>G mutant in PBMCs from a patient who received ASO (SEQ ID NO.3). PBMC: peripheral blood mononuclear cell, FL: full-length transcript, Δ8: transcript with exon 8 skipping.

[0092] Figure 3 Shows two transesterification reactions involved in the splicing precursor mRNA (pre-mRNA). The 2′OH group at the branch site binds to the 5′ splice site through nucleophilic attack, causing cleavage of the 5′ exon and formation of a lariat between the 5′ splice site and the branch site. Then the 3′OH group of the 5′ exon binds to the 3′ exon at the 3′ splice site, cleaving the intron lariat and ligating the exons to form mRNA. 5′SS: 5′ splice site; 3′SS: 3′ splice site; BS: branch site. DETAILED DESCRIPTION

[0093] Definitions

[0094] As used herein, the term "oligonucleotide" refers to a nucleotide sequence comprising at least ten DNA or RNA nucleotides.

[0095] As used herein, the term "antisense oligonucleotide", abbreviated as "ASO", refers to a nucleotide sequence that includes an antisense sequence that is sufficiently complementary to a target nucleotide sequence such that a stable double-stranded hybrid is formed with the target nucleotide sequence. In some embodiments, the target nucleotide sequence is an RNA nucleotide sequence.

[0096] As used herein, the term "nucleobase" refers to a nitrogen-containing base that is a component of a nucleoside. Exemplary nucleobases include, but are not limited to: adenine, guanine, thymine, cytosine, and uracil.

[0097] As used herein, the term "nucleoside" refers to a nucleobase covalently linked to a sugar. Examples of natural and unnatural nucleosides are described below.

[0098] As used herein, the term "nucleotide" refers to a nucleoside covalently linked to a phosphate group. Examples of natural and unnatural nucleotides are described below.

[0099] As used herein, the term "unnatural" refers to one or more nucleotide subunits having at least one modification selected from (i) a modified internucleotide bond, e.g., an internucleotide bond other than the standard phosphodiester bond found in naturally occurring oligonucleotides, (ii) a modified sugar moiety, e.g., a sugar moiety other than ribose or deoxyribose found in naturally occurring oligonucleotides, (iii) a modified nitrogen-containing base, e.g., a base other than the bases found in naturally occurring oligonucleotides, or (iv) a combination of the foregoing.

[0100] As used herein, the term "morpholino" refers to a nucleobase that includes a morpholino ring instead of ribose.

[0101] As used herein, the term "complementary" describes when the corresponding positions of at least two nucleotide sequences are occupied by nucleotides that can form hydrogen bonds with each other.

[0102] As used herein, the term "hybridization" describes the binding of two complementary nucleotide sequences to form a double-stranded molecule. When a sufficient number of the corresponding nucleotides in the two sequences can hydrogen bond with each other in sequence, i.e., when they are sufficiently complementary, they can form a stable hybrid. It is understood in the art that 100% complementarity is not required for an ASO to hybridize to a target sequence.

[0103] As used herein, the term "sufficient complementarity" is used to denote a level of complementarity sufficient to permit specific binding of an ASO to its target sequence and formation of a stable hybrid. In one embodiment, the complementarity of the ASO to the target sequence is at least 99%, or 98%, or 97%, or 96%, or 95%, or 94%, or 93%, or 92%, or 91%, or 90%, or 89%, or 88%, or 87%, or 86%, or 85%, or 84%, or 83%, or 82%, or 81%, or 80%, or 79%, or 78%, or 77%, or 76%, or 75%, or 74%, or 73%, or 72%, or 71%, or 70%.

[0104] The terms "target region" and "target sequence" are used interchangeably herein to designate the nucleotide sequence to which an ASO will hybridize under physiological conditions. The ASO and the target region need not be 100% complementary, provided there is sufficient complementarity to permit hybridization of the ASO to the target sequence to form a stable hybrid. The ASO may hybridize to all or a portion of the target sequence.

[0105] As used herein, the term "treatment" is used to refer to ameliorating a disease or disorder (i.e., slowing or arresting or reducing the development of the disease or at least one of its clinical symptoms). The term also refers to alleviating or ameliorating at least one physical parameter, including those not discernible by the patient. The term also refers to modulating a disease or disorder physically (e.g., by stabilization of discernible symptoms), physiologically (e.g., by stabilization of physical parameters), or both. The term also refers to preventing or delaying the occurrence, development, or progression of a disease or disorder.

[0106] As used herein, the term "therapeutically effective amount" is used to refer to the amount of a therapeutic agent or composition effective to prevent or treat a disorder or disease. In one embodiment, this includes the amount of a therapeutic agent or composition effective to prevent or treat Pendred syndrome.

[0107] As used herein, the term "pharmaceutically acceptable" is used to refer to molecular entities or compositions that are useful in pharmacy and are not biologically or otherwise undesirable.

[0108] As used herein, the term "carrier" is used to refer to a diluent, adjuvant, excipient, or vehicle with which a compound is administered.

[0109] As used herein, the term "excipient" refers to any component of a pharmaceutical composition other than the active ingredient.

[0110] Unless otherwise defined, all other scientific and technical terms shall have the same meaning as commonly understood by one of ordinary skill in the art. Such scientific and technical terms are explained in the literature, for example: J. Sambrook, E. F. Fritsch, and T. Maniatis, 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Books 1-3, Cold Spring Harbor Laboratory Press; Martin, 1990, Remington’s Pharmaceutical Sciences, 18th Edition, Mack Publishing Co; Glover, 1985, DNA Cloning: A Practical Approach, Volumes I and II, MRL Press, Ltd.; and Ausubel, F., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., Struhl, K., 2002, Current Protocols in Molecular Biology, Greene Publishing Associates / Wiley Intersciences.

