Gene PlYPK1 and its application in controlling litchi downy blight

Abstract

The present invention discloses a gene P1YPK1 and its application in preventing and controlling litchi downy mildew, belonging to the technical field of green prevention and control of crop diseases. The present invention applies a polyethylene glycol-mediated protoplast transformation technology and a CRISPR / Cas9 knockout strategy, constructs a P1YPK1 knockout vector and transforms the protoplasts mediated by PEG, and knocks out the gene P1YPK1 from litchi downy mildew by a homologous recombination method to obtain a knockout mutant. Compared with the wild type, the mutant has basically the same growth rate, significantly weakened pathogenicity, and significantly reduced oospore production. The present invention confirms that P1YPK1 is necessary for the growth, development, infection and pathogenicity of litchi downy mildew. Our research helps to further clarify the pathogenic molecular mechanism of litchi downy mildew and provides a target gene for the development of effective fungicides.

Description

Technical Field

[0001] The invention belongs to the technical field of green prevention and control of crop diseases, and particularly relates to a gene PlYPK1 and an application thereof in preventing and controlling litchi downy mildew. Background Art

[0002] The disease caused by infection of Peronophythora litchii (Peronophythora litchii Chen ex Ko et al.) is litchi downy blight, and its host plant is litchi. The pathogen belongs to the subphylum Mastigomycetes, class Oomycetes, order Peronosporales, and family Peronophthoraceae. The litchi downy blight caused by Peronophythora litchii is the most serious on litchi, and no effective disease-resistant litchi planting variety has been found. At present, the prevention and control of litchi downy blight is still mainly based on pesticide prevention and control, which has a high risk of drug resistance and pollutes the environment. Therefore, it is of great significance to study the pathogenic mechanism of litchi downy blight.

[0003] Studies have shown that the successful infection of litchi by litchi downy mildew mainly depends on a series of pathogenic factors. Therefore, fully exploring litchi pathogenicity-related genes and conducting functional research are of great significance for effectively controlling the damage of litchi downy mildew and breeding disease-resistant varieties.

[0004] YPK1 protein is a serine-threonine kinase involved in signal transduction and a member of the AGC protein kinase family. In litchi downy mildew, P1YPK1 plays an important role in the pathogenic mechanism. In Saccharomyces cerevisiae, the loss of ScYPK1 leads to growth defects in Saccharomyces cerevisiae. In Phytophthora sojae, PsYPK1 is involved in the formation of sporangia and oospores, and the pathogenicity of PsYPK1 knockout transformants to soybean hypocotyls is significantly reduced. Summary of the invention

[0005] In view of the defects or shortcomings in the prior art, the primary purpose of the present invention is to provide a litchi downy mildew pathogenicity-related protein PlYPK1.

[0006] Another object of the present invention is to provide biological materials related to the above-mentioned litchi downy mildew pathogenicity-related protein PILPK1.

[0007] Another object of the present invention is to provide the application of the above-mentioned litchi downy mildew pathogenicity-related protein PILPK1 or biological material.

[0008] In order to achieve the above-mentioned object of the invention, the present invention adopts the following technical solutions:

[0009] The present invention discloses a previously unknown protein PlYPK1 of litchi downy mildew and its encoding gene PlYPK1. The full length of the gene PlYPK1 is shown in SEQ ID NO.1, and its CDS sequence is shown in SEQ ID NO.2, encoding a total of 876 amino acids, as shown in SEQ ID NO.3. The present invention utilizes CRISPR / Cas9 gene editing technology to construct pBSSK::PlYPK1 and PYF2.3G-ribo-sgRNA1::PlYPK1 and PYF2.3G-ribo-sgRNA2::PlYPK1 knockout vectors and knocks out the PlYPK1 gene through PEG-mediated protoplast transformation technology. Finally, knockout mutants T13, T28, and T52 (named according to the numbering sequence of transformant verification) were obtained, and the three mutants had obvious defects in the growth and development process of litchi downy mildew. The results of pathogenicity determination showed that the knockout mutants T13, T28, and T52 of the gene PlYPK1 significantly reduced their pathogenicity to young leaves of litchi (variety: Nuomici). The above experiment proved that the PlYPK1 gene of litchi downy mildew is a pathogenicity-related gene of litchi downy mildew. PlYPK1 was complemented in litchi downy mildew to obtain a complemented transformant C. After the pathogenicity determination, it was found that the pathogenicity was restored after the PlYPK1 gene was complemented.

[0010] A litchi downy mildew pathogenicity-related protein PlYPK1, whose amino acid sequence is shown in SEQ ID NO.3, or a similar sequence having the same or similar function obtained by replacing, inserting or deleting one or more amino acids in SEQ ID NO.3.

