A circular RNA vaccine against porcine epidemic diarrhea virus and a construction method and application thereof

Abstract

The application belongs to the technical field of biological medicine, and particularly relates to a circular RNA vaccine against porcine epidemic diarrhea virus and a construction method and application thereof. The circular PEDV-COE1 RNA vaccine is obtained through gene synthesis, in-vitro transcription, circularization and liposome nanoparticle wrapping. The DNA molecule, the circular RNA molecule, the protein sequence and the gene sequence involved in the application can be used for preparing various porcine diarrhea virus vaccines. After porcine epidemic diarrhea virus circular RNA is injected into the muscle of a pig, a high level of porcine epidemic diarrhea virus neutralizing antibody can be generated in the pig, and the occurrence of piglet diarrhea can be effectively reduced, so that the application has great popularization value for the prevention and control of porcine epidemic diarrhea.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, and in particular relates to a circular RNA vaccine against porcine epidemic diarrhea virus, its construction method and application. Background Technology

[0002] Nucleic acid vaccines are a rapidly developing new vaccine category, including DNA and RNA vaccines. The design and production process of nucleic acid vaccines is simple; only the main antigen gene sequence needs to be inserted into an expression plasmid. The recombinant plasmid containing the target antigen gene can then be amplified in large quantities in *E. coli*. Recombinant plasmids extracted from *E. coli* can be used as DNA vaccines. RNA vaccines can be obtained by post-transcriptional modification of the extracted plasmids in vitro and encapsulation with polymer materials. Currently widely used inactivated / attenuated vaccines, recombinant viral vectors, and subunit vaccines all rely on cells with specific cell receptors for production. In contrast, DNA / RNA vaccines can be mass-produced solely in *E. coli* and are not specific to *E. coli*, allowing for rapid preparation of viral vaccines. With the maturation of production technologies and processes, the advantages of the simplicity of nucleic acid vaccine design and the high efficiency of production make them ideal for vaccine preparation for viral diseases that lack suitable proliferating cell lines, mutate rapidly, or are emerging.

[0003] DNA vaccines, using plasmids as vectors and taking the form of DNA, are more stable than RNA vaccines, making their preparation technology relatively simpler. Viral DNA vaccines typically use their major antigenic epitope genes as the antigen genes in the plasmid vector. During immunization, the expression plasmid is directly delivered to the target tissue, or it is first transformed into a vector bacterium, which then delivers the vaccine plasmid to the target tissue. However, some problems exist. For example, the expression of the target gene requires replication, transcription, and then translation from RNA to the protein before it can be used as an immunogen, resulting in low expression efficiency of the target protein, which is a major factor limiting the further development of DNA vaccines. If bacteria are used as vectors, issues such as plasmid expression efficiency and antigen presentation pathways also arise. RNA vaccines mainly include liposome nanoparticles (LNPs) containing mRNA and replication-deficient viral particles containing RNA replicons. LNP vaccines generally consist of liposomes packaging mRNA to form virus-like nanoparticles; replication-deficient viral particles co-transfect cells with in vitro transcribed RNA replicons and a helper vector, where viral membrane proteins expressed by the helper vector within the cells package the RNA replicons. Replication-deficient viral particles, when used as vaccines, can only achieve one round of infection and lack the ability to infect continuously. Therefore, like LNP vaccines, they have a safety advantage. Based on the development of mRNA modification and delivery tools, mRNA vaccines have become an important means of preventing and treating viral diseases. After obtaining the core neutralizing epitope sequence of a virus, high-performance mRNA vaccines can be designed and manufactured within weeks, demonstrating strong resilience against emerging diseases and rapid viral mutations. However, due to the poor stability of mRNA, a series of modifications and encapsulation processes are required after transcription to prepare RNA vaccines, significantly increasing their cost and hindering their widespread use.

[0004] Since 2010, outbreaks of porcine epidemic diarrhea (PEDV) have frequently occurred in pig farms across my country. Extensive molecular epidemiological surveys have shown that highly virulent variants of PEDV are the most common pathogen causing piglet diarrhea. The detection rate of PEDV in diarrhea samples exceeds 60%. The currently circulating PEDV strain is highly virulent, posing the greatest threat to piglets within their first week of life, with morbidity and mortality rates often reaching 100%, making it the leading cause of death in newborn piglets. Genomic analysis indicates that the genome of the currently circulating strain has undergone characteristic mutations, rendering vaccines based on the classic CV777 strain ineffective in providing immune protection. In 2013, PEDV first broke out in the United States, sweeping across more than 8,000 pig farms in 36 states within just a few months, causing the deaths of over 8 million piglets and resulting in significant economic losses to the pig farming industry.

[0005] Porcine epidemic diarrhea (PEDV) is prevalent in China, and many scholars have reported the continuous emergence of PEDV variants. Existing inactivated or attenuated vaccines do not provide complete protection against newly emerging PEDV variants, which partially explains why outbreaks of swine epidemic diarrhea often occur despite immunization against PEDV. The PEDV-encoded S protein (Spike protein) is a spike glycoprotein on the surface of the viral particle. The S protein promotes the fusion of viral particles with cell surface receptors, helping the virus invade cells and mediating the production of neutralizing antibodies in the infected host, playing a crucial role in preventing PEDV infection. The COE region is a partially protective antigenic gene segment in the PEDV S protein. Screening for highly specific antigenic proteins of the COE region is crucial for constructing highly protective subunit vaccines or nucleic acid vaccines. Research shows that RNA vaccines have many advantages, including good immunogenicity, safety, and the adjuvant properties of RNA molecules themselves, requiring lower doses for the same immunization effect. Circular RNA vaccines, compared to mRNA vaccines, have advantages such as higher storage temperature, less degradation, and the ability to generate a more durable and stronger immune response in vivo, making them widely applicable. Summary of the Invention

[0006] In view of the problems existing in the prior art, the present invention provides a circular RNA vaccine against porcine epidemic diarrhea virus, its construction method and application, with the aim of solving some of the problems in the prior art or at least alleviating some of the problems in the prior art.