[0111] Antisense oligonucleotides

[0112] In one embodiment, the present invention discloses ASOs directed to target sequences in the SLC26A4 pre-mRNA. Some embodiments relate to ASOs that are directed to all or part of a 25-nucleotide target sequence in intron 8 of the SLC26A4 pre-mRNA (Table 1, “25-Nt sequence of interest”). This target sequence is from position 8 to position 32 of intron 8 in the SLC26A4 gene. This intron 8 target sequence is involved in exon 8 skipping, which occurs in the mutant (c.919-2A>G) SLC26A4, such that the precursor mRNA containing this mutation is mis-spliced, removing exon 8 from the final transcript.

[0113] In another embodiment, the ASOs directed to the 25-nt target sequence are sufficiently complementary to the target sequence to form a stable hybrid and are 10-30 nucleotides in length. These ASOs are sufficiently complementary to all or part of the 25-nt target sequence.

[0114] In some embodiments, the ASOs have the specific sequences disclosed in Table 3. Those specific ASOs are also illustrated in the Examples. However, these specific ASOs are disclosed for illustrative purposes only and do not limit the scope of the invention in any way.

[0115] In some embodiments, the nucleobases of at least some of the ASOs will be replaced with uracil in place of thymine, or thymine in place of uracil. In some embodiments, the nucleosides of at least some of the ASOs will be replaced with ribose in place of deoxyribose, or deoxyribose in place of ribose.

[0116] Nucleotide modifications

[0117] In another embodiment, the disclosed ASOs contain one or more nucleotides that are chemically modified in one or more ways known to those skilled in the art. Nucleotide modifications include, for example, modified nitrogenous bases, sugar moieties, and phosphate esters. These modifications are preferred at least in terms of their ability to resist nuclease degradation.

[0118] Specific examples of chemically modified ASOs useful in the present invention include ASOs having a modified phosphate backbone or non-natural internucleoside linkages. ASOs having a modified backbone include those in which the backbone retains a phosphorus atom and those in which the backbone does not have a phosphorus atom.

[0119] In other embodiments, the sugar and internucleoside linkages, i.e., the backbone, of the nucleotide units in the ASO are both replaced with new groups. The base units are retained to hybridize with a suitable nucleic acid target compound. For example, the ASO can be a peptide nucleic acid (PNA). In a PNA compound, the sugar backbone of the oligonucleotide is replaced with a backbone containing amides, such as an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to the azanitrogen atoms of the backbone amide moiety.

[0120] The modified ASOs can also include one or more substituted sugar moieties, e.g., one or more sugar moieties that are mono- or disubstituted at the 2′, 3′, and / or 5′ positions, such as -OH; -F; substituted or unsubstituted, straight-chain or branched lower (C1-C10) alkyl, alkenyl, alkynyl, alkaryl, allyl, or aralkyl groups that can be interrupted by one or more heteroatoms; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S-, or N-alkynyl; O-, S-, or N-allyl; O-alkyl-O-alkyl, -methoxy, -aminopropoxy; methoxyethoxy; dimethylaminooxyethoxy; and -dimethylaminoethoxyethoxy. The sugar moiety can be a pyranose or a derivative thereof, or a deoxypyranose or a derivative thereof, or a ribose or a derivative thereof, or a deoxyribose or a derivative thereof. In one embodiment, the substituted sugar moiety is a 2′-O-methoxyethyl sugar moiety.

[0121] The modified ASOs can also include one or more nucleobase (commonly referred to in the art simply as "base") modifications or substitutions, for example, 5-substituted pyrimidines, 6-aza pyrimidines, and N-2, N-6, and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine. Certain nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the present invention. 5-Methylcytosine substitution has been shown to increase nucleic acid duplex stability by 0.6 - 1.2 °C.

[0122] Another modification of the ASOs of the present invention includes chemically linking one or more groups or conjugates that enhance ASO activity, cellular distribution, or cellular uptake to the ASO. Such groups include, but are not limited to, lipid groups (such as cholesterol groups), bile acids, thioethers (such as hexyl-thio-triphenylmethanethiol), thiolcholesterol, aliphatic chains (such as dodecanediol or undecyl residues), phospholipids (such as di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-hydrogen-phosphate), polyamines or polyethylene glycol chains, or adamantaneacetic acid, palmitoyl groups, or octadecylamine or hexylamino-carbonyl-hydroxy cholesterol groups.

[0123] Another modification of the ASO includes morpholino-based ASOs. Morpholino oligomers refer to oligomers that contain morpholino subunits that support nucleobases and contain a morpholino ring instead of ribose. Exemplary internucleotide linkages include, for example, phosphoramidate or diamidophosphate internucleotide linkages that connect the morpholino ring nitrogen of one morpholino subunit to the 4'-exocyclic carbon of an adjacent morpholino subunit. Each morpholino subunit includes a purine or pyrimidine nucleobase that effectively binds to the base in the oligonucleotide through base-specific hydrogen bonding.

[0124] Morpholino-based ASOs (including modified ASOs) are described in detail, for example, in U.S. Pat. Nos. 5,698,685; 5,217,866; 5,142,047; 5,034,506; 5,166,315; 5,185,444; 5,521,063; 5,506,337. The entire content thereof is hereby incorporated herein by reference.