[0011] The above-mentioned biological material related to the litchi downy mildew pathogenicity-related protein PlYPK1 is any one or more combinations of the following biological materials:

[0012] 1) A nucleic acid molecule encoding the litchi downy mildew pathogenicity-related protein PlYPK1;

[0013] 2) an expression cassette containing the nucleic acid molecule described in 1);

[0014] 3) A recombinant vector containing the nucleic acid molecule described in 1), or a recombinant vector containing the expression cassette described in 2);

[0015] 4) a recombinant microorganism containing the nucleic acid molecule described in 1), or a recombinant microorganism containing the expression cassette described in 2), or a recombinant microorganism containing the recombinant vector described in 3);

[0016] 5) a nucleic acid sequence that inhibits or blocks the gene expression of the litchi downy mildew pathogenicity-related protein P1YPK1;

[0017] 6) A gene knockout vector for inhibiting or blocking the gene expression of the litchi downy mildew pathogenicity-related protein PlYPK1 prepared using the nucleic acid sequence described in 5);

[0018] 7) A litchi downy mildew-deficient protein PlYPK1 related to litchi downy mildew prepared by using the gene knockout vector described in 6).

[0019] Furthermore, the nucleic acid molecule in 1) is the gene sequence of the litchi downy mildew pathogenicity-related protein PlYPK1, as shown in SEQ ID NO: 1, or the CDS sequence of the litchi downy mildew pathogenicity-related protein PlYPK1, as shown in SEQ ID NO: 2, or a similar sequence having the same or similar function obtained by base insertion, deletion, or substitution as shown in SEQ ID NO.1.

[0020] Furthermore, the nucleic acid sequence in 5) is antisense RNA, siRNA, shRNA or sgRNA of the PlYPK1 gene.

[0021] Furthermore, the sgRNA is represented by any of the following sequences:

[0022] sgRNA1: 5'-TTTGTGCGCCAATCCGGACGAGCTTACTCGTTTCGTCCTCACGGACTCATCAGCGGATTGCTAG-3';

[0023] sgRNA2: 5'-TTTAGCGCCGAAGGAAGACGAGCTTACTCGTTTCGTCCTCACGGACTCATCAGTTCCTTGCTAG-3'.

[0024] The application of the above-mentioned litchi downy mildew pathogenicity-related protein PlYPK1 or biological material is any one or more combinations of the following applications:

[0025] i) Application in regulating the pathogenicity of litchi downy mildew;

[0026] ii) Application in regulating the expression level of genes related to litchi downy mildew pathogenicity;

[0027] iii) Application in regulating the growth of litchi downy mildew;

[0028] iv) Application in regulating the oospore formation of Lychee Downy Phytophthora;

[0029] v) Application in the prevention and treatment of litchi frost blight;

[0030] ⅵ) Application as a target in the design and screening of drugs against litchi downy mildew.

[0031] A method for preventing and controlling litchi downy blight caused by litchi downy phyton, which is achieved by inhibiting or blocking the gene expression of the litchi downy phyton pathogenicity-related protein PILPK1.

[0032] A drug screening model against litchi downy mildew, wherein the drug screening model is a litchi downy mildew gene defective type of the litchi downy mildew pathogenicity-related protein PlYPK1.

[0033] The method for constructing the above-mentioned anti-litchi downy mildew drug screening model comprises the following steps:

[0034] (1) Design sgRNA according to the PlYPK1 gene sequence using the sgRNA website, connect the sgRNA with the pYF2.3G-Ribo-sgRNA vector to obtain the PlYPK1 gene knockout plasmid pYF2.3G-Ribo-sgRNA::PlYPK1;

[0035] Alternatively, primers for amplifying the left and right homology arms are designed based on the sequences of about 1 kb upstream and downstream of the PlYPK1 gene sequence, and the left and right homology arms are amplified using the genomic DNA of Peronophythora litchii as a template, and connected with the pBSSK vector to obtain the PlYPK1 gene knockout plasmid pBSSK::PlYPK1;

[0036] (2) The PlYPK1 gene knockout plasmid pYF2.3G-Ribo-sgRNA::PlYPK1 or pBSSK::PlYPK1 was introduced into the protoplasts of the wild-type strain of litchi downy mildew, and after screening and verification, the PlYPK1 gene knockout mutant was obtained, which is the litchi downy mildew drug screening model.

[0037] Furthermore, the sgRNA described in step (1) is any of the following sequences:

[0038] sgRNA1: 5'-CAACTACCTGATGAGTCCGTGAGGACGAAACGAGTAAGCTCGTCGTAGTTGCCCTAATGGATAG-3';

[0039] sgRNA2: 5'-CTCGTTGCTGATGAGTCCGTGAGGACGAAACGAGTAAGCTCGTCCAACGACAGCAGAATGGATG-3'.

[0040] Furthermore, the left and right homology arm amplification primers described in step (1) are as follows:

[0041] Left homology arm amplification primer:

[0042] PlYPK1-Left-F: 5'-CTAGAACTAGTGGATCCCCTCAGTAACATATTGGTGGT-3';

[0043] PlYPK1-Left-R: 5'-CCACCAACGTCAGGGCTCAACGACAAGATTCAACTGTTCT-3';

[0044] Right homology arm amplification primers:

[0045] PlYPK1-Right-F: 5'-AGAACAGTTGAATCTTGTCGTTGAGCCCTGACGTTGGTGG-3';

[0046] PlYPK1-Right-R: 5'-ATCGAATTCCTGCAGCCCCGCCATCGGCTTGAG-3'.