[0007] The circular RNA vaccine against porcine epidemic diarrhea (PED) and its construction method provided by this invention have advantages such as short development time, high safety, low cost, easy standardization of production, and good stability without modification. More importantly, the COE region screened by this invention based on more than ten years of epidemiological survey results can produce immune protection against the current major circulating PEDV strains, which can provide technical support for the prevention and control of porcine epidemic diarrhea.

[0008] This invention provides the application of the COE sequence, as shown in SEQ ID NO.1, in the preparation of a vaccine against porcine epidemic diarrhea virus.

[0009] Furthermore, the vaccine includes a circular RNA vaccine.

[0010] The present invention also provides a recombinant plasmid or circular RNA molecule comprising a COE sequence as shown in SEQ ID NO.1; or any one of the sequences shown in SEQ ID NO.14, SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.17, SEQ ID NO.18, or SEQ ID NO.19.

[0011] The present invention also provides a circular RNA vaccine against porcine epidemic diarrhea virus, which is capable of encoding a protein with an amino acid sequence as shown in SEQ ID NO.13.

[0012] SEQ ID NO.13

[0013] Met Asp Ala Met Lys Arg Gly Leu Cys Cys Val Leu Leu Leu Cys Gly AlaVal Phe Val Ser Pro Ser Gln Glu Ile His Ala Arg Phe Arg Arg Ile Ser Phe ValThr Leu Pro Ser Phe Asn Asp His Ser Phe Val Asn Ile Thr Val Ser Ala Ala PheGly Gly Leu Ser Ser Ala Asn Leu Val Ala Ser Asp Thr Thr Ile Asn Gly Phe SerSer Phe Cys Val Asp Thr Arg Gln Phe Thr Ile Thr Leu Phe Tyr Asn Val Thr AsnSer Tyr Gly Tyr Val Ser Lys Ser Gln Asp Ser Asn Cys Pro Phe Thr Leu Gln SerVal Asn Asp Tyr Leu Ser Phe Ser Lys Phe Cys Val Ser Thr Ser Leu Leu Ala GlyAla Cys Thr Ile Asp Leu Phe Gly Tyr Pro Ala Phe Gly Ser Gly Val Lys Leu ThrSer Leu Tyr Phe Gln Phe Thr Lys Gly Glu Leu Ile Thr Gly Thr Pro Lys Pro LeuGlu Gly Ile Gly Gly Gly Gly Ser Gly Tyr Ile Pro Glu Ala Pro Arg Asp Gly GlnAla Tyr Val Arg Lys Asp Gly Glu Trp Val Leu Leu Ser Thr Phe Leu Gly Arg Ser

[0014] The present invention also provides a circular RNA vaccine against porcine epidemic diarrhea virus, comprising a nucleotide sequence as shown in SEQ ID NO.1.

[0015] The present invention also provides a method for preparing a circular RNA vaccine against porcine epidemic diarrhea virus, comprising: introducing the sequence SEQ ID NO.7 into a cloning vector to construct a recombinant plasmid; linearizing the recombinant plasmid to prepare circular RNA; and mixing the circular RNA with LNP to prepare a circular RNA vaccine.

[0016] Furthermore, the vector is a pUC19 cloning vector.

[0017] Furthermore, it includes the following steps:

[0018] 1) The sequence SEQ ID NO:7 was transferred into the empty vector pUC57 to obtain the recombinant vector pUC-T7-IRES1-SP-COE-GS-Foldon-IRES2;

[0019] 2) The pUC-T7-IRES1-SP-COE-GS-Foldon-IRES2 recombinant vector was transformed into E. coli and cultured on a large scale;

[0020] 3) The pUC-T7-IRES1-SP-COE-GS-Foldon-IRES2 recombinant vector was digested with enzymes and recovered to obtain a large number of T7-IRES1-SP-COE-GS-Foldon-IRES2 fragments;

[0021] 4) Using the T7-IRES1-SP-COE-GS-Foldon-IRES2 fragment as a template, in vitro transcription was performed. After transcription, the DNA template was removed and the RNA was purified to obtain the circular RNA precursor.

[0022] 5) The RNA precursor was ligated using T4 RNA ligase, and then the uncircularized RNA was removed; after purification, high-purity circular RNA against swine epidemic diarrhea was obtained.

[0023] 6) Dilute the circular RNA with a buffer solution, mix the LNP and circular RNA solution at a volume ratio of 1:3, then dilute with PBS buffer and concentrate by ultrafiltration to obtain the circular RNA vaccine against swine epidemic diarrhea.

[0024] Further, in step 6), the circular RNA is diluted to a final concentration of 200 μg / ml.

[0025] Furthermore, the LNP and circular RNA solution were mixed at a volume ratio of 1:3 using NanoAssemblr Ignite, and then the LNP-circRNA preparation was diluted with PBS buffer and concentrated by ultrafiltration to obtain a circular RNA vaccine against porcine epidemic diarrhea.

[0026] In pUC-T7-IRES1-SP-COE-GS-Foldon-IRES2, the T7 promoter sequence is SEQ ID NO.14 (TAATACGACTCACTATA).

