A recombinant esterase, a coding gene, an engineered bacterium and application in production of R-ketoprofen
By expressing Pseudomonas recombinant esterase GE02212 in Escherichia coli, the hydrolysis of (R,S)-ketoprofen ethyl ester to produce R-ketoprofen is catalyzed, solving the problems of environmental pollution and insufficient stereoselectivity in the production of optically pure R-ketoprofen in the existing technology, and achieving efficient and environmentally friendly ketoprofen resolution.
Patent Information
- Application Number
- CN202211162336.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-09-23
- Publication Date
- 2025-10-10
- Estimated Expiration
- 2042-09-23
AI Technical Summary
When producing optically pure R-ketoprofen in existing technologies, the chemical method has the problems of complex operation and high environmental pollution risk, while the bio-enzymatic method lacks efficient stereoselective catalysts, making it difficult to efficiently split (R,S)-ketoprofen ethyl ester to produce R-ketoprofen.
Recombinant esterase GE02212 from Pseudomonas sp. was used to catalyze the hydrolysis of (R,S)-ketoprofen ethyl ester to produce R-ketoprofen by cloning and expressing the recombinant plasmid GE02212-pET-28a(+)-E.coli BL21 Gold(DE3) in Escherichia coli under appropriate conditions.
Efficient hydrolysis of (R,S)-ketoprofen ethyl ester was achieved with a conversion rate of 37.6% and an enantiomeric excess of 85.5% for the product R-ketoprofen, demonstrating good stereoselectivity and the advantages of simple operation and environmentally friendly bioenzymatic production.
Smart Images

Figure CN115820600B_ABST
Abstract
Description
(1) Technical field
[0001] The present invention relates to the technical field of genetic engineering, in particular to a recombinant esterase derived from Pseudomonas sp., a coding gene and an application thereof in splitting (R, S)-ketoprofen ethyl ester to produce (R)-ketoprofen. (2) Background technology
[0002] Ketoprofen, also known as ketoprofen, is chemically known as α-methyl-3-benzoylphenylacetic acid and belongs to the 2-arylpropionic acid class of nonsteroidal anti-inflammatory drugs. It is a commonly used analgesic and anti-inflammatory nonsteroidal drug in clinical practice. Ketoprofen is a racemic mixture, the S-isomer of which inhibits cyclooxygenase (COX-2), thereby exerting anti-inflammatory effects. The R-isomer also has certain medicinal value, including therapeutic effects in treating osteoporosis associated with periodontal disease. Ossipov et al. investigated the spinal activity of racemic ketoprofen and its enantiomers in rat models of neuropathic pain and ankylosing pain, and suggested that R-ketoprofen's mechanism of action against neuropathic pain does not involve COX inhibition and that it also plays an important role in treating tactile allodynia. Seonghun et al. isolated esterases from Bacillus stearothermophilus JY144 and Liu Ruien et al. isolated esterases from Bacillus megaterium NK13 that can stereoselectively resolve racemic ketoprofen esters to produce R-ketoprofen. The former catalyzes the hydrolysis of racemic ketoprofen ethyl ester, and the product ee is 50% when the conversion rate is 50%. p >98%; the latter catalyzes the hydrolysis of racemic ketoprofen ethyl chloride, and the product ee is 30% when the conversion rate is 30%. p At present, most of the research reports on optically pure ketoprofen focus on S-ketoprofen, while there are few reports on stereoselective resolution to generate R-ketoprofen.
[0003] Currently, the production of optically pure ketoprofen is mainly based on chemical production, while the bio-enzymatic separation and production of chiral compounds has the advantages of simple operation, green environmental protection, mild reaction conditions, and high production safety.
[0004] The present invention discloses a novel esterase gene sequence and its function. The enzyme can selectively catalyze the hydrolysis of (R, S)-ketoprofen ethyl ester to produce R-ketoprofen. (3) Summary of the invention
[0005] The present invention provides a recombinant esterase, an encoding gene, an engineered bacterium, and an application thereof in splitting (R, S)-ketoprofen ethyl ester to prepare R-ketoprofen. The esterase has good R-enantiomer selectivity and reaction activity in catalyzing the hydrolysis of (R, S)-ketoprofen ethyl ester, is simple to operate, is environmentally friendly, has mild reaction conditions, and has high production safety.