[0047] Compared with the prior art, the present invention has the following advantages and effects:

[0048] The present invention proves through experiments that the upstream and downstream sequences of the gene P1YPK1 are amplified respectively, connected to the vector pBSSK (kindly donated by the Oomycete and Fungal Molecular Biology Laboratory of the College of Plant Protection of Nanjing Agricultural University), and the obtained mutant has no significant difference in growth rate compared with the wild type through the protoplast transformation technology mediated by Polyethylene glycol (PEG) and the CRISPR / Cas9 knockout strategy after homologous recombination. The strain basically does not produce sporangia and oospores after fifteen days of growth. The pathogenicity test shows that the deletion of the gene P1YPK1 significantly reduces the pathogenicity of litchi downy mildew. The present invention confirms that the gene P1YPK1 is necessary for the growth and development of litchi downy mildew, the formation of oospores and the pathogenicity. Our research helps to further clarify the pathogenic molecular mechanism of litchi downy mildew, and provides a theoretical basis for discovering new drug action targets and designing new efficient, low-toxic and safe fungicides. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 It is a schematic diagram of the construction of homologous recombination of the PlYPK1 gene of Peronophytum litchii;

[0050] Figure 2 It is a PCR amplification result diagram of litchi Downy Phytophthora PLYPK1 gene knockout transformant; wherein, lane WT: litchi Downy Phytophthora wild type; lane CK: transformant transformed by PEG but not knocked out; lanes T13, T28, and T52 represent three knockout transformants of gene PLYPK1 respectively;

[0051] Figure 3The growth rates and colony morphologies of the wild type WT, the non-knockout transformant CK, and the knockout mutants T13, T28, and T52 on CA medium; a is the colony morphology, and b is the growth rate statistics;

[0052] Figure 4 The results of pathogenicity analysis of the PlYPK1 knockout mutants T13, T28, and T52; a is the infection spot image, and b is the statistical result of the infection spot diameter;

[0053] Figure 5 The following are the results of oospore yield analysis of the PlYPK1 knockout mutants T13, T28, and T52; wherein, a is the oospore morphology diagram, and b is the statistical result of oospore yield. DETAILED DESCRIPTION

[0054] The present invention is further described in detail below in conjunction with embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0055] If no specific experimental conditions are specified in the following embodiments, conventional experimental conditions or experimental conditions recommended by the reagent company are generally followed. The materials and reagents used, unless otherwise specified, are all reagents and materials obtained from commercial sources.

[0056] Example 1: Construction of PlYPK1 gene knockout vector

[0057] Test materials

[0058] Test strains, plants and vectors:

[0059] The test strain is the wild type strain of litchi downy mildew (Peronophythora litchii, Wild Type, referred to as WT), which is a conventional phytophthora fungus that can be obtained through commercial channels or isolated from nature. The Eschrichia coli strain JM109 can be obtained through commercial channels. The plant material for inoculation is young leaves of litchi (Nuomici) (collected from the horticultural practice orchard of South China Agricultural University); the oomycete knockout and transformation vectors pYF2-PsNLS-hSpCas9, pYF2.3G-Ribo-sgRNA (disclosed in the literature "Yufeng, Fang, Linkai, et al. Efficient Genome Editing in the Oomycete Phytophthora sojae Using CRISPR / Cas9 [J]. Current Protocols in Microbiology, 2017"), and pBSSK (disclosed in the literature "A CRISPR / Cas9-mediated in situ complementation method for Phytophthora sojae mutants[J].Molecular Plant Pathology,2021,22(3)”. The above vectors were kindly donated by the Laboratory of Molecular Biology of Oomycetes and Fungi, College of Plant Protection, Nanjing Agricultural University).

[0060] Main test culture medium:

[0061] Carrot agar (CA) (1 L): 300 g carrot juice was squeezed, filtered through gauze, and sterilized at 121° C. for 20 min. 1.5% (W / V) agar powder was added to the solid culture medium.

[0062] LB medium (1 L): 5 g yeast extract, 10 g tryptone, 10 g sodium chloride (NaCl), sterilized at 121° C. for 20 min. Add 1.5% (W / V) agar powder to the solid medium.

[0063] Nutrition Pea Broth (NPB) (1L): 120g fresh peas were boiled in water for 20min and filtered. 5g sorbitol (D-Sorbitol), 5g mannitol (D-Mannitol), 5g glucose, 3g potassium nitrate (KNO3), 2g calcium carbonate (CaCO3), 2g yeast extract, 1g dipotassium hydrogen phosphate (K2HPO4), 1g potassium dihydrogen phosphate (KH2PO4), 0.5g magnesium sulfate (MgSO4), 0.1g calcium chloride (CaCl2), 2mL vitamin stock and 2ml trace elements were added to the filtrate, and ddH2O was added to make up to 1L, and sterilized at 121℃ for 20min. For solid culture medium, 1.5% (W / V) Difco Bacto Agar was added.