[0027] The internal ribosome entry site sequence 1 (IRES1) is the 3' end IRES sequence of human Coxsackie B3 virus, and the sequence is SEQ ID NO.15;

[0028] SEQ ID NO.15:

[0029] GGGGAAACCCAAACATGGGACGCTCTAATACAGACATGGTGCGAAGAGTCTATTGAGCTAGTTGGTAGTCCTCCGGCCCCTGAATGCGGCTAATCCTAACTGCGGAGCACACACCCTCAAGCCAGAGGGCAGTGTGTCGTAACGGGCAACTCTGCAGCGGAACCGACTACTTTGGGTGTCCGTGTTTCA TTTTATTCCTATACTGGCTGCTTATGGTGACAATTGAGAGATCGTTACCATATAGCTATTGGATTGGCCATCCGGTGACTAATAGAGCTATTATATATCCCTTTGTTGGGTTTATACCACTTAGCTTGAAAGAGGTTAAAACATTACAATTCATTGTTAAGTTGAATACAGCAAAACTAGTGCCACCATG

[0030] The sequence of the human tissue plasminogen activator signal peptide (SP) is SEQ ID NO.16;

[0031] SEQ ID NO.16:

[0032] GATGCAATGAAGAGAGGGCTCTGCTGTGTGCTGCTGCTGTGTGGAGCAGTCTTCGTTTCGCCCAGCCAGGAAATCCATGCCCGATTCAGAAGA

[0033] The porcine epidemic diarrhea virus COE sequence is any one of SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.6;

[0034] The GS sequence is SEQ ID NO.17 (GGCGGAGGAGGCAGC).

[0035] The Foldon sequence is SEQ ID NO.18;

[0036] SEQ ID NO.18:

[0037] GGCTACATCCCAGAAGCCCCTAGAGACGGACAGGCTTACGTGCGAAAAGACGGCGAGTGGGTGCTGCTGAGCACATTCCTGGGAAGGAGC

[0038] The internal ribosome entry site sequence 2 (IRES2) is the 5' end portion IRES sequence of human Coxsackie B3 virus, and the sequence is SEQ ID NO.19.

[0039] SEQ ID NO.19:

[0040] TGATGATGAGGGTTTTTAAAACAGCCTGTGGGTTGATCCCACCCACAGGCCCATTGGGCGCTAGCACTCTGGTATCACGGTACCTTTGTGCGCCTGTTTTATACCCTCCCCCAACTGTAACTTAGAAGTAACACACACCGATCAACAGTCAGCGTGGCACACCAGCCACGTTTTGATCAAGCACTTCTGTTACCCCGG ACTGAGTATCAATAGACTGCTCACGCGGTTGAAGGAGAAAGCGTTCGTTATCCGGCCAACTACTTCGAAAAACCTAGTAACACCGTGGAAGTTGCAGAGTGTTTCGCTCAGCACTACCCCAGTGTAGATCAGGTCGATGAGTCACCGCATTCCCCACGGGCGACCGTGGCGGTGGCTGCGTTGGCGGCCTGCCCATGTTT

[0041] EcoRV restriction sites were added to both ends of the fusion sequence, and the sequence was chemically synthesized and incorporated into the pUC57 empty vector.

[0042] In the above technical solution, the Escherichia coli in step 2) is a conventional engineered bacterium, such as Top10, DH5α, and DH10B.

[0043] In the above technical solution, the culture medium for Escherichia coli in step 2) is LB liquid culture medium, preferably, the culture medium contains ampicillin with a final concentration of 100 ng / ml.

[0044] In the above technical solution, the restriction endonuclease used in step 3) is EcoRV restriction endonuclease.

[0045] In the above technical solution, the in vitro transcription kit used in step 4) is a commercially available T7 in vitro transcription kit, such as the HiScribe T7 High-Efficiency RNA Synthesis Kit (NEB). In the reaction system, guanosine monophosphate (GMP) is added to a final concentration of 2 mM. Transcription is completed to obtain a circular RNA precursor. The transcription product is ligated with T4 RNA ligase 2 at 25°C for 8 hours. The ligated circular product is then treated with RNase R to remove the linear RNA precursor. To further enrich the circular RNA, the RNase R-treated sample is purified by high-performance liquid chromatography (HPLC), collecting the fraction rich in circular RNA, followed by column purification. To further reduce the immunogenicity of the purified circular RNA, it is heated at 65°C for 3 minutes, cooled on ice, and then treated with rapid heat-sensitive calf intestinal alkaline phosphatase (CIP). Finally, the circular RNA is purified and concentrated using the RNA Clean and Concentrator Kit.

[0046] This invention discloses a method for preparing a circular RNA vaccine against porcine epidemic diarrhea virus (PEDV). The prepared circular RNA is encapsulated with liposome nanoparticles (LNPs) to obtain an applicable circular RNA vaccine against PEDV, which provides immune protection to pigs after immunization.

[0047] In summary, the advantages and positive effects of this invention are as follows:

[0048] 1. The construction of a circular RNA vaccine against porcine epidemic diarrhea virus disclosed in this invention is disclosed for the first time. The circular RNA vaccine against porcine epidemic diarrhea virus disclosed in this invention is a nucleic acid vaccine. Compared with DNA vaccines, circular RNA vaccines can be directly translated into proteins after injection to rapidly generate an immune response, resulting in higher biosafety. Compared with mRNA vaccines, circular RNA has a covalently closed circular structure, does not contain 5'-Cap and 3'-polyA structures, and does not require the introduction of modified bases. Its stability is higher than that of linear RNA. At the same time, the closed circular structure of circular RNA can protect it from exonuclease-mediated degradation. In mammalian cells, the median half-life of circular RNA is at least 2.5 times longer than that of linear mRNA.