[0006] The technical scheme adopted by the present application is as follows:
[0007] The present application provides a recombinant esterase (denoted as GE02212) derived from Pseudomonas sp., wherein the amino acid sequence of the recombinant esterase is shown in SEQ ID No. 2.
[0008] The Pseudomonas sp. in the present application is preferably Pseudomonas sp. zjut126, which is preserved in the China Center for Type Culture Collection on October 30, 2017, with the preservation number CCTCC NO: M2017635 and the address Wuhan University, Wuhan, China, 430072, and has been disclosed in patent application CN109321487A.
[0009] The present application also relates to a coding gene of the recombinant esterase, wherein the nucleotide sequence of the coding gene is shown in SEQ ID No. 1.
[0010] Due to the particularity of the amino acid sequence, any polypeptide fragment or variant thereof containing the amino acid sequence shown in SEQ ID No. 2, such as conservative variant, bioactive fragment or derivative, as long as the polypeptide fragment or polypeptide variant has more than 80% homology with the aforementioned amino acid sequence, belongs to the protection scope of the present application. Specifically, the changes can include deletion, insertion or substitution of amino acids in the amino acid sequence; wherein, for conservative changes of the variant, the substituted amino acid has similar structure or chemical property with the original amino acid, such as substitution of leucine for isoleucine, and the variant can also have non-conservative changes, such as substitution of tryptophan for glycine.
[0011] The present application also provides a recombinant plasmid (preferably GE02212-pET-28a(+)) containing the coding gene of the recombinant esterase, and a recombinant genetically engineered bacterium (preferably GE02212-pET-28a(+)-E.coli BL21 Gold (DE3)) obtained by transformation of the recombinant plasmid.
[0012] In addition, the present application also provides an application of the recombinant esterase in hydrolysis of (R,S)-ketoprofen ethyl ester to generate R-ketoprofen, and the specific application is as follows: the pure enzyme solution obtained by resuspension of the wet bacterium body of the engineered bacterium containing the coding gene of the recombinant esterase after induction fermentation, ultrasonic crushing and extraction is used as a catalyst, (R,S)-ketoprofen ethyl ester is used as a substrate, a buffer solution with pH 7.0-9.0 is used as a reaction medium to form a reaction system, and the hydrolysis resolution reaction is carried out under the conditions of 20-60℃, 120-240 rpm (preferably 30℃, 200 rpm) to obtain R-ketoprofen.
[0013] Preferably, the reaction medium is a 50 mM Tris-HCl buffer solution at pH 8.0; the amount of substrate added is 0.5-35 g / L, preferably 1 g / L, based on the total volume of the reaction system; and the amount of catalyst used is 0.16-0.9 mg / L, preferably 0.3 mg / L, based on protein content.
[0014] Furthermore, the catalyst is prepared as follows: (1) wet bacteria are resuspended in ice-cold pH 8, 50mM Tris-HCl buffer to obtain a bacterial suspension; the bacterial suspension is ultrasonically disrupted at 0-4°C and 350-450W for 10-15 minutes, with 2s of operation and 3s of rest during the ultrasonic disruption; the obtained disrupted liquid is centrifuged at 4°C and 8000rpm for 10 minutes, and the supernatant is collected; (2) the supernatant of step (1) is loaded onto a Ni-NTA affinity chromatography column equilibrated with PB buffer containing 10mM imidazole at pH 7.5 at a rate of 1mL / min. After loading, the column is first washed with PB buffer containing 20mM imidazole at pH 7.5 until the ultraviolet absorption reaches a stable baseline, and then the target protein is eluted in one step with PB buffer containing 250mM imidazole at pH 7.5, and the eluate containing the target protein is collected, dialyzed, and concentrated to obtain a pure enzyme solution of the recombinant esterase.