[0064] Pea mannitol medium (Pea / 0.5mol·L -1 Manitol, PM) (1L): 120g fresh peas, boiled in water for 20min, filtered. Add 91g D-Mannitol, 2g CaCO3 and 1.32g CaCl2 to the filtrate, add ddH2O to 1L, sterilize at 121℃ for 20min. For solid culture medium, add 1.5% (W / V) Difco Bacto Agar.

[0065] Petri medium (1L): 0.5g potassium dihydrogen phosphate, 0.25g magnesium sulfate heptahydrate (MgSO4·7H2O), 1g L-asparagine, 1mg vitamin B1, 0.5g yeast extract, 10mg β-sitosterol and 5g glucose, add ddH2O to 1L, sterilize at 121℃ for 20min. Add 1.5% agar powder to the solid medium.

[0066] Construction of CRISPR / Cas9 technology-related vectors:

[0067] (1) Construction of pYF2.3G-Ribo-sgRNA::PlYPK1

[0068] According to the website for designing sgRNA (http: / / grna.ctegd.uga.edu / ), the targeting RNA (sgRNA) on the PlYPK1 gene was selected and delivered to Bioengineering for synthesis. The sgRNA annealing system was prepared according to Table 1, and the metal bath was 37°C for 30 min.

[0069] The sgRNA sequences are as follows:

[0070] PlYPK1-sgRNA1-F: 5'-CTAGCAATCCGCTGATGAGTCCGTGAGGACGAAACGAGTAAGCTCGTCCGGATTGGCGCACAAACAGT-3'

[0071] PlYPK1-sgRNA1-R: 5'-AAACACTGTTTGTGCGCCAATCCGGACGAGCTTACTCGTTTCGTCCTCACGGACTCATCAGCGGATTG-3'

[0072] PlYPK1-sgRNA2-F: 5'-CTAGCAAGGAACTGATGAGTCCGTGAGGACGAAACGAGTAAGCTCGTCTTTCCTTCGGCGCTAAATCTG-3'

[0073] PlYPK1-sgRNA2-R: 5'-AAACCAGATTTAGCGCCGAAGGAAGACGAGCTTACTCGTTTCGTCCTCACGGACTCATCAGTTCCTTG-3'.

[0074] Table 1 sgRNA double-stranded synthesis system (30 μL) (Takara)

[0075]

[0076] The reaction conditions were 37°C for 30 min, and then 4 μL of 0.5 mol·L -1 NaCl, mix well and boil in a boiling water bath for 2 minutes, then cool at room temperature for 3 to 4 hours to allow the DNA fragments to anneal to form double strands.

[0077] The targeting RNA (sgRNA) on the PlYPK1 gene was annealed to form a double strand, and then connected to the pYF2.3G-Ribo-sgRNA vector after restriction digestion (the restriction digestion system is shown in Table 2) using T4-DNA ligase. The connection system is shown in Table 3. The reaction conditions are 16°C, 12h, cooled on ice, and then transformed into Escherichia coli.

[0078] Table 2 pYF2.3G-Ribo-sgRNA vector double enzyme digestion system (50 μL) (NEB)

[0079]

[0080] Table 3 pYF2.3G-Ribo-sgRNA vector and double-stranded sgRNA ligation reaction system (10 μL) (NEB)

[0081]

[0082]

[0083] (2) Construction of pBSSK::PlYPK1 vector

[0084] The left and right homologous arms and amplification primers (PlYPK1-Left-F, PlYPK1-Left-R, PlYPK1-Right-F, PlYPK1-Right-R) were designed based on the sequences of approximately 1 kb upstream and downstream of the PlYPK1 gene.

[0085] PlYPK1-Left-F: 5'-CTAGAACTAGTGGATCCCCTCCAGTAACATATTGGTGGT-3'

[0086] PlYPK1-Left-R: 5'-CCACCAACGTCAGGGCTCAACGACAAGATTCAACTGTTCT-3'

[0087] PlYPK1-Right-F: 5'-AGAACAGTTGAATCTTGTCGTTGAGCCCTGACGTTGGTGG-3'

[0088] PlYPK1-Right-R: 5'-ATCGAATTCCTGCAGCCCCGCCATCGGCTTGAG-3'.

[0089] PCR amplification was performed using high-fidelity enzyme Phanta Max Super-Fidelity DNA Polymerase (Nanjing Novozyme), and the left and right homologous arms were amplified using litchi Downy Phytophthora genomic DNA as a template. The specific PCR amplification system is shown in Table 4:

[0090] Table 4 Phanta Max high-fidelity enzyme PCR amplification system (50 μL)

[0091]

[0092] The amplification procedure was: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 s, annealing at 56-72°C for 15 s, extension at 72°C for 30 s / kb, 34 cycles, and finally extension for 5 min. The target band was detected by electrophoresis and then recovered using the agarose gel purification recovery kit of OMEGA. For specific steps, refer to the instructions of the kit. After the product concentration was detected, the directional seamless cloning kit ClonExpress One Step Cloning Kit (Nanjing Novozyme) was used to connect with the linearized pBSSK vector (enzyme digestion system see Table 5), and the connection system is shown in Table 6.