[0049] 2. The method for constructing a circular RNA vaccine against porcine epidemic diarrhea virus disclosed in this invention is simple. It uses the T4 phage fibrin Foldon sequence, which enables the protein encoded by the expressed PEDV COE to form a multimer, greatly enhancing the immunogenicity of the protein and enabling the body to produce stronger immune antibodies.

[0050] 3. The COE region sequence of porcine epidemic diarrhea virus screened in this invention is obtained from the analysis of more than ten years of porcine epidemic diarrhea virus epidemiological survey data, and can have a strong neutralizing effect on currently circulating porcine epidemic diarrhea virus strains.

[0051] 4. Existing vaccines against porcine epidemic diarrhea virus (PEDV) are all inactivated or attenuated vaccines prepared by virus isolation and culture. These vaccines have long development cycles, and PEDV mutations are frequent, with significant changes in the antigenic sites of currently circulating strains. Traditional vaccines are no longer suitable for the control of modern PEDV. This invention discloses a method for preparing a circular RNA vaccine against PEDV and its application. This method has a short development cycle, does not require virus isolation, is unaffected by factors such as virus titer, is easy to standardize for production, and has low production costs. Attached Figure Description

[0052] Figure 1 The diagram shows the structural pattern of the recombinant plasmid pUC-T7-IRES1-SP-COE-Foldon-IRES2 in Example 1.

[0053] Figure 2 The image shows the restriction enzyme digestion diagram of the recombinant plasmid pUC-T7-IRES1-SP-COE-Foldon-IRES2 in Example 2. Lane M: DL5000 DNA Marker; Lanes 1-6 are the products of pUC-T7-IRES1-SP-COE-Foldon-IRES2.

[0054] Figure 3 The effect of PEDV challenge on the weight gain rate of piglets born to pregnant sows immunized with the anti-PEDV circular RNA vaccine in Example 4.

[0055] Figure 4 The effect of PEDV challenge on the mental state of piglets born to pregnant sows immunized with the anti-PEDV circular RNA vaccine in Example 4.

[0056] Figure 5 The effect of PEDV challenge on the weight gain rate of 1-day-old piglets using the anti-PEDV circular RNA vaccine in Example 5.

[0057] Figure 6The effect of PEDV challenge on the mental state of 1-day-old piglets using the anti-PEDV circular RNA vaccine in Example 5. Detailed Implementation

[0058] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. Unless otherwise specified, the equipment and reagents used in the embodiments and experimental examples are commercially available. The specific embodiments described herein are only for explaining the invention and are not intended to limit the invention. Unless otherwise specified, all technical means in the examples of this invention are conventional means well known to those skilled in the art, such as enzyme digestion, transformation, bacterial culture, and in vitro transcription.

[0059] Based on the information contained in this application, various changes to the precise description of the invention can be readily made by those skilled in the art without departing from the spirit and scope of the appended claims. It should be understood that the scope of the invention is not limited to the defined processes, properties, or components, as these embodiments and other descriptions are merely illustrative of specific aspects of the invention. In fact, various modifications to embodiments of the invention that will be apparent to those skilled in the art or related fields are covered within the scope of the appended claims.

[0060] To better understand the invention and not to limit its scope, all figures indicating amounts, percentages, and other numerical values ​​used in this application should, in all cases, be understood to be modified by the word "about". Therefore, unless specifically stated otherwise, the numerical parameters listed in the specification and appended claims are approximate values ​​and may vary depending on the desired properties being sought. Each numerical parameter should at least be considered as obtained based on reported significant figures and through conventional rounding methods. In this invention, "about" means within 10%, preferably within 5%, of a given value or range.

[0061] This invention discloses a circular RNA vaccine against porcine epidemic diarrhea virus (PEDV), its construction method, and its applications. The circular PEDV-COE1 RNA vaccine is obtained through gene synthesis, in vitro transcription, circularization, and liposome nanoparticle encapsulation. The DNA molecules, circular RNA molecules, protein sequences, and gene sequences involved in this invention can all be used to prepare various porcine diarrhea virus vaccines. Intramuscular injection of PEDV-COE1 RNA into pigs induces high levels of PEDV-COE1 neutralizing antibodies, effectively reducing the incidence of diarrhea in piglets and demonstrating significant promotional value for the prevention and control of PEDV. The circular PEDV-COE1 RNA vaccine is obtained through gene synthesis, in vitro transcription, circularization, and liposome nanoparticle encapsulation. This invention protects the DNA molecule encoding the gene. The circular RNA molecules, protein sequences, and gene sequences can all be used to prepare various porcine diarrhea virus vaccines. Intramuscular injection of PEDV-COE1 RNA into pigs induces high levels of PEDV-COE1 neutralizing antibodies, effectively reducing the incidence of diarrhea in piglets and demonstrating significant promotional value for the prevention and control of PEDV.

[0062] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments of the present invention.

[0063] Example 1: Construction of recombinant plasmids

[0064] By performing S gene sequencing analysis on a large number of clinical samples of porcine epidemic diarrhea virus (PEDV) and screening for optimal COE sequences through extensive mutation analysis of the COE region of the S gene, detailed information on the COE sequences from different major prevalent strains currently in clinical use is presented in the table below.