[0015] Preferably, the wet bacterial cell concentration in the bacterial suspension is 0.5-35 g / L (preferably 10 g / L). The ultrasonic disruption conditions are 4° C., 400 W, and 10 min.
[0016] The wet bacteria were obtained by the following steps: inoculating the engineered bacteria containing the recombinant esterase encoding gene into LB liquid medium containing 50 μg / mL kanamycin resistance, culturing in a shaker at 37°C and 200 rpm for 12-16 hours to obtain seed liquid; then transferring the seed liquid to LB liquid medium containing 50 μg / mL kanamycin resistance at an inoculum concentration of 1% by volume, and shaking culturing at 37°C until the OD 600 The pH value was 0.6-0.8, and the inducer IPTG was added at a final concentration of 0.1 mM. The mixture was placed in a shaker at 25°C and 200 rpm to induce fermentation for 10-12 hours. The fermentation liquid was centrifuged and the precipitate was the wet bacteria.
[0017] Compared with the existing technology, the beneficial effects of the present invention are mainly reflected in:
[0018] The coding gene of the recombinant esterase provided by the present invention was cloned and expressed in Escherichia coli to construct the recombinant plasmid GE02212-pET-28a(+) and the engineered bacteria GE02212-pET-28a(+)-E.coli BL21 Gold(DE3). The induced expressed recombinant esterase had a good conversion rate and stereoselectivity for the hydrolysis and resolution of (R,S)-ketoprofen ethyl ester. When an appropriate amount of the recombinant esterase was used to catalyze the hydrolysis of (R,S)-ketoprofen ethyl ester, the substrate concentration was 1 g / L, the catalytic time was 3 hours, the conversion rate was 37.6%, and the ee of the product was 0.05. p The stereoselectivity was 85.5%, and it had a preferential stereoselectivity for the R-configuration of the substrate.
[0019] The amino acid sequence of the recombinant esterase GE02212 differs significantly from that of reported esterases that use racemic ketoprofen esters as substrates and produce R-ketoprofen as the main product (having low homology). It is a new esterase with similar catalytic properties. The present invention has potential application in the production of R-ketoprofen by enzymatic hydrolysis of (R,S)-ketoprofen ethyl ester. (IV) Description of the accompanying drawings
[0020] Figure 1 , amino acid sequence alignment of recombinant esterase GE02212 and two reported R-selective esterases (all substrates are racemic ketoprofen esters).
[0021] Figure 2 , Agarose electrophoresis of the DNA fragment of the recombinant esterase GE02212 amplified by PCR. Lane 1: target gene.
[0022] Figure 3 , PCR verification of recombinant plasmid; M: Maker; Lane 1: amplified fragment of gene GE02212; Lane 2: pET-28a(+) empty plasmid; Lane 3: GE02212-pET-28a(+) recombinant plasmid.
[0023] Figure 4 , SDS-PAGE image of the expression product of the engineered bacteria GE02212-pET-28a(+)-E.coli BL21 Gold(DE3);
[0024] M: Maker; Lane 1: affinity-purified recombinant esterase GE02212; Lane 2: with IPTG induction; Lane 3: without
[0025] IPTG induction.
[0026] Figure 5 , Normal phase HPLC chart of the substrate and product of (R,S)-ketoprofen ethyl ester catalyzed by recombinant esterase for 3h. (V) Specific implementation methods
[0027] The present invention will be further described below with reference to specific embodiments, but the protection scope of the present invention is not limited thereto.
[0028] The experimental methods described in the following examples are conventional methods unless otherwise specified; the reagents and biological materials described are commercially available unless otherwise specified.
[0029] In order to better illustrate the purpose, technical solutions and advantages of the present invention, the present invention is further described below with reference to the accompanying drawings and specific embodiments.
