Trichoderma yunnanense and application thereof

Abstract

The invention relates to the technical field of microorganisms, and discloses trichoderma yunnanense and application thereof. The Trichoderma yunnanense CCTCC NO: M 2025645 provided by the invention is a dominant strain of a high-yield siderophore, the activity of the siderophore is 69.79%, and the Trichoderma yunnanense can be used for synthesizing and secreting carboxylic acid type siderophore; the strain has a sulfur oxidation function; in addition, the invention also provides an application of the trichoderma sp. In regulation and control of plant diseases, the trichoderma sp. Disclosed by the invention can be used for antagonizing fusarium solani, fusarium graminearum, fusarium moniliforme, Rosellinia necatrix and Alternaria brassicae (Fr.) Kissler, and the trichoderma sp. Can be used for antagonizing fusarium solani, fusarium graminearum, fusarium moniliforme, Rosellinia necatrix and Alternaria brassicae (Fr.) Kissler, and can be used for antagonizing fusarium solani, fusarium graminearum, fusarium moniliforme, Rosellinia necatrix and Alternaria brassicae. The Trichoderma yunnanense provided by the invention is a strain separated from tobacco planting soil, and compared with a strain subjected to mutagenesis screening in an extreme environment and a laboratory, the Trichoderma yunnanense has better adaptability when being applied to a planting environment, and can be stably colonized in plant rhizosphere and soil, so that the Trichoderma yunnanense stably plays a growth promoting role for a long time, is safe and environment-friendly, and has a wide application prospect.

Description

Technical Field

[0001] The present invention relates to the field of microbial technology, and particularly to a Trichoderma yunnanense and its application. Background Art

[0002] Soil health is related to the green and sustainable development of agriculture. However, due to the excessive application of chemical fertilizers, pesticides and improper planting, China is facing a series of soil degradation problems such as soil compaction, continuous cropping obstacles, salinization, heavy metal pollution, etc., which seriously affect crop yields and food security. Therefore, it is particularly urgent to find a green and environmentally friendly measure that can effectively improve the soil condition.

[0003] The rhizosphere is the interface where crops and the environment interact with each other. Rhizosphere microorganisms participate in various biochemical processes in the soil. Plant growth-promoting rhizobacteria (PGPR) are rhizosphere microorganisms beneficial to plant growth, and have functions such as promoting crop nutrient absorption, inhibiting pathogenic microorganisms, improving abiotic stress environment, and secreting plant hormones, which are of great significance for promoting plant growth and maintaining soil ecological health. Diverse microbial communities in the soil assist in completing a series of important soil ecological functions by regulating soil nutrient cycling, decomposing organic matter in the soil, inhibiting soil-borne diseases, improving soil structure and supporting plant production, and are an important link in the material cycle and energy flow of the ecosystem, maintaining the sustainable development of the ecosystem. Using soil microorganisms to assist in soil improvement, removal and remediation of toxic pollutants is an economical, efficient and environmentally friendly method.

[0004] At present, the remediation effect of PGPR on obstacle soils and its growth-promoting effect on crops have received increasing attention. Microbial fertilizers, biopesticides and seedling substrates developed with rhizosphere microorganisms as the core components have been widely used. Therefore, further exploring and screening more PGPR strains with high colonization ability and extensive functions not only helps to develop new biological fertilizer products and improve agricultural production efficiency, but also further promotes the development of agriculture towards a more green, environmentally friendly and sustainable direction. Summary of the Invention

[0005] The present invention aims to solve the problem of the lack of effective plant biocontrol bacteria and their products in the actual application of the prior art, and provides a Trichoderma yunnanense and its application. The Trichoderma yunnanense provided by the present invention is isolated from the tobacco-growing farmland soil in Zhaotong City, Yunnan Province. This strain has strong siderophore production activity and sulfur oxidation function, and can also antagonize Fusarium solani ( Fusarium solani ), Fusarium graminearum ( Fusarium graminearum ), Fusarium concentricum ( Fusarium concentricum ), Rosellinia necatrix ( Rosellinia necatrix ), Alternaria brassicae ( Alternaria brassicae(Fr.) Keissler

[0006] To achieve the above object, in the first aspect of the present invention, a strain of Trichoderma yunnanense ( Trichoderma yunnanense ) is provided. The strain number is YNK-FG0001, and the deposit number is CCTCC NO: M 2025645.