[0125] In an ASO structure, the phosphate group is commonly referred to as forming the "internucleotide linkage" of the ASO. The native internucleotide linkage of RNA and DNA is a 3′ to 5′ phosphodiester bond. The "phosphoramidate" group includes a phosphorus with three linked oxygen atoms and one linked nitrogen atom, while the "diamidophosphate" group includes a phosphorus with two linked oxygen atoms and two linked nitrogen atoms. The "phosphorotriamide" group (or phosphotriamide group) includes a phosphorus with one linked oxygen atom and three linked nitrogen atoms. In the uncharged or cationic internucleotide linkages of the morpholino-based ASOs of the present invention, one nitrogen always hangs on the linkage chain. The second nitrogen, in the diamidophosphate linkage, is typically the ring nitrogen in the morpholine ring structure.

[0126] There is no need for uniform modification at all positions in a given ASO. In fact, more than one of the above-mentioned modifications can be included in a single nucleoside within an ASO. ASOs can include at least one region where the ASO is modified to confer increased resistance to nuclease degradation, increased cellular uptake, and / or additional regions for increasing binding affinity to the target nucleic acid.

[0127] Manufacture of antisense oligonucleotides

[0128] The antisense molecules used in the present invention can be prepared by well-known solid-phase synthesis techniques. Equipment for such synthesis can be obtained from a variety of sources, including, for example, Applied Biosystems (Foster City, Calif). A method for synthesizing oligonucleotides on a modified solid support is described in U.S. Patent 4,458,066.

[0129] Any other means known in the art for such synthesis can be used additionally or alternatively. The use of similar techniques to prepare oligonucleotides, such as phosphorothioates and alkylated derivatives, is well known. In one such automated embodiment, diethyl-phosphoramidite is used as the starting material and the synthesis can be carried out as described by Beaucage et al., (1981) Tetrahedron Letters, 22:1859-1862.

[0130] The ASOs of the present invention are synthesized in vitro and do not include antisense compositions of biological origin. The ASOs of the present invention can also be mixed, encapsulated, conjugated, or otherwise combined with mixtures of other molecules, molecular structures, or compounds, such as liposomes, receptor-targeting molecules, oral, rectal, topical, or other formulations, to assist in their uptake, distribution, and / or absorption.

[0131] Method for preventing or reducing exon 8 skipping during pre - mRNA splicing

[0132] The above ASOs can be used to prevent or reduce exon 8 skipping during processing of the precursor mRNA transcribed from the mutant (c.919-2A>G) SLC26A4 gene.

[0133] Thus, in one embodiment, a method is disclosed for using ASOs to prevent or reduce exon 8 skipping in the mutant (c.919-2A>G) SLC26A4 gene during precursor mRNA splicing by introducing the ASO into a cell, wherein the ASO comprises all or part of SEQ ID NO.1, wherein the ASO hybridizes to the intron 8 target region of the SLC26A4 gene, and wherein the ASO prevents or reduces exon 8 skipping during splicing of the precursor mRNA of the SLC26A4 gene. In another embodiment, the ASO administered to prevent or reduce exon 8 skipping during precursor mRNA splicing comprises one of SEQ ID NOs. 2-10.

[0134] In one embodiment, the ASO is administered alone as a so-called "naked" ASO. Naked ASOs are synthesized in vitro. The naked ASOs can be introduced into cells to directly hybridize to the intron 8 target region of the SLC26A4 gene to prevent or reduce exon 8 skipping during precursor mRNA splicing.

[0135] In another embodiment, the ASO is administered in the form of an expression vector, wherein the expression vector encodes an RNA transcript comprising the ASO sequence of the present invention. When the expression vector is placed under conditions conducive to the expression of the encoded ASO, the expression vector can express the encoded ASO, which can hybridize to the intron 8 target region of the SLC26A4 gene to prevent or reduce exon 8 skipping during precursor mRNA splicing. The expression vector can be a viral or non-viral vector. In one embodiment, a plasmid-based expression vector is provided that comprises an expression cassette or transcription cassette that drives the expression or transcription of an ASO for redirecting splicing according to the present invention.

[0136] Cells can be provided with an ASO for redirecting splicing according to the present invention by plasmid-derived ASO expression or viral expression provided by a vector based on cytomegalovirus, adenovirus, or adeno-associated virus. The expression can be driven by an RNA polymerase II promoter (Pol II) (such as the U7 RNA promoter) or an RNA polymerase III (Pol III) promoter (such as the U6 RNA promoter). In one embodiment, the delivery vehicle is a vector, such as the pCI-neo vector and the like. In addition, plasmids and artificial chromosomes can be used for targeted homologous recombination, and integration of cells into the human genome can be appropriately applied to deliver an ASO for redirecting splicing according to the present invention.

[0137] Methods for introducing "naked" ASOs or expression vectors encoding ASOs into cells are well known in the art. The ASO or the expression vector encoding the ASO can be introduced by transfection using known transfection agents. In one embodiment, the use of excipients or transfection agents facilitates the delivery of the ASO or the expression vector encoding the ASO as defined in the present invention to and / or into cells. In another embodiment, the excipient or transfection agent is capable of forming complexes, nanoparticles, micelles, vesicles, and / or liposomes to deliver each ASO or the expression vector encoding each ASO as defined in the present invention, complexing it with the vesicle or liposome or capturing it therein through the cell membrane. Many of these excipients are known in the art. Suitable excipients or transfection agents include, but are not limited to, LipofectAMINE TM 2000 (Invitrogen), polyethylenimine (PEI; ExGen500 (MBI Fermentas)) or its derivatives, or similar cationic polymers, including polypropylenimine or polyethylenimine copolymers (PECs) and derivatives, synthetic amphiphiles (SAINT-18), Lipofectin TM , DOTAP, and / or viral capsid proteins, which are capable of self-assembling into particles that can deliver each ASO or the expression vector encoding each ASO as defined in the present invention to cells. Such excipients have been shown to be effective in delivering oligonucleotides (such as ASOs) to a variety of cultured cells. Their high transfection potential is combined with excellent low to moderate toxicity in terms of the survival of the overall cells. The ease of structural modification can be used to further modify and analyze their further (in vivo) nucleic acid transfer properties and toxicity.