[0030] Example 1: Amplification of esterase gene GE02212 and construction of engineered bacteria
[0031] 1. Extraction of genomic DNA from strain Pseudomonas sp. zjut126
[0032] Pseudomonas sp. zjut126 (CCTCC NO: M2017635) was inoculated into a seed culture medium containing 1 g / L of (R, S)-ketoprofen ethyl ester and cultured in a constant temperature shaker at 30°C and 200 rpm for 24 hours. The seed liquid was then inoculated into a fermentation medium containing 1 g / L of (R, S)-ketoprofen ethyl ester at an inoculum concentration of 2% by volume and cultured in a constant temperature shaker at 30°C and 200 rpm for 24 hours. The fermentation broth was centrifuged at 8000 r / min for 2 minutes in a 2 mL centrifuge tube, the supernatant was discarded, and the bacterial precipitate was collected; then, the genomic DNA of the strain Pseudomonas sp. zjut126 was extracted according to the instructions of the SK8255 column bacterial genomic DNA extraction kit.
[0033] The composition of the seed culture medium is: K2HPO4 2.1g / L, KH2PO4 0.4g / L, NaCl 0.1g / L, MgSO4·7H2O0.2g / L, CaCl2 0.025g / L, NH4NO3 0.5g / L, trace element solution 10mL / L, the solvent is water, and the pH is adjusted to 7.
[0034] Trace element solution composition: CoCl2 0.1g / L, MnSO4 0.5g / L, FeSO4·7H2O 0.1g / L, CuSO4 0.1g / L, ZnSO4·7H2O 0.1g / L, H3BO3 0.01g / L, Al2(SO4)3·12H2O 0.01g / L, Na2MoO4·2H2O 0.01g / L, EDTA·2Na 1g / L. Solution preparation process: dissolve 1g EDTA·2Na in 800ml ultrapure water, add the above raw materials, and make up to 1L.
[0035] Fermentation medium: NaCl 0.5 g / L, MgSO4·7H2O 1.0 g / L, K2HPO4 1.0 g / L, NH4NO3 1.0 g / L, yeast extract powder 5.0 g / L, solvent is water, and the pH is adjusted to 7.
[0036] 2. Amplification of target esterase gene and construction of engineered bacteria
[0037] Genome sequencing of the strain Pseudomonas sp. zjut126 revealed 15 suspected esterase genes. Following a similar process, primers were designed for amplification, and genetically engineered strains were constructed for cloning and expression. Ultimately, only one esterase exhibited the desired activity.
[0038] Using the genomic DNA of strain Pseudomonas sp. zjut126 as a template, specific primers were designed based on the genomic DNA to amplify the target esterase gene. The designed primers are as follows:
[0039] Upstream primer: 5′-CGCGGATCCGAATTCGAGATGCGTGACCACTTGATCCTG-3′, EcoRI;
[0040] Downstream primer: 5′-CGAGTGCGGCCGCAAGCTTGTCAGGCATCGTCACCCTC-3′, HindIII.
[0041] After the PCR reaction, the amplified products were detected by agarose gel electrophoresis. Figure 2 As shown in the figure, it can be seen that there is an obvious band at about 750bp, and there is no non-specific band, which is consistent with the expected size; then the target fragment is recovered by gel cutting using AxyPrepTM DNA Gel Extraction G Kit, and the target fragment and vector pET-28a(+) are double-digested with restriction endonucleases HindIII and EcoRI respectively. The digested pET-28a(+) vector and the PCR amplified and purified target fragment are mixed at a certain concentration ratio and then purified by After recombination and ligation using the II kit, the recombinant plasmid GE02212-pET-28a(+) was obtained. 10 μL of the ligation product was taken and transformed into E. coli BL21(DE3) competent cells. The cells were then placed on ice for 30 minutes, heat-shocked at 42°C for 90 seconds, and placed on ice for 5 minutes. 900 μL of fresh LB medium was added and the cells were revived in a 37°C, 200 rpm constant temperature shaker for 1 hour to allow the E. coli to resume normal growth. The cells were centrifuged at 5000 rpm for 5 minutes, and 900 μL of the supernatant was aspirated. The supernatant and precipitate were mixed by pipetting with a pipette tip, and the supernatant and precipitate were evenly spread on a solid culture dish containing 50 μg / mL kanamycin resistance LB medium and cultured in a 37°C constant temperature incubator overnight.