[0065]

[0066] SEQ ID NO:1

[0067] ATCAGTTTCGTCACCCTGCCTTCCTTCAACGACCATAGTTTTGTCAACATTACGGTTTCCGCTAGTTTCGGGGGACATAGCGGTGCTAACCTGATTGCCTCCGATACCACAATTAATGGCTTCAGCTCCTTCTGCGTCGATACGAGGCAGTTCACCATCAGTCTGTTTTACAACGTGACCAATTCTTATGGATACGTGTCAAAGTCCCAGGACAGTAACTGCCCATTTACCTTGCAGAGCGTCAATGACTACCTCTCTTTTTCTAAGTTTTGCGTGTCTACTTCCCTGCTGGCCAGCGCCTGTACCATTGATTTGTTCGGTTATCCCGAGTTCGGGAGCGGCGTCAAATTCACGTCCCTGTATTTTCAGTTTACGAAGGGCGAGCTGATTACTGGGACCCCAAAACCTCTGGAGGGTGTG

[0068] SEQ ID NO:2

[0069] ATTTCTTTTGTTACTTTGCCATCATTTAATGATCATTCTTTTGTTAATATTACTGTCTCTGCGGCTTTTGGTGGTCTTAGTAGTGCCAATCTCGTTGCATCTGACACTACTATCAATGGGTTTAGTTCTTTCTGTGTTGACACTAGACAATTTACCATTACACTGTTTTATAATGTTACAAACAGTTATGGTTATGTGTCTAAATCACAGGATAGTAATTGTCCTTTCACCTTGCAATCTGTTAATGATTACCTGTCTTTTAGCAAATTTTGTGTTTCAACCAGCCTTTTGGCTGGTGCTTGTACCATAGATCTTTTTGGTTACCCTGCGTTCGGTAGTGGTGTTAAGTTGACGTCCCTTTATTTTCAATTCACAAAAGGTGAGTTGATTACTGGCACGCCTAAACCACTTGAAGGTATC

[0070] SEQ ID NO:3

[0071] ATTTCTTTTGTTACTTTGCCATTATTTAATGATCATTCTTTTGTTAATATTACTGTCTCTGCGGCTTTTGGTGGTCTTAGTAGTGCCAATCTCGTTGCATCTGACACTACTATCAATGGGTTTAGTTCTTTCTGTGTTGACACTAGACAATTTACCATTACACTGTTTTATAATGTTACAAACAGTTATGGTTATGTGTCTAAATCACAGGATAGTAATTGTCCTTTCACCTTGCAATCTGTTAATGATTACCTGTCTTTTAGCAAATTTTGTGTTTCAACCAGCCTTTTGGCTGGTGCTTGTACCATAGATCTTTTTGGTTACCCTGCGTTCGGTAGTGGTGTTAAGTTGACGTCCCTTTATTTTCAATTCACAAAAGGTGAGTTGATTACTGGCACGCCTAAACCACTTGAAGGTATC

[0072] SEQ ID NO:4

[0073] ATTTCTTTTGTTACTTTGCCATCATTTAATGATCATTCTTTTGTTAATATTACTGTCTCTGCGGCTTTTGGTGGTCATAGTGGTGCCAACCTCATTGCATCTGACACTACTATCAATGGGTTTAGTTCTTTCTGTGTTGACACTAGACAATTTACCATTACACTGTTTTATAACGTTACAAACAGTTATGGTTATGTGTCTAAATCACAGGATAGTAATTGCCCTTTCACCTTGCAATCTGTTAATGATTACCTGTCTTTTAGCAAATTTTGTGTTTCAACCAGCCTTTTGGCTGGTGCTTGTACCATAGATCTTTTTGGTTACCCTGAGTTCGGTAGTGGTGTTAAGTTTACGTCCCTTTATTTTCAATTCACAAAGGGTGAGTTGATTACTGGCACGCCTAAACCACTTGAAGGTGTC

[0074] SEQ ID NO:5

[0075] ATTTCTTTTGTTACTCTGCCATCATTTAATGATCATTCTTTTGTTAACATTACTGTATCTGCTTCCTTTGGTGGTCATAGTGGTGCCAACCTTATTGCATCTGACACTACTATCAATGGGTTTAGTTCTTTCTGTGTTGACACTAGACAATTTACCATTTCACTGTTTTATAACGTTACAAACAGTTATGGTTATGTGTCTAAATCACAGGACAGTAATTGCCCTTTCACCTTGCAATCTGTTAATGATTACCTGTCTTTTAGCAAATTTTGTGTTTCCACCAGCCTTTTGGCTAGTGCCTGTACCATAGATCTTTTTGGTTACCCTGAGTTTGGTAGTGGTGTTAAGTTTACGTCCCTTTACTTTCAATTCACAAAGGGTGAGTTGATTACTGGCACGCCTAAACCACTTGAAGGTGTC

[0076] SEQ ID NO:6

[0077] ATTTCTTTTGTTACTCTGCCATCATTTAATGATCATTCTTTTGTTAACATTACTGTCTCTGCTTCCTTTGGTGGTTATAGTGGTGCCAACCTTATTGCATCTGACACTACTATCAATGGGTTTAGTTCTTTCTGTGTTGACACCAGACAATTTACCATTTCACTGTTTTATAACGTTACAAACAGTTATGGTTATGTGTCTAAATCACAGGACAGTAATTGCCCTTTCACCTTGCAATCTGTTAATGATTACCTGTCTTTTAGCAAATTTTGTGTTTCCACCAGCCTTTTGGCTAGTGCCTGTACCATAGATCTTTTTGGTTACCCTGAGTTTGGTAGTGGTGTTAAGTTTACGTCCCTTTACTTTCAATTCACAAAGGGTGAGTTGATTACTGGCACGCCTAAACCACTTGAAGGTGTC