[0007] In the second aspect of the present invention, a microbial agent is provided, and its active ingredient is the Trichoderma yunnanense in the first aspect.

[0008] In the third aspect of the present invention, the application of the strain in the first aspect or the microbial agent in the second aspect in siderophore production, sulfur oxidation and antagonizing pathogenic bacteria is provided; the pathogenic bacteria include Fusarium solani ( Fusarium solani ), Fusarium graminearum ( Fusarium graminearum ), Fusarium concentricum ( Fusarium concentricum ) and Rosellinia necatrix ( Rosellinia necatrix ), Alternaria brassicicola ( Alternaria brassicae (Fr.) Keissler).

[0009] Through the above technical solutions, the present invention can at least achieve the following beneficial effects: (1) The Trichoderma yunnanense provided by the present invention has strong siderophore production function and sulfur oxidation function, and can also antagonize Fusarium solani ( Fusarium solani ), Fusarium graminearum ( Fusarium graminearum ), Fusarium concentricum ( Fusarium concentricum ) and Rosellinia necatrix ( Rosellinia necatrix ), Alternaria brassicicola ( Alternaria brassicae (Fr.) Keissler), so as to effectively prevent and control diseases and improve soil quality.

[0010] (2) The Trichoderma yunnanense provided by the present invention is a strain isolated from flue-cured tobacco soil. Compared with the strains screened by extreme environment and laboratory mutagenesis, it has better adaptability to the planting environment, can stably colonize in the rhizosphere of plants and soil, and thus can play a growth-promoting role stably for a long time. Moreover, since it is a strain isolated from farmland soil, the risk of adverse effects on the local environment and soil microbial ecology during the application of the strain in farmland is reduced. Description of the Drawings

[0011] Figure 1 is the colony morphology diagram of the YNK-FG0001 strain in the plate culture in Example 1; Figure 2 is the phylogenetic tree constructed based on the ITS gene sequence of the YNK-FG0001 strain in Example 1; Figure 3It is the effect diagram of siderophore production by strain YNK-FG0001 in Example 2. In the figure, A is the front view of the culture plate, and B is the back view of the culture plate; Figure 4 It is the absorbance value of siderophore production by strain YNK-FG0001 in the full wavelength range in Example 3; Figure 5 It is the sulfur oxidation effect diagram of strain YNK-FG0001 in Example 4. In the figure: (A) is the physical diagram of the strain cultured in MST medium added with a chromogenic agent, and (B) is the comparison diagram of CK (chromogenic agent) and the mixture of fermentation broth and MTS liquid medium;

[0012] Figure 6 It is the effect diagram of antagonistic pathogenic bacteria of strain YNK-FG0001 in Example 5: (A) Effect diagram of antagonizing Fusarium solani Fusarium solani ); (B) Effect diagram of antagonizing Fusarium graminearum Fusarium graminearum ); (C) Effect diagram of antagonizing Fusarium concentricum Fusarium concentricum ); (D) Effect diagram of antagonizing Alternaria brassicae ( Alternaria brassicae (Fr.) Keissler); (E) Effect diagram of antagonizing Rosellinia necatrix Rosellinia necatrix ).

[0013] Biological deposit The Trichoderma yunnanense provided by the present invention is classified and named as: Trichoderma yunnanense YNK-FG0001, which was deposited at the China Center for Type Culture Collection on March 31, 2025. The address is Wuhan University, No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province. The deposit number is: CCTCC NO: M 2025645. Detailed implementation manners

[0014] In the ranges disclosed herein, the endpoints and any values are not limited to the exact ranges or values. These ranges or values should be understood to include values close to these ranges or values. For numerical ranges, between the endpoint values of each range, between the endpoint values of each range and individual point values, and between individual point values can be combined with each other to obtain one or more new numerical ranges, and these numerical ranges should be regarded as specifically disclosed herein.

[0015] In the present invention, without relevant explanations of the terms herein, the term "siderophore" refers to a small molecule compound with the ability to chelate iron elements, the term "strain with high siderophore production activity" refers to a microorganism capable of efficiently synthesizing siderophores, the term "fermentation metabolite" refers to many metabolites secreted by the strain through fermentation, and the term "antibacterial activity" refers to the activity of inhibiting or hindering the growth of plant pathogenic bacteria.