[0093] Table 5 pBSSK restriction enzyme digestion reaction system (10 μL)

[0094]

[0095]

[0096] Table 6 pBSSK::PlYPK1 vector ligation reaction system (10 μL)

[0097]

[0098] The constructed pYF2.3G-Ribo-sgRNA1::PlYPK1, pYF2.3G-Ribo-sgRNA2::PlYPK1, and pBSSK::PlYPK1 were transformed into Escherichia coli.

[0099] (3) E. coli transformation and verification

[0100] 100 μL of E. coli competent cells JM109 were frozen and thawed on ice, 10 μL of the ligation product was added, and the mixture was mixed by tapping with fingertips, and then placed on ice for 30 min. Heat shock was performed in a 42°C water bath for 90 s, and then quickly placed on ice for 2 min. 650 μL of LB liquid culture medium was added to the tube and cultured at 37°C, 180 rpm for 1 h. The above bacterial solution was centrifuged at 4000 rpm for 4 min, the supernatant was aspirated, and the remaining 100 μL of LB culture medium was used to suspend the bacteria and spread on a plate containing a final concentration of 100 μg mL -1 The Amp was cultured on LB solid screening plates at 37°C for 12 to 16 hours.

[0101] Using a single colony of Escherichia coli as a template, the verification primers for the pYF2.3G-Ribo-sgRNA vector were M13F and RPL41_Pseq_F; the verification primers for the pBSSK vector were M13F and M13R; among them, M13F and M13R were universal primers, and the sequence of primer RPL41_Pseq_F was as follows: RPL41_Pseq_F: 5'-CAAGCCTCACTTTCTGCTGACTG-3'.

[0102] Green Taq Mix (Nanjing Novozyme) was used for colony PCR verification, and the system is as shown in Table 7:

[0103] Table 7 Colony PCR reaction system (20 μL)

[0104]

[0105] The PCR amplification procedure was as follows: pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s / kb, 34 cycles, and extension for 7 min. The amplified products were detected by gel electrophoresis, and two colonies with amplified bands that matched the target fragment size were selected and stained with 100 μg mL -1 Amp was cultured in LB liquid medium and sent for sequencing.

[0106] (4) Large-scale extraction of plasmid DNA

[0107] Select a single colony of E. coli containing the target plasmid and shake it. Add the single colony to a solution containing 100 μg mL -1 The mixture was added to 200 mL of LB liquid medium containing Amp and cultured at 37°C, 180 rpm for 12 h. The mixture was added to 200 mL of LB liquid medium containing Amp and cultured at 37°C, 180 rpm for 14 h.

[0108] Use TIANGEN's EndoFree Maxi Plasmid Kit to extract the four plasmids required for PEG-mediated transformation (pYF2-NLS-hSpCas9, pYF2.3G-Ribo-sgRNA1::PlYPK1, pYF2.3G-Ribo-sgRNA2::PlYPK1, pBSSK::PlYPK1)

[0109] Example 2: Preparation of protoplasts of Peronophytum litchii and PEG-mediated transformation

[0110] Preparation of enzymatic solution: weigh 0.15g Lysing Enzymes (SIGMA) and 0.06g Cellulase (SIGMA) in a sterile beaker, add 10mL 0.8mol·L -1 Mannitol, 8 mL sterile ddH2O, 800 μL 0.5 mol·L -1 KCl, 800 μL 0.5 mol·L -1 MES-KOH and 400 μL 0.5 mol·L -1 After CaCl2 is fully dissolved, transfer to a 50 mL centrifuge tube for later use;

[0111] Preparation of W5 solution: weigh 7.8 g Glucose, 4.6 g CaCl2, 2.25 g NaCl, 0.093 g KCl, add ddH2O to make up to 250 mL, and set aside;

[0112] Preparation of MMg solution: weigh 18.22 g of mannitol, 0.76 g of MgCl2·6H2O, and 2 mL of MES Buffer, add water to make up to 250 mL, and set aside;