[0078] Such as Figure 1As shown, T7-IRES1-SP-COE-GS-Foldon-IRES2 were synthesized sequentially, yielding sequences as shown in SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12, respectively. Simultaneously, EcoRV restriction endonucleases were added to both ends, and the synthesized fragments were ligated into the EcoRV restriction sites of the pUC19 cloning vector at 16℃ for 2 h to obtain the recombinant plasmid. T7 RNA polymerase recognizes the T7 promoter sequence on the sense strand and then uses the antisense strand as a template to transcribe in the 5'-3' direction. The transcribed sequence should be completely identical to the sense strand, with the T7 promoter serving as the initiation sequence for generating the transcription product. The IRES sequence can fold into a structure similar to initiating tRNA, thereby mediating ribosome binding to RNA and initiating protein translation. SP is the signal peptide sequence of human tissue plasminogen activator, a short peptide that guides the translocation of newly synthesized proteins from the cell to the endoplasmic reticulum and subsequent secretion outside the cell. The COE region of porcine epidemic diarrhea virus (PEDV) is an important immunogenic region containing multiple antigenic epitopes. The antibodies induced by COE are mostly neutralizing antibodies, which are key components in blocking virus-cell binding, stimulating host immune responses, neutralizing antibodies, and protecting the immune system from viral infection. GS is the linker sequence of the fusion protein, and its amino acid sequence consists of "GGGGS". Foldon is derived from the C-terminus of T4 phage fibrin and consists of 27 amino acids (GYIPEAPRDGQAYVRKDGEWVLLSTFL). This domain can link with viral proteins to form oligomeric homoproteins, significantly increasing the protein's immunogenicity.

[0079] The constructed recombinant plasmids were named pUC-T7-IRES1-SP-COE1-Foldon-IRES2, pUC-T7-IRES1-SP-COE2-Foldon-IRES2, pUC-T7-IRES1-SP-COE3-Foldon-IRES2, pUC-T7-IRES1-SP-COE4-Foldon-IRES2, pUC-T7-IRES5-SP-COE1-Foldon-IRES2, and pUC-T7-IRES1-SP-COE6-Foldon-IRES2, respectively. The constructed recombinant plasmids were transformed into DH5α Escherichia coli. After enzyme digestion and sequencing identification, the obtained positive strains were expanded in LB medium, and the plasmids were extracted and stored for later use.

[0080] SEQ ID NO:7

[0081]

[0082] SEQ ID NO:8

[0083]

[0084] SEQ ID NO:9

[0085]

[0086] SEQ ID NO:10

[0087]

[0088] SEQ ID NO:11

[0089]

[0090] SEQ ID NO:12

[0091]

[0092] Example 2: In vitro expression, preparation, and purification of circular RNA

[0093] 1. The recombinant plasmids pUC-T7-IRES1-SP-COE1-Foldon-IRES2, pUC-T7-IRES1-SP-COE2-Foldon-IRES2, pUC-T7-IRES1-SP-COE3-Foldon-IRES2, pUC-T7-IRES1-SP-COE4-Foldon-IRES2, pUC-T7-IRES1-SP-COE5-Foldon-IRES2, and pUC-T7-IRES1-SP-COE6-Foldon-IRES2 prepared in Example 1 were used... IRES2 was digested with EcoRV restriction endonucleases and then recovered via gel electrophoresis to obtain linearized fragments of T7-IRES1-SP-COE1-Foldon-IRES2, T7-IRES1-SP-COE2-Foldon-IRES2, T7-IRES1-SP-COE3-Foldon-IRES2, T7-IRES1-SP-COE4-Foldon-IRES2, T7-IRES1-SP-COE5-Foldon-IRES2, and T7-IRES1-SP-COE6-Foldon-IRES2. The enzyme digestion electrophoresis images are shown below. Figure 2 As shown.

[0094] 2. RNA was synthesized in vitro using the HiScribe T7 High-Efficiency RNA Synthesis Kit (NEB, E2040S), and appropriate optimizations were made based on the instruction manual.

[0095] The reaction system is as follows:

[0096]

[0097] After mixing, place in a 37℃ metal bath for 16 hours.

[0098] 3. Add 70 μl Nuclease-free H2O, 10 μl 10×DNaseI Buffer and 2 μl DNase I to the 20 μl system after transcription is completed, mix well and incubate in a 37℃ metal bath for 15 minutes.

[0099] 4. After transcription, the RNA was purified using the QIAGEN RNA purification kit to obtain the purified circular RNA precursor.

[0100] 5. Ligate with T4 RNA ligase 2 at 25°C for 8 hours, and finally treat the ligated circular product with RNase R to remove the linear RNA precursor.

[0101] 6. A 4.6 × 300 mm size-limited column with a particle size of 5 mm and a pore size of 2000 Å was used in the high performance liquid chromatography (HPLC) to collect fractions rich in circular RNA. The RNA was then purified by column chromatography using the Monarch RNA Purification Kit (NEB, T2050L).

[0102] 7. To further reduce the immunogenicity of the purified circular RNA, the circular RNA was heated at 65°C for 3 minutes, cooled on ice, and then incubated with rapid heat-sensitive calf intestinal alkaline phosphatase (CIP) at 37°C for 10 minutes, followed by heat inactivation at 80°C. Finally, the circular RNA was purified and concentrated using an RNA purification and concentration kit (ApexBio, K1069) to obtain the desired result.

[0103]

[0104] Example 3: Evaluation of the neutralizing effect of neutralizing antibodies against porcine epidemic diarrhea virus (PEDV) in mice immunized with a circular RNA vaccine.

[0105] 1. Preparation of circular RNA vaccine against porcine epidemic diarrhea virus

[0106] The anti-swine epidemic diarrhea virus circular RNA was prepared according to the method in Example 2. The anti-swine epidemic diarrhea virus circular RNA was diluted with PNI buffer to 20 ug / ml. The LNP was mixed with the diluted anti-swine epidemic diarrhea virus circular RNA at a ratio of 1:3 to obtain the anti-swine epidemic diarrhea virus circular RNA vaccine.