[0138] Therapeutic methods

[0139] The above-mentioned ASOs can be used to treat hearing loss in subjects suffering from Pendred syndrome.

[0140] Accordingly, in one embodiment, the present invention also describes a method of treating hearing loss in a subject with Pendred syndrome using ASOs, comprising administering a therapeutically effective amount of all or a portion of SEQ ID NO.1.

[0141] In another embodiment, the ASO administered for treating hearing loss in a subject with Pendred syndrome comprises one of SEQ ID NOs. 2-10.

[0142] The amount of ASO administered in the pharmaceutical composition may depend on the subject being treated, the subject's body weight, the mode of administration, and the judgment of the prescribing physician. For example, the dosing regimen may involve administering the pharmaceutical composition at a perceived dose of about 1 μg to about 1000 mg daily or semi-daily. In another embodiment, intermittent dosing (e.g., monthly or annually) of the pharmaceutical composition may be employed. According to standard dosing regimens, a physician will readily be able to determine the optimal dose and will be able to readily modify the dosing to achieve such a dose.

[0143] The therapeutically effective amount of the compounds or compositions disclosed in the present invention can be measured by the therapeutic efficacy of the compounds. However, the dose may vary depending on the needs of the patient, the severity of the condition being treated, and the compound being used. In one embodiment, the therapeutically effective amount of the disclosed compounds is sufficient to establish a maximum plasma concentration. Initial doses (e.g., determined according to animal trials), as well as the scaling of human dosing, are carried out according to practices well recognized in the art.

[0144] Toxicity and therapeutic effects can be determined by standard pharmaceutical procedures in cell culture or experimental animals, e.g., for determining LD 50 (the dose lethal to 50% of the population) and ED 50 (the dose therapeutically effective for 50% of the population). The dose ratio between toxicity and therapeutic effect is the therapeutic index, which can be expressed as the LD 50 / ED 50 ratio. Compositions with a larger therapeutic index are preferred.

[0145] Data obtained from cell culture assays or animal studies can be used to formulate a dose range for humans. The therapeutically effective dose obtained in one animal model can be converted using conversion factors known in the art for use in another animal, including humans (see, e.g., Freireich et al., Cancer Chemother.Reports 50(4):219-244(1966)).

[0146] The above-mentioned ASOs can be administered in the form of a pharmaceutical composition, which comprises a therapeutically effective amount of an ASO and a pharmaceutically acceptable excipient, diluent, preservative, solubilizer, emulsifier, adjuvant, and / or carrier. The composition comprises diluents having various buffer components (e.g., Tris-HCl, acetate, phosphate), pH values, and ionic strengths, as well as additives such as detergents and solubilizers (e.g., Tween 80, polysorbate 80), antioxidants (e.g., ascorbic acid, sodium metabisulfite), preservatives (e.g., thimerosal, benzyl alcohol), and filling substances (e.g., lactose, mannitol). The materials can be incorporated into particulate formulations of polymeric compounds such as polylactic acid, polyglycolic acid, etc., or liposomes. Hyaluronic acid can also be used. The composition can affect the physical state, stability, in vivo release rate, and in vivo clearance rate of the proteins and derivatives of the present invention. The composition can be prepared in liquid form or can be prepared in dry powder form, such as lyophilized form.

[0147] Administration

[0148] A pharmaceutical composition comprising an ASO and a pharmaceutically acceptable carrier or excipient can be prepared for administration according to techniques well known in the pharmaceutical industry. Such techniques include, but are not limited to, combining the ASO with the carrier and / or excipient into a unit dosage form.

[0149] Compositions suitable for oral administration can exist in discrete units, such as capsules, cachets, lozenges, or tablets, each unit containing a predetermined amount of a compound of the present invention, which is in the form of a powder or granule; a solution or suspension in an aqueous or non-aqueous liquid; or an oil-in-water or water-in-oil emulsion. As shown, such formulations can be prepared by any suitable pharmaceutical method, which includes the step of combining at least one embodiment of the present invention as an active compound with a carrier or excipient, which may constitute one or more accessory ingredients. The carrier must be acceptable in the sense of being compatible with the other ingredients of the formulation and not harmful to the recipient. The carrier can be solid or liquid, or both, and can be formulated with at least one compound of the present invention as an active compound into a unit dosage form, such as a tablet, which can contain from about 0.05% to about 95% (by weight) of at least one active compound. There may also be other pharmacologically active substances, including other compounds. The formulations of the present invention can be prepared by any well-known pharmaceutical technique mainly consisting of mixing the components.

[0150] For solid compositions, conventional non-toxic solid carriers include, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, talc, cellulose, glucose, sucrose, magnesium carbonate, etc. Liquid pharmaceutically administrable compositions can be prepared by, for example, dissolving or dispersing at least one active compound as described in the present invention and, optionally, a pharmaceutical adjuvant in an excipient such as water, saline, aqueous glucose solution, glycerol, ethanol, etc., thereby forming a solution or suspension. Generally, suitable formulations can be prepared by uniformly and intimately mixing at least one active compound of the present invention with a liquid and / or finely divided solid carrier and then, if desired, shaping the product. For example, tablets can be prepared by compressing or molding powders or granules of at least one embodiment of the present invention, which can optionally be combined with one or more accessory ingredients. Compressed tablets can be prepared by compressing in a suitable machine at least one embodiment of the present invention in a free-flowing form (such as powder or granules), which can optionally be mixed with a binder, lubricant, inert diluent, and / or surfactant / dispersant. Molded tablets can be prepared by molding in a suitable machine, where at least one embodiment of the present invention in powder form is moistened with an inert liquid diluent.