[0016] During the research process, the inventors of the present invention isolated a strain of Trichoderma yunnanense from the farmland soil of flue-cured tobacco fields in Zhaotong City, Yunnan Province ( Trichoderma yunnanense ). After testing, it was found that this strain has the properties of producing siderophores and antagonizing Fusarium solani ( Fusarium solani ), Fusarium graminearum ( Fusarium graminearum ), Fusarium concentricum ( Fusarium concentricum ), Rosellinia necatrix ( Rosellinia necatrix ), and Alternaria brassicae ( Alternaria brassicae (Fr.)Keissler) pathogens. This strain can not only promote nutrient absorption but also antagonize pathogens. Through further research, the inventors also found that it can effectively promote plant growth, improve agricultural productivity, and promote the green and sustainable development of ecological agriculture.

[0017] Based on the above findings, in the first aspect of the present invention, a strain of Trichoderma yunnanense ( Trichoderma yunnanense ) is provided, and the preservation number of this strain is CCTCC NO: M 2025645.

[0018] In the second aspect of the present invention, a microbial inoculant is provided, and the microbial inoculant includes the Trichoderma yunnanense as described in the first aspect and an optional carrier.

[0019] In the third aspect of the present invention, the application of the Trichoderma yunnanense described in the first aspect or the inoculant described in the second aspect in the production of siderophores is provided.

[0020] The present invention further provides a quantitative analysis method for verifying the activity of the strain in producing siderophores. The method includes: inoculating the YNK-FG0001 strain into a medium for cultivation.

[0021] According to the present invention, the medium can be a PDA solid medium, and the solid medium can be a conventional medium suitable for the growth of Trichoderma. In a preferred case, the solid medium contains: 200 - 400 g of potatoes, 20 - 40 g of glucose, 18 - 36 g of agar, 1 - 2 L of deionized water, and pH 7.0. The color reagent contains: CAS detection solution (0.0605 g of chrome azurol S, 1 mmol·L -1 FeCl3·6H2O + 10 mmol·L -1 HCl, deionized water, etc.). The liquid medium contains: 30.0 - 60.0 g·L -1 of glucose, 2.0 - 40.0 g·L -1 of sodium nitrate, 1.0 - 2.0 g·L -1 of potassium phosphate trihydrate, 0.5 - 1.0 g·L -1 of potassium chloride, and 0.5 g·L -1 of magnesium sulfate heptahydrate, 0.75 - 1.5 g·L of 8 - hydroxyquinoline -1 , 1.0 - 2.0 L of deionized water.

[0022] According to the present invention, the preferred conditions for culturing the strain include: the preferred temperature is 25 - 30 °C, and the preferred culture time is 3 - 4 days.

[0023] Any method and conditions capable of verifying Trichoderma yunnanense and enabling it to produce siderophores can be applied to the present invention.

[0024] The fourth aspect of the present invention provides the application of Trichoderma yunnanense as described above in the preparation of carboxylic acid - type siderophores.

[0025] The fifth aspect of the present invention provides a method for sulfur oxidation, which includes culturing Trichoderma yunnanense described in the first aspect and collecting the culture product.

[0026] Any method and conditions capable of fermenting and culturing Trichoderma yunnanense and enabling it to perform sulfur oxidation can be applied to the present invention.

[0027] The sixth aspect of the present invention provides the application of Trichoderma yunnanense described in the first aspect in antagonizing Fusarium solani Fusarium solani (Mart.) Sacc., Fusarium graminearum Fusarium graminearum Fusarium concentricum (Schw.) Sacc., Rosellinia necatrix Fusarium concentricum Alternaria brassicae (Fr.) Keissler,

[0028] The seventh aspect of the present invention provides a bacterial agent with the function of promoting plant growth, and the active ingredient in the bacterial agent includes Trichoderma yunnanense described in the first aspect.

[0029] According to the preferred embodiment of the present invention, wherein the bacterial agent is a liquid bacterial agent.

[0030] Preferably, in the liquid bacterial agent, the content of Trichoderma yunnanense is 1×10 6 —1×10 8 CFU / mL.