[0113] The wild-type strain of Peronophytum litchii WT was activated on nutrient pea solid plate medium (NPB solid medium). The mycelium block was placed in a conical flask, and 50 mL of NPB liquid medium was added for cultivation. Three bottles were cultured in the dark at 25°C for 3 days, and shaken every 12 hours. The mycelium was collected by gauze filtration, gently squeezed with tweezers, and added to a 50 mL centrifuge tube containing enzymatic solution. After gently mixing, the enzymatic solution was hydrolyzed at 25°C and 40 rpm for 40 to 45 minutes. After the mycelium was hydrolyzed, the mycelium was quickly filtered with a 50 mL beaker wrapped with three layers of Miracloth filter cloth, and the filtrate was transferred to a 50 mL round-bottom centrifuge tube and centrifuged at 4°C and 1500 rpm for 3 minutes. The supernatant was discarded, 10 mL of W5 solution was added to resuspend the protoplasts, and then 25 mL of W5 solution was added, and the mixture was gently mixed upside down, and centrifuged at 4°C and 1500 rpm for 4 minutes. Discard the supernatant, add 7mL W5 solution to resuspend the protoplasts, and place on ice for 30min. Then centrifuge at 4℃, 1500rpm for 4min, discard the supernatant, add 6mL MMg solution to resuspend the protoplasts, and place in the greenhouse for 10min. Take 6 sterilized 50mL centrifuge tubes and place them on ice. Add 4 plasmids to each centrifuge tube: pYF2-NLS-hSpCas9, pYF2.3G-Ribo-sgRNA1::PlYPK1, pYF2.3G-Ribo-sgRNA2::PlYPK1, pBSSK::PlYPK1, 30μg each, to obtain MMg solution containing protoplasts.

[0114] Add 1 mL of MMg solution containing protoplasts to each 50 mL centrifuge tube, shake gently to mix, and place on ice for 10 min. Add 580 μL of 40% polyethylene glycol (PEG) solution to each centrifuge tube along the tube wall, and add three times in succession. During this process, slowly rotate the centrifuge tube to mix the PEG and protoplasts, and place on ice for 20 min. Add 100 mg mL PEG to pea mannitol culture medium (PM) at a dilution of 1000:1. -1Amp PM was prepared from ampicillin. Add 2 mL of Amp PM to a centrifuge tube, gently turn it upside down, and place it on ice for 2 min; continue to add 8 mL of Amp PM to the centrifuge tube, gently turn it upside down, and place it on ice for 2 min; finally, add 10 mL of Amp PM to each centrifuge tube in turn, gently turn it upside down, and place it at an angle. Incubate in the dark at 25°C for 14 to 16 hours to allow the protoplasts to regenerate. After overnight incubation, observe the regeneration of the protoplasts under a microscope, and then centrifuge at 2000 rpm for 5 min. Discard the supernatant from each centrifuge tube until 5 mL of liquid culture medium remains, suspend the precipitate, and add 30 mL of 30 μg·mL -1 Geneticin G418 pea mannitol solid medium, invert and mix, pour into two 9 cm sterile culture dishes, and culture in the dark at 25 ℃ for 2 to 3 days. Pick a single colony and number it for identification.

[0115] Example 3: Validation and determination

[0116] (1) Verification and analysis of PlYPK1 gene knockout transformants

[0117] The genomic DNA of the wild type WT and transformants of Litchi Downy Phytophthora was extracted by CTAB method. The genomic DNA was used as a template to design primers PlYPK1BY-F and PlYPK1BY-R outside the left and right homologous arm fragments of PlYPK1 in the genome for conventional PCR amplification. The band size was detected by gel electrophoresis to verify whether PlYPK1 was successfully knocked out and sent for sequencing detection.

[0118] PlYPK1BY-F:5'-AGTACGATTTGTTTGGGGTCGGCAA-3'

[0119] PlYPK1BY-R: 5'-TAGGGCGATCCGATCTCTAGGAACG-3'.

[0120] The sequencing results proved that the PEG transformation knockout was successful, and 3 PlYPK1 gene knockout transformants were obtained. They were numbered from T1 according to the transformant verification order. The 3 successfully knocked out mutants were named T13, T28, and T52, respectively.

[0121] (2) Determination of growth rate of knockout mutants

[0122] The wild-type WT strain of litchi downy mildew, the transformant CK that grew in a medium containing G418 antibiotics but failed to be knocked out, and the mutants T13, T28, and T52 that successfully knocked out the PlYPK1 gene were transferred twice on CA plates without antibiotics. The 9mm diameter mycelium blocks of WT, CK, T13, T28, and T52 with the same bacterial age were punched and inoculated in the center of a 15mL equal amount of carrot medium plate (diameter = 9cm). Set up 3 replicates, culture at 25℃ in the dark for 5d, measure the colony diameter, calculate the growth rate, and take pictures. The experiment was repeated three times independently, and the Duncan's multiple range test in SPSS software was used to analyze the significance of the differences between the strains.

[0123] Growth rate (mm / d) = colony diameter on day 5 / 5 days.

[0124] (3) Determination of pathogenicity of knockout mutants

[0125] Young leaves of litchi (variety Nuomici) were soaked in ddH2O and placed on wet filter paper. The WT, CK and T13, T28, and T52 mycelium blocks with the same age of 9 mm obtained by the transfer culture in the determination step (2) were inoculated, and the mycelium growth surface was covered on the back of the leaf. Each strain was repeatedly inoculated with 6 young leaves of similar leaf age, placed at 25℃ to keep moist, and photographed after 48 hours and the diameter of the lesions was measured. Duncan's multiple range test in SPSS software was used for significant difference analysis.