[0151] Formulations suitable for oral (sublingual) administration include flavored lozenges containing at least one embodiment of the present invention, the flavor base typically being sucrose and gum arabic or tragacanth, and inert base lozenges containing at least one compound, the inert base such as gelatin and glycerol or sucrose and gum arabic.

[0152] Formulations suitable for parenteral administration include sterile aqueous formulations of at least one embodiment of the present invention, which are approximately isotonic with the blood of the intended recipient. These formulations are administered intravenously, although administration may also be effected by subcutaneous, intramuscular, intraperitoneal, intracerebroventricular, or intradermal injection. Such formulations can be conveniently prepared by mixing at least one embodiment as described in the present invention with water and rendering the resulting solution sterile and isotonic with the blood. Injectable compositions of the present invention can contain from about 0.1% to about 5% w / w of the active compound.

[0153] Formulations suitable for rectal administration are in the form of unit-dose suppositories. These can be prepared by mixing at least one embodiment as described in the present invention with one or more conventional solid carriers, such as cocoa butter, and then shaping the resulting mixture.

[0154] Formulations suitable for topical application to the skin can be in the form of ointments, creams, lotions, pastes, gels, sprays, aerosols, or oils. Carriers and excipients that can be used include petrolatum, lanolin, polyethylene glycol, alcohols, and combinations of two or more thereof. The ASO is generally present in the composition at a concentration of from about 0.1% to about 15% w / w, such as from about 0.5% to about 2%.

[0155] Examples

[0156] The following examples are used to describe the present invention more comprehensively. The examples are for illustrative purposes and do not limit the present invention in any way.

[0157] Materials and Methods

[0158] Antisense oligonucleotides (ASOs) modified with 2′-O-methoxyethyl (MOE) ribose and phosphorothioate (PS) backbone and containing 5-methylcytosine in place of all cytosines were purchased from Biosyntech Co., Ltd. (Suzhou, China) and dissolved in DEPC-treated water at a stock solution of 20 μM. A human SLC26A4 minigene c.919-2A>G mutant (1212 bp) was constructed in the pCI-neo vector through two steps. The mutant included 153-nt exon 7, 100-nt intron 7, 83-nt exon 8, a shortened 701-nt intron 8 (382 + 6 + 313), 148-nt exon 9, and the first 27-nt sequence of intron 9. First, a 718-nt genomic DNA fragment (the first 382-bp sequence from exon 7 to intron 8) was cloned into the restriction sites XhoI and XbaI in the vector, and then a 488-bp genomic DNA fragment (the last 313-bp sequence of intron 8 to the first 27-nt sequence of intron 9) was cloned into the restriction sites XbaI and NotI.

[0159] LipofectAMINE TM 2000 was used to transiently co-transfect each ASO with the SLC26A4 minigene mutant into HEK293 cells. After 48 hours of transfection, the cells were collected and total RNA was isolated. Transcripts were amplified by semi-quantitative RT-PCR using Cy5-conjugated primers. The Cy5-labeled PCR products were separated on a 6% native polyacrylamide gel and then imaged using a G:BOX ChemXL or FluorChem M system. The inclusion percentage (%) of exon 8 was calculated using Image J software. %incl = full-length transcript / (full-length transcript + transcript with exon 8 skipped).

[0160] Results

[0161] Human SLC26A4 Exon 8 with -2A>G Mutation

[0162] Exon 8 (uppercase), flanking intron sequences (lowercase), and c.919-2A>G mutation is:

[0163] <gtaagtagaatatgtagttagaaagttcagcattatttggttgacaaacaaggaattattaaaaccaatggagtttttaacatcttttgttttattt gACGATAATTGCTACTGCCATTTCATATGGAGCCAACCTGGAAAAAAATTACAATGCTGGCATTGTTAAATCCATCCCAAGGGGgtgagtg tggtgttcctcttagtactaataca ttaagtcagtaagtcagtcttttttatttaaataaaaccttttattacaagcttca(SEQ ID NO.40)>。

[0164] Using the above microgene system, a large number of ASOs targeting sequences within 81 nucleotides at the 3′ end of exon 8 and 74 nucleotides at the 5′ end of intron 8 were designed and screened. Multiple ASOs promoted the splicing of exon 8 in cultured cells ( Figure 1 ). The ASO sequences and splicing data are shown in Table 1-2. We identified a 25-nt extension segment (underlined above) in intron 8 as the ideal ASO target. The sequence (5′-tggtgttcctcttagtactaataca-3′ (SEQ ID NO.41)) starts at position 8 of intron 8 and extends to position 32 of this intron.

[0165] Table 1

[0166]

[0167]

[0168] HEK293 cells were co-transfected with each ASO (10 nM) and the SLC26A4 microgene mutant. The inclusion percentage of exon 8 in untreated cells was approximately 30%. The inclusion percentage of exon 8 in cells treated with a 10 nM control ASO (5′-UUCUCCGAACGUUGACGUTT-3′ (SEQ ID NO.80)) was approximately 26%. Many ASOs effectively promoted the inclusion of exon 8. >58% incl: The inclusion percentage of exon 8 was higher than 58% after treatment with 10 nM ASO.

[0169] Table 2

[0170]

[0171] In terms of their ability to correct the exon 8 splicing of the SLC26A4 c.919-2A>G mutant, the ASOs were divided into three groups, from the most effective group to the weakest group.