[0031] The present invention will be described in detail below through examples. It should be understood that the following examples are only used to further explain and illustrate the content of the present invention by way of example, and are not used to limit the present invention.

[0032] In the following examples, unless otherwise specified, the reagents and materials used are commercially available products purchased from regular chemical / biological reagent or material suppliers, and the reagents are all of analytical grade.

[0033] In the following examples, unless otherwise specified, the operating temperature is room temperature (25 ± 5 °C).

[0034] Example 1 This example is used to illustrate the acquisition, identification, and preservation of Trichoderma yunnanense CCTCC NO: M 2025645.

[0035] (I) Strain isolation and purification In August 2024, a fungus was isolated from the tobacco-growing farmland soil (104°21'E, 27°37'N) in Yiliang County, Zhaotong City, Yunnan Province, China, and it was preserved in the China General Microbiological Culture Collection Center with the preservation number CCTCC NO: M 2025645.

[0036] PDA medium was used during the strain isolation and purification process, and the preparation method is as follows: 200 g of potatoes, 20 g of glucose, 15 - 20 g of agar, add 1000 mL of deionized water, adjust the pH to 7.0 ± 0.1, and autoclave at 121 °C for 25 min.

[0037] A fungus was isolated and purified from the tobacco-growing farmland soil sample collected from Yiliang County, Zhaotong City, Yunnan Province by the dilution plating method and the tip hypha picking method, and it was named Trichoderma yunnanense.

[0038] (II) Strain identification 1. Identification of fungal morphological characteristics and molecular genetics classification Colony: The Trichoderma yunnanense strain YNK-FG0001 was inoculated on PDA medium and cultured at 28 °C. The following changes were observed on the PDA medium: At the beginning, the strain was white, dense, and round, and it spread around; after growing for a period of time, light green spores were produced from the center of the colony, and the center turned green; finally, the whole colony turned green as Figure 1 shown. Trichoderma yunnanense( Trichoderma yunnanense) The strain was inoculated onto a PDA solid medium and cultured at 30 °C for 48 hours. The strain was sent to Beijing Tsingke Biotechnology Co., Ltd., Chongqing Branch for ITS sequencing of the strain. The sequence results were: TCCGTAGGGTGACCTGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAACGTTACCAAACTGTTGCCTCGGCGGGGTCACGCCCCGGGTGCGTCGCAGCCCCGGAACCAGGCGCCCGCCGGAGGAACCAACCAAACTCTTTCTGTAGTCCCCTCGCGGACGTATTTCTTTACAGCTCTGAGCAAAAATTCAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGATCGGCGTTGGGGATCGGGACCCCTCACACGGGTGCCGGCCCCTAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACAACTCGCACCGGGAGCGCGGCGCGTCCACGTCCGTAAAACACCCAACTTTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATC (SEQ ID NO.1). The sequencing results were imported into NCBI for comparison and homologous comparison was carried out with the standard strain sequence with a homology higher than 80%. It had a homology of up to 98.98% with Trichoderma yunnanense ( Trichodermayunnanense , NR134419) (see Figure 2 ). Therefore, it was identified as a microorganism of Deuteromycotina, Hyphomycetes, Moniliales, Moniliaceae, Trichoderma. The phylogenetic tree of the strain was constructed using MEGA7. Figure 2 The phylogenetic tree of the drawn strain is shown.

[0039] 3. Identification results Combining the molecular detection results and the fungal morphological characteristic detection results of the strain YNK-FG0001, the strain was identified as Trichoderma yunnanense ( Trichoderma yunnanense ) (III) Strain preservation The classification obtained above was named:Trichoderma yunnanense Trichoderma yunnanense YNK-FG0001 was deposited at the China Center for Type Culture Collection on March 31, 2025. The address is Wuhan University, No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province. The deposit number is CCTCC NO: M 2025645 Example 2 This example is used to illustrate the siderophore-producing performance of the strains involved in the present invention It was cultured using a plate medium, and the method is as follows: Prepare an iron-free Czapek solid medium: glucose 30.0 g·L -1 , sodium nitrate 2 g·L -1 , potassium phosphate trihydrate 1 g·L -1 , potassium chloride 0.5 g·L -1 , magnesium sulfate heptahydrate 0.5 g·L -1 , 8-hydroxyquinoline 0.75 g·L -1 , deionized water 1 L, add agar 18 g for solid. Double-layer chromogenic medium: lower layer: 100 ml of deionized water, 1.8 g of agar, 15 ml of CAS solution; upper layer: iron-free Czapek solid medium. Then inoculate the YNK-FG0001 strain on the double-layer plate medium. The appearance of red indicates that the strain secretes siderophores. As shown in Figure 3 A and B in, a red halo appeared around the colonies, indicating that the strain secretes siderophores