[0107] 2. Immunization of Kunming rats

[0108] Thirty-five 8-week-old male Kunming rats were randomly divided into seven groups: a negative control group (200 μL PBS), a PEDV-COE1 group (200 μL PEDV-COE1), a PEDV-COE2 group (200 μL PEDV-COE2), a PEDV-COE3 group (200 μL PEDV-COE3), a PEDV-COE4 group (200 μL PEDV-COE4), a PEDV-COE5 group (200 μL PEDV-COE5), and a PEDV-COE6 group (200 μL PEDV-COE6). After one intramuscular immunization, a booster immunization was administered 14 days later, with each mouse receiving 3 μg of anti-porcine epidemic diarrhea virus circular RNA vaccine.

[0109] 3. Detection of PEDV COE-specific neutralizing antibodies in serum

[0110] Blood was collected from the ear vein on day 14 after the second immunization, and serum was separated. The serum was inactivated by heating at 56°C for 30 minutes to obtain inactivated serum. Following standard virus neutralization assays, 50 μL of inactivated serum was added to each well of a 96-well microplate and serially diluted 10-fold, with four wells for each dilution. 50 μL of PEDV CH / JX / 01 strain (100 TCID50) was added to each well, and the mixture was incubated at 37°C for 1 h. The resulting mixture was then seeded into a 96-well plate containing a confluent layer of Vero81 cells and incubated at 37°C with 5% CO2 for 2 h. Cells were then washed twice with 1×PBS buffer (pH 7.2–7.4), and 200 μL of DMEM medium containing 10 ng / ml trypsin was added. The plates were then incubated at 37°C with 5% CO2 for CPE observation. Positive and negative serum controls, a virus control, and a normal cell control were also established. Simultaneously, the PEDV CH / JX / 01 strain was replaced with the CV777 and DR13 strains, and the above routine virus neutralization test steps were repeated to determine the neutralizing titers of serum against different viruses. The serum dilution that reduced cytopathic effects by 50% was taken as the neutralizing titer of that serum.

[0111]

[0112] Neutralization titer results showed that the RNA vaccine designed and synthesized in this invention, after injection into Kunming mice, exhibited strong neutralizing ability against all currently prevalent strains. In contrast, RNA vaccines designed based on currently prevalent strains only provide strong immune protection against the same virus or the same subtype, offering poor protection against different subtypes.

[0113] Example 4: Evaluation of the immunization effect of a circular RNA vaccine against porcine epidemic diarrhea virus on pregnant sows

[0114] 1. Preparation of circular RNA vaccine against porcine epidemic diarrhea virus

[0115] Circular RNA against swine epidemic diarrhea virus was prepared according to the method in Example 2. The circular RNA against swine epidemic diarrhea virus was diluted to 200 ug / ml with PNI buffer. Commercial LNP (Hanheng Biotechnology, HB-LF-1000) was mixed with the diluted circular RNA against swine epidemic diarrhea virus at a ratio of 1:3 to obtain the circular RNA vaccine against swine epidemic diarrhea virus.

[0116] 2. Immunized pregnant sows

[0117] Twelve pregnant sows (approximately 1.5 months from gestation) who were negative for both PEDV antibodies and antigens were randomly divided into four groups: a negative control group (4 ml PBS), a low-dose PEDV-COE1 group (10 ug / sow), a medium-dose PEDV-COE1 group (50 ug / sow), and a high-dose PEDV-COE1 group (250 ug / sow). After one intramuscular immunization, a booster immunization was administered 14 days later, with each booster dose being 4 ml.

[0118] 3. Detection of PEDV COE-specific neutralizing antibodies in serum

[0119] Blood was collected from the ear vein on day 0 before immunization, day 14 after immunization, day 28 after immunization, and day 56 after immunization, and serum was separated. The serum was inactivated by heating at 56°C for 30 minutes to obtain inactivated serum. A standard virus neutralization assay was performed. 50 μL of inactivated serum was added to each well of a 96-well microplate and serially diluted 10-fold, with 4 wells for each dilution. 50 μL of PEDV virus (100 TCID50) was added to each well, and the mixture was incubated at 37°C for 1 h. The resulting mixture was then seeded into a 96-well plate containing a confluent layer of Vero81 cells and incubated at 37°C with 5% CO2 for 2 h. Cells were then washed twice with 1×PBS buffer (pH 7.2–7.4), and 200 μL of DMEM medium containing 10 ng / ml trypsin was added. The cells were then incubated at 37°C with 5% CO2 to observe cytotoxicity (CPE). Positive and negative serum controls, a virus control, and a normal cell control were also included. The serum dilution that reduces cytopathic effects by 50% is the neutralizing titer of that serum.

[0120] Neutralization titer results showed that after immunization with PEDV-COE1, pregnant sows produced neutralizing antibodies against the variant strain of PEDV. Moreover, the neutralization titers of the medium-dose group and the high-dose group were greater than or equal to 64 after the second immunization, which could produce a strong virus neutralization effect.

[0121]

[0122] 3. Evaluation of the protective efficacy of circular RNA vaccine against porcine epidemic diarrhea virus

[0123] Five 3-day-old suckling piglets born to immunized pregnant sows were selected. Before challenge with the virus, the piglets were weighed and their feces were collected. Each piglet was orally vaccinated with 10⁵ TCID⁵ PEDV. After challenge, the piglets were fed with their regular breast milk. The piglets were weighed daily, and their mental state was observed, along with fecal samples collected and recorded. After challenge, the piglets' mental state was recorded (energetic: 0; depressed: 1; lethargic: 2; extremely lethargic: 3).

[0124] The results of the PEDV challenge experiment showed that immunization of pregnant sows with medium-to-high doses of PEDV-COE1 (50μg, 250μg) provided complete protection for their piglets; the suckling piglets maintained good mental condition, and the treatment had a high safety profile, with no impact on their healthy growth during the rearing process. Figure 3 and Figure 4 ).