[0126] (4) Determination of oospore production of knockout mutants

[0127] At the edge of the colonies of WT, CK, T13, T28, and T52 after two transfer cultures, a sterile punch was used to remove a bacterial plate of the same size (d = 9 mm) and transferred to the surface to cover a layer of Hybond N + After culturing in the dark at 25°C for 10 days on the carrot medium with membrane, the membrane was peeled off, 5 bacterial discs were randomly punched with a hole puncher near the inoculation point, and the plates were homogenized in 5 mL ddH2O. 1 μL was aspirated and placed on a slide to count the number of oospores of each strain.

[0128] Example 4: Results and Analysis

[0129] (1) Construction of the recombinant fragment of the PlYPK1 gene of Peronophytum litchii

[0130] The PCR technology was used to clone the homology arm Left and homology arm Right fragments of the PlYPK1 gene, and the multiple fragments were connected to the linearized pBSSK vector to successfully obtain the pBSSK::PlYPK1 vector; the sgRNA was obtained by double-stranded synthesis and connected to the linearized pYF2.3G-Ribo-sgRNA vector to successfully obtain the pYF2.3G-Ribo-sgRNA1::PlYPK1 and pYF2.3G-Ribo-sgRNA2::PlYPK1 vectors. The knockout diagram is shown in the figure. Figure 1 .

[0131] (2) Screening of knockout mutants of the litchi downy mildew gene PlYPK1

[0132] The primers for the left and right arms of the gene PlYPK1 were designed: PlYPK1BY-F / R, and DNA of the wild type (WT), non-knockout transformant (CK) and PlYPK1 gene knockout mutant of litchi downy mildew were extracted. PCR amplification was performed with the wild type as the control. The amplification method and system were referred to Example 1. The results showed that WT and CK amplified fragments of about 5000 bp, and the three transformants T13, T28 and T52 could amplify fragments of about 2000 bp, further indicating that T13, T28 and T52 were knockout transformants of the gene PlYPK1 ( Figure 2 ), and the sequencing results confirmed that it had indeed been knocked out. The sequencing results of T13, T28, and T52 are as follows:

[0133] TTCTGGGTTCGTGAACACGGTCAGTGCCGATGTGACGGACAAGACGATCTTTTGGAGCGGCGTCGTGGGCATGTGCGAGTCGTATTGGACGCGGCGCTGCGGCAAGCCCGCCACGGGGCCCAGCGTCTGGTCCGCGAACGATGCAGTCGGTGCAGATGTCATATAAGCCATGAGCGTAGGGCGTGTGAACGCACGGGAGGCCGCGCGCGCCGTCGACGCTAAGCGAGAGCACATCAAGGAATGTGAGCGCTATTAGGGTCAGGGCACGTGCCTACGTGGCGACGTGTTTTCATCCAATAAGAACAGTTGAATCTTGTCGTTGAGCCCTGACGTTGGTGGTATGCTAATCAACCGAGCAACTGGGCTAGCGGCTTGGGAGGCTAACATCATCGGCCTTTACGATAACTAGCGTTTATCGCTAGACGTGCCAGTGTTCCTCAGCTCCGTTGGTCATCTCCGGCGCTGGCCACCAACAATGCATGGCGGAGCACGCCCGTAACGGCTTTCACGACGTTGAAGTGTTTTGGCGGCGGAATTTGAACCAGCCAATCACATGCCTCCATCGGGAGAACTTCAACCAGAGGAAACGGTCAAAAGCTGCACCCAGCCATTAGACCCGCCAGCAGCGGAGGGATAACGCCAGCAATTCAGACAAGGCGCAGGGCTGCTCTCGGTGGGGAGAGACGCCTTACTGTGCCTTGGACACTTGCGTTCGCTTGTATTTGCAAAGATACCGCGTAGAAGCTGGTTCCATTTTGAGACTGTCCGCAACGTTGACGTGGTCGTTCCCAGCATCAATATTTCAACGCAGTCGCCAGCGCAGCGCTGGCCTGTTCGCCTCGATAATGGAAAAAGGCCATGATGTAATAATACAGCTATCAGAGGTTTCGAAACGGCCACCGTTCTCCAGAGAAGTCAGGCAGACTGTCGCTGGCCAACGCCACCGCGACGACGCCCAATATATACCTTTTCGCGCCGTCAAATCAACTGCTTGGCCAGG。

[0134] (3) Analysis of growth rate of PlYPK1 knockout mutant

[0135] Compared with the wild type WT and the non-knockout transformant CK of Peronophytum litchii, the growth rate of the knockout mutants T13, T28, and T52 in CA medium was basically the same as that of WT, and the mycelial color was no different from that of the wild type. The frost attached to the mycelium disappeared, and the mycelium became dense and felt-like ( Figure 3 ).

[0136] (4) Pathogenicity analysis of PlYPK1 knockout mutants

[0137] Compared with the wild type WT and the non-knockout transformant CK of litchi downy mildew, the diameter of the lesions of the knockout mutants T13, T28, and T52 inoculated with bacterial cakes was significantly reduced. This proves that the deletion of the gene PLYPK1 significantly reduces the pathogenicity of litchi downy mildew ( Figure 4 ).