[0172] Figure 1 The inclusion efficiency of exon 8 of the tested ASOs is shown. The inclusion percentage of exon 8 in untreated cells (blank) was approximately 30%. The inclusion percentage of exon 8 of the negative control-treated ASO (Con ASO) was approximately 26%. Although all the tested ASOs targeted the same 25-nt sequence in intron 8, they had different degrees of exon 8 inclusion efficacy.

[0173] For example, HUA0003-1027 (SEQ ID NO.2), HUA0003-1029 (SEQ ID NO.3), and HUA0003-1030 (SEQ ID NO.4) reached an exon 8 inclusion percentage of almost 90%. However, HUA0003-1231 (SEQ ID NO.39) only reached an exon 8 inclusion percentage of 58%. Since both HUA0003-1029 (SEQ ID NO.3) and HUA0003-1231 (SEQ ID NO.39) are 20 nucleotides in length and only differ by two nucleotides, this efficacy difference is particularly significant.

[0174] Table 3

[0175]

[0176] Table 3 shows the ASOs that promote exon 8 inclusion, including their 5′-3′ sequences and their exon 8 inclusion percentages. Table 3 also shows the relationship between the tested ASOs and the conserved sequence they all share, which happens to be the same as HUA0003-1027 (SEQ ID NO.2).

[0177] Figure 2 The promotion of endogenous SLC26A4 c.919-2A>G exon 8 inclusion in patient peripheral blood mononuclear cells (PBMCs) is shown. PBMCs were isolated from a c.919-2A>G homozygous patient by density gradient centrifugation, and then the cells were cultured in Rosewell Park Memorial Instiute (RPMI) 1640 complete medium (Invitrogen). Cholesterol-conjugated ASO (dissolved in water) was added to a 12-well culture dish at 10 6 cells per well, with complete medium containing a low serum content (3% FBS). The final concentration of the ASO was 2 μM. After 48 hours, the cells were collected for RNA purification and splicing analysis.

[0178] Those of ordinary skill in the art will understand that the present invention can be modified in ways not specifically described herein. The scope of the present invention is not limited by the specific embodiments described herein, which are for illustrative purposes only.

[0179] The present invention includes any modifications and variations, including all functionally equivalent products, compositions, and methods.