[0040] The quantitative determination of the siderophore-producing activity of this strain is as follows: Select the strain with a red bottom color in the medium and culture it in an iron-free Czapek liquid medium on a constant temperature shaker (model: HS-200B) at 28 °C and 150 r / min for 48 h. After the culture is completed, aspirate 2 - 5 mL of the culture solution, filter it through a 0.22 μm sterile filter membrane, add an equal volume of CAS detection solution, let it stand for 1 h, and then measure its OD630 value with a full-wavelength microplate reader (model: Multiska GO), denoted as As; measure the absorbance value of the uninoculated liquid medium in the same method as the reference value, denoted as Ar. The concentration of siderophores is expressed in siderophore units (SU), SU = [(Ar - As) / Ar] × 100%. The measurement is repeated 3 times, and the average value is taken for comparative analysis. The results are shown in Table 1. Through 5 days of culture, the measured siderophore-producing activity of the strain is 69.79%.

[0041] Table 1: Quantitative determination of siderophore production by the strain

[0042] Note: The data in the table are the average values (standard deviations) of the soil sample analysis results; Ar; for the blank control group at OD 630Absorbance value (reference value); As; Treatment group at OD 630 Absorbance value.

[0043] Example 3 This example is used to illustrate the identification of the chemical structure type of the siderophore compound produced by the strain of the present invention. The identification method is as follows: Carboxylic acid type siderophore: Identified by the copper sulfate detection method (CuSO4 test): Add 2 ml of 0.25 μmol / L CuSO4 solution and 4 ml of acetate buffer solution with pH 4.0 to a volumetric flask containing 2 ml of the strain detection solution (each strain is detected separately). Use a high performance liquid chromatograph HPLC (Agilent 1260) for full wavelength ultraviolet light scanning. If a maximum absorption peak appears between 190 nm and 280 nm, it indicates that the type of siderophore secreted by the strain is the carboxylate type. The results show that after full wavelength ultraviolet light scanning using the high performance liquid chromatograph HPLC (Agilent 1260), it is found that the maximum absorption peaks of the strain culture filtrates all appear between 190 nm and 280 nm. Therefore, it is determined that the YNK-FG0001 strain produces carboxylic acid type siderophores as Figure 4 .

[0044] Example 4 This example is used to illustrate the sulfur oxidation effect of Trichoderma yunnanense CCTCC NO: M 2025645. The effect test method is as follows: MST (modified thiosulfate) medium (g / L): Weigh 5.0 g of sodium thiosulfate, 0.1 g of dipotassium hydrogen phosphate, 0.2 g of sodium bicarbonate, 0.1 g of ammonium chloride, 5.0 g of glucose, and 5.0 g of yeast extract powder. Add them to 1000 mL of water and dissolve. Use 0.008 g of bromocresol purple as the color indicator, adjust the pH to 8 ± 0.1, and add 20 g of agar. Autoclave at 121 °C for 20 min.

[0045] Method 1: Place the strain YNK-FG0001 obtained in Example 1 on a potato agar solid medium and incubate it upside down in an incubator at 25 °C. Use a puncher to take a 5 mm diameter fungal cake from the cultured Trichoderma yunnanense and inoculate it into the MST medium added with the color indicator. Repeat each treatment 3 times and place it in an incubator at 30 °C. Continuously observe whether a yellow circle appears on the colony plate. Method 2: Inoculate the Trichoderma yunnanense strain into the sterilized PDB liquid medium and incubate it on a shaker at 25 °C and 160 r / min for 8 d. A large amount of bacteria and spores will be produced in the medium. Filter it with 4 layers of sterile gauze to obtain the fermentation stock solution of Trichoderma. Take 2 ml of the fermentation stock solution and mix it with 2 ml of MST (modified thiosulfate) liquid to see if the MST liquid will turn yellow.