[0138] (5) Effect of PlYPK1 knockout mutant on oospore production

[0139] Under the same treatment conditions, oospore suspensions of wild type and knockout mutants T13, T28, and T52 were prepared. Compared with WT and CK, the knockout mutants T13, T28, and T52 basically did not produce oospores, indicating that knockout of the gene PlYPK1 would affect the production of oospores of litchi downy mildew ( Figure 5 ).

[0140] The experimental results show that the gene provided by the present invention can be used for plant disease prevention and control, especially litchi downy blight caused by litchi downy blight. In addition, the gene provided by the present invention can be used as a drug target for plant disease prevention and control. Those skilled in the art can develop drugs for preventing and controlling plant diseases, especially litchi downy blight, according to the guidance and inspiration of this specification.

[0141] The above examples are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above examples. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principles of the present invention shall be equivalent alternatives and shall be included in the protection scope of the present invention.

Claims

1. A litchi downy mildew pathogenicity-related protein PlYPK1, characterized in that: Its amino acid sequence is shown in SEQ ID NO.

3.

2. The biological material related to the pathogenicity-related protein PlYPK1 of litchi downy mildew as claimed in claim 1, characterized in that: Any of the following biological materials: 1) A nucleic acid molecule encoding the litchi downy mildew pathogenicity-related protein PlYPK1; 2) an expression cassette containing the nucleic acid molecule described in 1); 3) a recombinant vector containing the expression cassette described in 2); 4) A recombinant microorganism containing the recombinant vector described in 3).

3. The biomaterial according to claim 2, characterized in that: 1) The nucleic acid molecule is the gene sequence of the litchi downy mildew pathogenicity-related protein PlYPK1, as shown in SEQ ID NO: 1, or the CDS sequence of the litchi downy mildew pathogenicity-related protein PlYPK1, as shown in SEQ ID NO:

2.

4. The use of the litchi downy mildew pathogenicity-related protein P1YPK1 according to claim 1, characterized in that: Any of the following applications: i) Use of knocking out the gene of the litchi downy mildew pathogenicity-related protein PlYPK1 in reducing the pathogenicity of litchi downy mildew; ii) Use of knocking out the gene of the litchi downy mildew pathogenicity-related protein PlYPK1 in inhibiting the formation of litchi downy mildew oospores; iii) Use of knocking out the gene of the litchi downy mildew pathogenicity-related protein PlYPK1 in preventing and controlling litchi downy mildew.

5. A method for preventing and controlling litchi downy blight caused by litchi downy blight, characterized in that: This is achieved by knocking out the gene of the litchi downy mildew pathogenicity-related protein PlYPK1 described in claim 1.

6. A method for constructing a mutant of a PlYPK1 gene knockout, characterized in that: The steps include: (1) According to the gene sequence of the litchi downy mildew pathogenicity-related protein PlYPK1 described in claim 3, sgRNA was designed using the sgRNA website, and the sgRNA was connected to the pYF2.3G-Ribo-sgRNA vector to obtain PlYPK1 Gene knockout plasmid pYF2.3G-Ribo-sgRNA:: PlYPK1 ; Or, according to PlYPK1 The left and right homology arm amplification primers were designed based on the gene sequence, and the left and right homology arms were amplified using the genomic DNA of litchi downy mildew as a template, and then connected with the pBSSK vector to obtain PlYPK1 Gene knockout plasmid pBSSK:: PlYPK1 ; (2) PlYPK1 Gene knockout plasmid pYF2.3G-Ribo-sgRNA:: PlYPK1 or pBSSK:: PlYPK1 The wild-type strain of Peronophytum litchiensis was introduced into the protoplasts and the PlYPK1 gene knockout mutants; The left and right homology arm amplification primers described in step (1) are as follows: Left homology arm amplification primer: PlYPK1-Left-F: 5'-CTAGAACTAGTGGATCCCCTCAGTAACATATTGGTGGT-3'; PlYPK1-Left-R: 5'-CCACCAACGTCAGGGCTCAACGACAAGATTCAACTGTTCT-3'; Right homology arm amplification primers: PlYPK1-Right-F: 5'-AGAACAGTTGAATCTTGTCGTTGAGCCCTGACGTTGGTGG-3'; PlYPK1-Right-R: 5'-ATCGAATTCCTGCAGCCCCGCCATCGGCTTGAG-3'.

7. The construction method according to claim 6, characterized in that: The sgRNA described in step (1) is as follows: sgRNA1: 5'-CAATCCGCTGATGAGTCCGTGAGGACGAAACGAGTAAGCTCGTCCGGATTGGCGCACAAACAGT-3'.

8. The construction method according to claim 6, characterized in that: The sgRNA described in step (1) is as follows: sgRNA2: 5'-CAAGGAACTGATGAGTCCGTGAGGACGAAACGAGTAAGCTCGTCCTTCCTTCGGCGCTAAATCTG-3'.

Images