[0180] The entire disclosure of all publications cited herein is incorporated herein by reference. No admission is made that any such publication constitutes prior art or is part of the common general knowledge of those of ordinary skill in the art. Sequence Listing <110> Suzhou Antianshengshi Pharmaceutical Technology Co., Ltd. <120> Antisense Oligonucleotides and Their Use in the Treatment of Pendred Syndrome <130> 13365.0018-00304 <140> 2021800066331 <141> 2021-02-11 <150> 62 / 975,337 <151> 2020-02-12 <160> 80 <170> SIPOSequenceListing 1.0 <210> 1 <211> 25 <212> DNA <213> Homo sapiens <400> 1 tgtattagta ctaagaggaa cacca 25 <210> 2 <211> 18 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note = "Artificial sequence description: synthetic oligonucleotide" <400> 2 tagtactaag aggaacac 18 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note="Artificial sequence description: synthetic oligonucleotide" <400> 3 attagtacta agaggaacac 20 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note="Artificial sequence description: synthetic oligonucleotide" <400> 4 tattagtact aagaggaaca c 21 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note="Artificial sequence description: synthetic oligonucleotide" <400> 5 gtattagtac taagaggaac ac 22 <210> 6 <211> 23 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note="Artificial sequence description: synthetic oligonucleotide" <400> 6 tgtattagta ctaagaggaa cac 23 <210> 7 <211> 22 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note = "Artificial sequence description: synthetic oligonucleotide" <400> 7 tattagtact aagaggaaca cc 22 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note = "Artificial sequence description: synthetic oligonucleotide" <400> 8 attagtacta agaggaacac c 21 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note = "Artificial sequence description: synthetic oligonucleotide" <400> 9 ttagtactaa gaggaacacc 20 <210> 10 <211> 23 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note = "Artificial sequence description: synthetic oligonucleotide" <400> 10 gtattagtac taagaggaac acc 23 <210> 11 <211> 15 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note = "Artificial sequence description: synthetic oligonucleotide" <400> 11 gcagtagcaa ttatc 15 <210> 12 <211> 15 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note = "Artificial sequence description: synthetic oligonucleotide" <400> 12 atatgaaatg gcagt 15 <210> 13 <211> 15 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note = "Artificial sequence description: synthetic oligonucleotide" <400> 13 ggttggctcc atatg 15 <210> 14 <211> 15 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note = "Artificial sequence description: synthetic oligonucleotide" <400> 14 tttttttcca ggttg 15 <210> 15 <211> 15 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note="Artificial sequence description: synthetic oligonucleotide" <400> 15 agcattgtaa ttttt 15 <210> 16 <211> 15 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note="Artificial sequence description: synthetic oligonucleotide" <400> 16 taacaatgcc agcat 15 <210> 17 <211> 15 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note="Artificial sequence description: synthetic oligonucleotide" <400> 17 gggatggatt taaca 15 <210> 18 <211> 15 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note="Artificial sequence description: synthetic oligonucleotide" <400> 18 tcaccccctt gggat 15 <210> 19 <211> 15 <212> DNA <213> Artificial Sequence <220> <221> source <223> / Comment = "Artificial Sequence Description: Synthetic Oligonucleotide" <400> 19 aacaccacac tcacc 15 <210> 20 <211> 15 <212> DNA <213> Artificial Sequence <220> <221> source <223> / Comment = "Artificial Sequence Description: Synthetic Oligonucleotide" <400> 20 tactaagagg aacac 15 <210> 21 <211> 15 <212> DNA <213> Artificial Sequence <220> <221> source <223> / Comment = "Artificial Sequence Description: Synthetic Oligonucleotide" <400> 21 aatgtattag tacta 15 <210> 22 <211> 15 <212> DNA <213> Artificial Sequence <220> <221> source <223> / Comment = "Artificial Sequence Description: Synthetic Oligonucleotide" <400> 22 ttactgactt aatgt 15 <210> 23 <211> 15 <212> DNA <213> Artificial Sequence <220> <221> source <223> / Comment="Artificial Sequence Description: Synthetic Oligonucleotide" <400> 23 aaagactgac ttact 15 <210> 24 <211> 15 <212> DNA <213> Artificial Sequence <220> <221> source <223> / Comment="Artificial Sequence Description: Synthetic Oligonucleotide" <400> 24 tttaaataaa aaaga 15 <210> 25 <211> 15 <212> DNA <213> Artificial Sequence <220> <221> source <223> / Comment="Artificial Sequence Description: Synthetic Oligonucleotide" <400> 25 aaaggtttta tttaa 15 <210> 26 <211> 18 <212> DNA <213> Artificial Sequence <220> <221> source <223> / Comment="Artificial Sequence Description: Synthetic Oligonucleotide" <400> 26 gtactaagag gaacacca 18 <210> 27 <211> 18 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note = "Artificial Sequence Description: Synthetic Oligonucleotide" <400> 27 agtactaaga ggaacacc 18 <210> 28 <211> 18 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note = "Artificial Sequence Description: Synthetic Oligonucleotide" <400> 28 ttagtactaa gaggaaca 18 <210> 29 <211> 18 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note = "Artificial Sequence Description: Synthetic Oligonucleotide" <400> 29 attagtacta agaggaac 18 <210> 30 <211> 18 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note = "Artificial Sequence Description: Synthetic Oligonucleotide" <400> 30 tattagtact aagaggaa 18 <210> 31 <211> 18 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note = "Artificial Sequence Description: Synthetic Oligonucleotide" <400> 31 gtattagtac taagagga 18 <210> 32 <211> 18 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note = "Artificial Sequence Description: Synthetic Oligonucleotide" <400> 32 tgtattagta ctaagagg 18 <210> 33 <211> 18 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note = "Artificial Sequence Description: Synthetic Oligonucleotide" <400> 33 atgtattagt actaagag 18 <210> 34 <211> 18 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note = "Artificial Sequence Description: Synthetic Oligonucleotide" <400> 34 aatgtattag tactaaga 18 <210> 35 <211> 18 <212> DNA <213> Artificial Sequence <220> <221> source <223> / Comment="Artificial Sequence Description: Synthetic Oligonucleotide" <400> 35 taatgtatta gtactaag 18 <210> 36 <211> 18 <212> DNA <213> Artificial Sequence <220> <221> source <223> / Comment="Artificial Sequence Description: Synthetic Oligonucleotide" <400> 36 ttaatgtatt agtactaa 18 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> source <223> / Comment="Artificial Sequence Description: Synthetic Oligonucleotide" <400> 37 tagtactaag aggaacacca 20 <210> 38 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> source <223> / Comment="Artificial Sequence Description: Synthetic Oligonucleotide" <400> 38 tattagtact aagaggaaca 20 <210> 39 <211> 20 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note = "Artificial Sequence Description: Synthetic Oligonucleotide" <400> 39 gtattagtac taagaggaac 20 <210> 40 <211> 271 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note = "Artificial Sequence Description: Synthetic Polynucleotide" <400> 40 gtaagtagaa tatgtagtta gaaagttcag cattatttgg ttgacaaaca aggaattatt 60 aaaaccaatg gagtttttaa catcttttgt tttatttcgg acgataattg ctactgccat 120 ttcatatgga gccaacctgg aaaaaaatta caatgctggc attgttaaat ccatcccaag 180 ggggtgagtg tggtgttcct cttagtacta atacattaag tcagtaagtc agtctttttt 240 atttaaataa aaccttttat tacaagcttc a 271 <210> 41 <211> 25 <212> DNA <213> Homo sapiens <400> 41 tggtgttcct cttagtacta ataca 25 <210> 42 <211> 15 <212> DNA <213> Homo sapiens <400> 42 gataattgct actgc 15 <210> 43 <211> 15 <212> DNA <213> Homo sapiens <400> 43 actgccattt catat 15 <210> 44 <211> 15 <212> DNA <213> Homo sapiens <400> 44 catatggagc caacc 15 <210> 45 <211> 15 <212> DNA <213> Homo sapiens <400> 45 caacctggaa aaaaa 15 <210> 46 <211> 15 <212> DNA <213> Homo sapiens <400> 46 aaaaattaca atgct 15 <210> 47 <211> 15 <212> DNA <213> Homo sapiens <400> 47 atgctggcat tgtta 15 <210> 48 <211> 15 <212> DNA <213> Homo sapiens <400> 48 tgttaaatcc atccc 15 <210> 49 <211> 15 <212> DNA <213> Homo sapiens <400> 49 atcccaaggg ggtga 15 <210> 50 <211> 15 <212> DNA <213> Homo sapiens <400> 50 ggtgagtgtg gtgtt 15 <210> 51 <211> 15 <212> DNA <213> Homo sapiens <400> 51 gtgttcctct tagta 15 <210> 52 <211> 15 <212> DNA <213> Homo sapiens <400> 52 tagtactaat acatt 15 <210> 53 <211> 15 <212> DNA <213> Homo sapiens <400> 53 acattaagtc agtaa 15 <210> 54 <211> 15 <212> DNA <213> Homo sapiens <400> 54 agtaagtcag tcttt 15 <210> 55 <211> 15 <212> DNA <213> Homo sapiens <400> 55 tcttttttat ttaaa 15 <210> 56 <211> 15 <212> DNA <213> Homo sapiens <400> 56 ttaaataaaa ccttt 15 <210> 57 <211> 18 <212> DNA <213> Homo sapiens <400> 57 tggtgttcct cttagtac 18 <210> 58 <211> 18 <212> DNA <213> Homo sapiens <400> 58 ggtgttcctc ttagtact 18 <210> 59 <211> 18 <212> DNA <213> Homo sapiens <400> 59 gtgttcctct tagtacta 18 <210> 60 <211> 18 <212> DNA <213> Homo sapiens <400> 60 tgttcctctt agtactaa 18 <210> 61 <211> 18 <212> DNA <213> Homo sapiens <400> 61 gttcctctta gtactaat 18 <210> 62 <211> 18 <212> DNA <213> Homo sapiens <400> 62 ttcctcttag tactaata 18 <210> 63 <211> 18 <212> DNA <213> Homo sapiens <400> 63 tcctcttagt actaatac 18 <210> 64 <211> 18 <212> DNA <213> Homo sapiens <400> 64 cctcttagta ctaataca 18 <210> 65 <211> 18 <212> DNA <213> Homo sapiens <400> 65 ctcttagtac taatacat 18 <210> 66 <211> 18 <212> DNA <213> Homo sapiens <400> 66 tcttagtact aatacatt 18 <210> 67 <211> 18 <212> DNA <213> Homo sapiens <400> 67 cttagtacta atacatta 18 <210> 68 <211> 18 <212> DNA <213> Homo sapiens <400> 68 ttagtactaa tacattaa 18 <210> 69 <211> 20 <212> DNA <213> Homo sapiens <400> 69 tggtgttcct cttagtacta 20 <210> 70 <211> 20 <212> DNA <213> Homo sapiens <400> 70 ggtgttcctc ttagtactaa 20 <210> 71 <211> 20 <212> DNA <213> Homo sapiens <400> 71 gtgttcctct tagtactaat 20 <210> 72 <211> 20 <212> DNA <213> Homo sapiens <400> 72 tgttcctctt agtactaata 20 <210> 73 <211> 20 <212> DNA <213> Homo sapiens <400> 73 gttcctctta gtactaatac 20 <210> 74 <211> 21 <212> DNA <213> Homo sapiens <400> 74 ggtgttcctc ttagtactaa t 21 <210> 75 <211> 21 <212> DNA <213> Homo sapiens <400> 75 gtgttcctct tagtactaat a 21 <210> 76 <211> 22 <212> DNA <213> Homo sapiens <400> 76 ggtgttcctc ttagtactaa ta 22 <210> 77 <211> 22 <212> DNA <213> Homo sapiens <400> 77 gtgttcctct tagtactaat ac 22 <210> 78 <211> 23 <212> DNA <213> Homo sapiens <400> 78 ggtgttcctc ttagtactaa tac 23 <210> 79 <211> 23 <212> DNA <213> Homo sapiens <400> 79 gtgttcctct tagtactaat aca 23 <210> 80 <211> 21 <212> DNA / RNA <213> Artificial Sequence <220> <221> source <223> / note="Description of artificial sequence: synthetic oligonucleotide" <220> <221> source <223> / note="Description of combined DNA / RNA molecule: synthetic oligonucleotide" <400> 80 uucuccgaac gugucacgut t 21