[0042] The next day, positive clones were picked and inoculated into LB liquid medium containing 50 μg / mL kanamycin resistance, and cultured at 37°C for 16 hours. The cultured bacterial liquid was collected and sent for sequencing. The nucleotide sequence is shown in SEQ ID NO.1. The plasmid was extracted from the positive clone with the correct sequencing result. The plasmid was the recombinant plasmid GE02212-pET-28a(+) containing the target esterase gene. The verification result of the plasmid is shown in Figure 3 As shown, the engineering bacteria GE02212-pET-28a(+)-E. coli BL21 Gold(DE3) was successfully constructed.
[0043] SEQ ID NO.1:
[0044] ATGCGTGACCACTTGATCCTGTTGCCGGGCTGGGGCCTGGGTAGCGCACCGCTGGAACCGCTGCGCGACGCGCTGCACGAGCGCGAGCCGCACCTGAACGTGTTGATCGAGCCGCTGCCGTCGCTGGACGACGCCGCCGACTGGCTCGACGAACTCGACGATAACCTGCCGCGCGATAGCTGGCTGGCCGGCTGGTCGCTGGGAGGCATGCTCGCCGGCGAACTGGCGGCGCGCCGCGGTGACGATTGCCGGGGACTGCTGACCCTGGCCAGCAATCCGTGCTTCCGCGTGCGCGAGGACTGGCCGAACGCGATGCCGGCGGAAACCTTCGAGGACTTCTTCGAGGCTTTCCTGCTCGAACCGCACCTGACCCGCAAGCGTTTCACCCTGCTGGTCAGCCAGGGTGCGCGCGACCCTCGGACCCTGGCGCGGCAACTGCAGGTGGCGCTGCCGCAACTGGAGCGCGAGGCGCTGGTCGCCGGCCTGCAGTTGCTCGGCCAACTGGATACCCGGGCCGCCCTGGAAAACTTCCGCGGGCCGCAATTGCACCTGTTCGCCGAAGCCGATGCGCTGGTGCCGCTGGCCGCCGCCGAGGCCCTGCTCGAGTGGCTGCCGGACGTCGAGGTCTCGACCCTGGCGGCCAGTCACGGCCTGCCGCTGGAATGTCCGGACGAGGTGGCCGGCGCAATCCTGAGATTCCTTCGCGAGGGTGACGATGCCTGA。
[0045] 实施例2:重组酯酶的表达和重组酯酶酶液的获得
[0046] 1、工程菌诱导表达
[0047] A single colony of the recombinant Escherichia coli GE02212-pET-28a(+)-E.coliBL21Gold(DE3) preserved on the plate in Example 1 was picked and inoculated into LB liquid culture medium containing 50 μg / mL kanamycin resistance, and cultured in a constant temperature shaker at 37°C and 200 rpm for 12 hours. The inoculum was transferred to 50 mL of LB liquid culture medium containing 50 μg / mL kanamycin resistance at a volume concentration of 1%, cultured in a constant temperature shaker at 37°C and 200 rpm for 3 hours, and then 50 μL IPTG was added to a final concentration of 0.1 mM, and low-temperature induction was carried out at 25°C and 200 rpm for 12 hours to obtain an induced culture solution. After the induction was completed, the induced culture solution was taken for SDS-PAGE electrophoresis analysis. The results are as follows: Figure 4 As shown, the uninduced engineered bacteria were used as a control. It can be seen from the figure that after IPTG induction, the recombinant E. coli expressed the target protein with a size of about 26.5 KDa, which was consistent with the expected size.
[0048] 2. Purification of recombinant esterase
[0049] (1) Ultrasonic fragmentation
[0050] The induced culture was centrifuged at 8000 rpm for 10 minutes at 4°C, and the precipitate was collected as the wet cells. The wet cells were resuspended at 10 g / L in 50 mM Tris-HCl buffer (pH 8) and disrupted by sonication at 400 W for 10 minutes at 4°C, with a 2-second interval and a 3-second pause. The resulting disrupted liquid was centrifuged at 8000 rpm for 10 minutes at 4°C, and the supernatant was collected.