[0046] Figure 5 (A - B) shows the sulfur oxidation effect of strain YNK - FG0001. As can be seen from Figure (A), a yellow ring is produced in the medium at the bottom of the colony, and the yellowing of the MST liquid in Figure (B) indicates that this strain can carry out sulfur oxidation.

[0047] Example 5 This example is used to illustrate the antagonistic effect of Trichoderma yunnanense YNK - FG0001 against Fusarium solani ( Fusarium solani ), Fusarium graminearum ( Fusarium graminearum ), Fusarium concentricum ( Fusarium concentricum ), Rosellinia necatrix ( Rosellinia necatrix ), and Alternaria brassicae ( Alternaria brassicae (Fr.) Keissler).

[0048] Test pathogens: Fusarium solani ( Fusarium solani ), Fusarium graminearum ( Fusarium graminearum ), Fusarium concentricum ( Fusarium concentricum ), and Rosellinia necatrix ( Rosellinia necatrix ), and Alternaria brassicae ( Alternaria brassicae (Fr.) Keissler) were provided by the laboratory of the Institute of Agricultural Resources and Environment, Yunnan Academy of Agricultural Sciences.

[0049] Plate confrontation method experiment: Using Fusarium solani ( Fusarium solani ), Fusarium graminearum ( Fusarium graminearum ), Fusarium concentricum ( Fusarium concentricum ), and Rosellinia necatrix ( Rosellinia necatrix ), and Alternaria brassicae ( Alternaria brassicae (Fr.) Keissler) as the indicator pathogens, inoculate a 5 - mm pathogen cake in the center of the PDA medium, and inoculate the strain YNK - FG0001 obtained in Example 1 at a distance of 25 mm from it in a cross shape. The uninoculated plate is used as a control. There are 3 replicates for each strain, and they are cultured in a constant - temperature incubator at 25 - 30 °C in the dark for 5 - 7 d, and the inhibition rate is calculated.

[0050] After the culture, calculate the average value and the inhibition rate. Inhibition rate (%) = (control group colony diameter - treatment group colony diameter) / (control group colony diameter - 5) × 100.

[0051] Figure 6 (A) - (E) show the effect of strain YNK - FG0001 against Fusarium solani ( Fusarium solani ), Fusarium graminearum ( Fusarium graminearum ), Fusarium concentricum ( Fusarium concentricum ), and Rosellinia necatrix (Rosellinia necatrix ), Alternaria brassicae Alternaria brassicae (Fr.) Keissler). The results determined by the plate confrontation method show that the strain YNK-FG0001 can antagonize the above 5 pathogens, and the antibacterial rates of each pathogen are 65.40%, 33.64%, 54.60%, 45.15%, and 50.26%.

[0052] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited thereto. Within the technical concept scope of the present invention, various simple modifications can be made to the technical solutions of the present invention, including any other suitable combination of each technical feature. These simple modifications and combinations should also be regarded as the content disclosed by the present invention and fall within the protection scope of the present invention.

Claims

1. A strain of Trichoderma yunnanense( Trichoderma yunnanense ), characterized in that The preservation number of this strain is: CCTCC NO: M2025645, and its taxonomic name is: Trichoderma yunnanense YNK-FG0001.

2. A bacterial agent, characterized in that, The active ingredient of the microbial agent includes Trichoderma yunnanense described in claim 1.

3. The microbial agent according to claim 2, wherein, The microbial agent is a liquid microbial agent; the content of Trichoderma yunnanense in the microbial agent is 1×10 6 -1×10 8 CFU / mL.

4. Use of the Trichoderma yunnanense according to claim 1 or the microbial agent according to claim 2 in siderophore production, sulfur oxidation and antagonism against pathogenic bacteria; the pathogenic bacteria include Fusarium solani Fusarium solani ), Fusarium graminearum Fusarium graminearum ), Fusarium concentricum Fusarium concentricum ), and Rosellinia necatrix Rosellinia necatrix ), Alternaria brassicae Alternaria brassicae (Fr.) Keissler).

5. The application according to claim 4, wherein: The siderophore is a carboxylic acid type siderophore.

Images