Claims

1. An antisense oligonucleotide having a length of 10 - 30 nucleotides, characterized in that, Comprising all or part of SEQ ID NO:1, the antisense oligonucleotide is: a. SEQ ID NO:2; b. SEQ ID NO:3; c. SEQ ID NO:4; d. SEQ ID NO:5; e. SEQ ID NO:6; f. SEQ ID NO:7; g. SEQ ID NO:8; h. SEQ ID NO:9; or i. SEQ ID NO:

10.

2. The antisense oligonucleotide according to claim 1, wherein The antisense oligonucleotide comprises a non-natural backbone.

3. The antisense oligonucleotide according to claim 2, wherein The non-natural backbone is a modified sugar moiety.

4. The antisense oligonucleotide according to claim 3, wherein The modified sugar moiety is 2'-O-methoxyethyl ribose.

5. The antisense oligonucleotide according to claim 2, wherein The non-natural backbone is a modified phosphate.

6. The antisense oligonucleotide according to claim 5, wherein The modified phosphate is phosphorothioate.

7. The antisense oligonucleotide according to claim 1, wherein The antisense oligonucleotide comprises a modified nitrogenous base.

8. The antisense oligonucleotide according to claim 7, wherein The modified nitrogenous base is 5-methylcytosine base.

9. Use of the antisense oligonucleotide according to any one of claims 1-8 in the preparation of a medicament for treating hearing loss in a subject suffering from Pendred syndrome.

10. The application according to claim 9, characterized in that, The treatment comprises administration by parenteral administration.

11. The application according to claim 9 or 10, characterized in that, The antisense oligonucleotide is used in the preparation of the medicament in the form of a naked antisense oligonucleotide or an expression vector encoding the antisense oligonucleotide.

12. The application according to claim 11, characterized in that, The expression vector is a pCI-neo expression vector.

13. A pharmaceutical composition comprising the antisense oligonucleotide according to any one of claims 1-8.

14. The pharmaceutical composition according to claim 13, wherein, It further comprises a pharmaceutically acceptable carrier or excipient.

Images