[0051] (2) Ni-NTA affinity chromatography
[0052] A Ni-NTA affinity chromatography column (GXK 16 / 20 jacketed protein chromatography column, 1.6×20 cm) was equilibrated with PB buffer at pH 7.5 containing 10 mM imidazole. The supernatant from step (1) was loaded at a rate of 1 mL / min. The column was then rinsed with PB buffer at pH 7.5 containing 20 mM imidazole until the UV absorbance reached a stable baseline. Finally, the target protein was eluted in a one-step method using PB buffer at pH 7.5 containing 250 mM imidazole. The eluate containing the target protein was collected and dialyzed against a dialysate (pH 7.5, 50 mM PB buffer) using a dialysis bag (molecular weight cut-off 3500) to remove salt ions from the eluate. The retentate was then concentrated to 1 / 10 of its original volume using an ultrafiltration membrane (molecular weight cut-off 10000). The concentrate was used to obtain a pure recombinant esterase solution (protein concentration was 2.2 g / L as determined by the Bradford method) and designated as recombinant esterase GE02212. The amino acid sequence is shown in SEQ ID NO. 2. Figure 4 shown.
[0053] SEQ ID NO.2:
[0054] MRDHLILLPGWGLGSAPLEPLRDALHEREPHLNVLIELPPSLDDAADWLDELDDNLPRDSWLAGWSLGGMLAGELAARRGDDCRGLLTLASNPCFRVREDWPNAMPAETFEDFFEAFLLE PHLTRKRFTLLVSQGARDPRTLARQLQVALPQLEREALVAGLQLLGQLDTRAALENFRGPQLHLFAEADALVPLAAAEALLEWLPDVEVSTLAASHGLPLECPDEVAGAILRFLREGDDA.
[0055] An amino acid sequence alignment of recombinant esterase GE02212 was performed using the Blast+ program on the EBI website against the protein database. The Uniprot KB database (including UnitProt KB / Swiss-Prot and uniProt KB / TrEMBL) was selected, and all other parameters were set to default. Table 1 lists the top five closest matches from the returned results. As can be seen from the table, the first four proteins all share 100% amino acid sequence identity with recombinant esterase GE02212. These proteins are from Pseudomonas fluorescens and Pseudomonas aeruginosa, respectively, and are annotated as "possible biotin synthesis protein" and "alpha / beta fold hydrolase." This paper demonstrates that these proteins possess specific functions. The fifth protein shares a slightly lower amino acid sequence identity with recombinant esterase GE02212, at 99.6%, and is annotated as "biotin synthesis protein."
[0056] Table 1: Results of amino acid sequence alignment of recombinant esterase GE02212 using the UniProt KB database in Blast
[0057]
[0058] The recombinant esterase GE02212 (amino acid sequence shown in SEQ ID NO. 2) and the two reported R-selective esterases mentioned in "Background Art" were aligned using the program Clustal Omega on the EBI website. The alignment results are shown in Figure 1(GU143552 and JY144 in the figure are esterases discovered by Zhao Yuhong et al. and Ji-Youn et al., respectively, that hydrolyze racemic ketoprofen esters to produce R-ketoprofen.) The results showed that the sequence identity of recombinant esterase GE02212 with esterases GU143552 and JY144 was only 17.5% and 20% respectively. Therefore, recombinant esterase GE02212 is a new esterase gene that stereoselectively hydrolyzes (R,S)-ketoprofen ethyl ester to produce R-ketoprofen.
[0059] Example 3: Recombinant esterase catalyzes the stereoselective hydrolysis of (R,S)-ketoprofen ethyl ester to produce R-ketoprofen
[0060] Catalytic system: 10 mg of substrate (R, S)-ketoprofen ethyl ester was added to 50 mM Tris-HCl buffer (pH 8.0) as the reaction medium, 50 μL of the pure recombinant esterase prepared in Example 2 was added, and the total reaction system was 10 mL. The reaction was carried out in a shake flask at 30°C and 180 rpm for 3 h.
[0061] Samples were taken separately and normal phase HPLC was used to detect the consumption of substrate and the formation of product. Figure 5 As shown, the main product of the hydrolysis of the substrate (R, S)-ketoprofen ethyl ester is R-ketoprofen, the substrate conversion rate is 37.6%, and the product enantiomeric excess is 85.5%.
[0062] Normal-phase HPLC was performed using a Waters chromatograph. The mobile phase was: n-hexane:isopropanol:TFA = 98:2:0.1 (v / v / v), flow rate: 1.0 mL / min, UV detection wavelength: 254 nm, column temperature: 30°C, injection volume: 10 μL, chromatographic column: 250 mm × 4 mm, Daicel chiral OD column.
[0063] Enantiomeric excess of substrate (ee s ), product enantiomeric excess (ee p ) and conversion rate (C) were calculated according to the following formula.
[0064]
[0065]
[0066]
[0067] Where, [S] S and [S] R are the contents of substrate (R,S)-ketoprofen ethyl ester S and R forms, respectively, [P] S and [P] R are the contents of the products S-ketoprofen and R-ketoprofen, respectively.
Claims
1. A recombinant esterase derived from Pseudomonas sp. for hydrolyzing (R, S)-ketoprofen ethyl ester to produce R-ketoprofen, characterized in that: The amino acid sequence of the recombinant esterase is shown in SEQ ID No.
2.
2. The use according to claim 1, characterized in that The application is as follows: wet bacteria obtained by induced fermentation of an engineered bacterium containing a recombinant esterase encoding gene are resuspended in a buffer solution and then ultrasonically crushed to extract a pure enzyme solution as a catalyst; (R, S)-ketoprofen ethyl ester is used as a substrate; a buffer solution with a pH of 7.0-9.0 is used as a reaction medium to form a reaction system; a hydrolysis and resolution reaction is carried out at 20-60° C. and 120-240 rpm to obtain R-ketoprofen.
3. The use according to claim 2, characterized in that The reaction medium is a pH 8.0, 50 mM Tris-HCl buffer solution; the amount of substrate added is 0.5-35 g / L based on the total volume of the reaction system; and the amount of catalyst used is 0.16-0.9 mg / L based on protein content.
4. The use according to claim 2, characterized in that The catalyst is prepared as follows: (1) wet bacteria are resuspended in ice-cold pH 8, 50mM Tris-HCl buffer to obtain a bacterial suspension; the bacterial suspension is ultrasonically disrupted at 0-4°C and 350-450W for 10-15 minutes, with 2s of operation and 3s of rest during the ultrasonic disruption; the obtained disrupted liquid is centrifuged at 4°C and 8000rpm for 10 minutes, and the supernatant is collected; (2) the supernatant of step (1) is loaded onto a Ni-NTA affinity chromatography column equilibrated with PB buffer containing 10mM imidazole at pH 7.5 at a speed of 1mL / min. After the loading is completed, the column is first washed with PB buffer containing 20mM imidazole at pH 7.5 until the ultraviolet absorption reaches a stable baseline, and then the target protein is eluted in one step with PB buffer containing 250mM imidazole at pH 7.5, and the eluate containing the target protein is collected, dialyzed, and concentrated to obtain a pure enzyme solution of the recombinant esterase.
5. The use according to claim 2 or 4, characterized in that The wet bacteria are obtained by the following steps: inoculating the engineered bacteria containing the recombinant esterase encoding gene into LB liquid culture medium containing 50 μg / mL kanamycin resistance, and culturing in a shaker at 37° C. and 200 rpm for 12-16 hours to obtain seed liquid; The seed solution was then transferred to LB liquid medium containing 50 μg / mL kanamycin resistance at an inoculum concentration of 1% by volume and cultured at 37°C with shaking until the OD 600 The pH value was 0.6-0.8, and the inducer IPTG was added at a final concentration of 0.1 mM. The mixture was placed in a shaker at 25°C and 200 rpm to induce fermentation for 10-12 hours. The fermentation liquid was centrifuged and the precipitate was the wet bacteria.
Citation Information
Patent Citations
Pseudomonas sp. zjut 126 and application in production of L-glufosinate
CN109321487A