[0125]

[0126] Example 5: Evaluation of the immunization effect of a circular RNA vaccine against porcine epidemic diarrhea virus on newborn piglets.

[0127] 1. Preparation of circular RNA vaccine against porcine epidemic diarrhea virus

[0128] The circular RNA against swine epidemic diarrhea virus was prepared according to the method in Implementation Case 2. The circular RNA against swine epidemic diarrhea virus was diluted to 200 ug / ml with PNI buffer. The LNP was mixed with the diluted circular RNA against swine epidemic diarrhea virus at a ratio of 1:3 to obtain the circular RNA vaccine against swine epidemic diarrhea virus.

[0129] 2. Immunize newborn piglets

[0130] Twenty one-day-old piglets that were negative for both PEDV antibodies and antigens were randomly divided into four groups: a negative control group (2 ml PBS), a low-dose PEDV-COE1 group (5 ug / pig), a medium-dose PEDV-COE1 group (25 ug / pig), and a high-dose PEDV-COE1 group (125 ug / pig). One intramuscular immunization was administered, with each immunization dose being 2 ml.

[0131] 3. Detection of PEDV COE-specific neutralizing antibodies in serum

[0132] Blood was collected from the ear vein on day 0 before immunization and day 14 after immunization, and serum was separated. The serum was inactivated by heating at 56°C for 30 minutes to obtain inactivated serum. A standard virus neutralization assay was performed: 50 μL of inactivated serum was added to each well of a 96-well microplate, and serially diluted 10-fold, with each dilution in 4 wells. 50 μL of PEDV virus (100 TCID50) was added to each well, and the mixture was incubated at 37°C for 1 h. The resulting mixture was then seeded into a 96-well plate confluent with a monolayer of Vero81 cells and incubated at 37°C with 5% CO2 for 2 h. Cells were then washed twice with 1×PBS buffer (pH 7.2–7.4), and 200 μL of DMEM medium containing 10 ng / ml trypsin was added. The cells were then incubated at 37°C with 5% CO2 to observe cytopathic effects (CPE). Positive and negative serum controls, a virus control, and a normal cell control were also included. The serum dilution that reduced cytopathic effects by 50% was considered the neutralizing titer.

[0133] Neutralization titer results showed that after piglets were immunized with the PEDV-COE1 RNA vaccine, they produced neutralizing antibodies against the PEDV variant strain.

[0134]

[0135] 3. Evaluation of the protective efficacy of circular RNA vaccine against porcine epidemic diarrhea virus

[0136] Before challenging the immunized suckling piglets with the virus, weigh them and collect fecal samples. Fourteen days after immunization, each piglet was orally vaccinated with 105 TCID50 PEDV. After challenge, the piglets were artificially fed. Weigh the piglets daily, observe their mental state, and collect and record their fecal samples. After challenge, start recording the piglets' mental state (energetic: 0; depressed: 1; lethargic: 2; extremely lethargic: 3).

[0137] The results of the PEDV challenge experiment showed that immunization of suckling piglets with medium- and high-dose cyclic PEDV-COE1 RNA vaccine (25 μg, 125 μg) provided complete protection; the suckling piglets maintained good mental condition, and the vaccine had a high safety profile, with no adverse effects on their healthy growth during the rearing process. Figure 5 and Figure 6 ).

[0138]

[0139] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A method for preparing a circular RNA vaccine against porcine epidemic diarrhea virus, characterized in that: The sequence SEQ ID NO.7 was introduced into a cloning vector to construct a recombinant plasmid. After linearizing the recombinant plasmid, circular RNA was prepared. The circular RNA was then mixed with LNP to prepare a circular RNA vaccine.

2. The method for preparing a circular RNA vaccine against porcine epidemic diarrhea virus according to claim 1, characterized in that: The vector is a pUC19 cloning vector.

3. The method for preparing a circular RNA vaccine against porcine epidemic diarrhea virus according to claim 1, characterized in that, Includes the following steps: 1) The sequence SEQ ID NO:7 was transferred into the empty vector pUC19 to obtain the recombinant vector pUC-T7-IRES1-SP-COE-GS-Foldon-IRES2; 2) The pUC-T7-IRES1-SP-COE-GS-Foldon-IRES2 recombinant vector was transformed into E. coli and cultured on a large scale; 3) The pUC-T7-IRES1-SP-COE-GS-Foldon-IRES2 recombinant vector was digested with enzymes and recovered to obtain a large number of T7-IRES1-SP-COE-GS-Foldon-IRES2 fragments; 4) Using the T7-IRES1-SP-COE-GS-Foldon-IRES2 fragment as a template, in vitro transcription was performed. After transcription, the DNA template was removed and the RNA was purified to obtain the circular RNA precursor. 5) The RNA precursor was ligated using T4 RNA ligase, and then the uncircularized RNA was removed; after purification, high-purity circular RNA against swine epidemic diarrhea was obtained. 6) Dilute the circular RNA with a buffer solution, mix the LNP and circular RNA solution at a volume ratio of 1:3, then dilute with PBS buffer and concentrate by ultrafiltration to obtain the circular RNA vaccine against swine epidemic diarrhea.

4. The method for preparing a circular RNA vaccine against porcine epidemic diarrhea virus according to claim 3, characterized in that: In step 6), the circular RNA is diluted to a final concentration of 200 μg / ml.

5. The method for preparing a circular RNA vaccine against porcine epidemic diarrhea virus according to claim 3, characterized in that: The LNP and circular RNA solution were mixed at a volume ratio of 1:3 using NanoAssemblr Ignite. The LNP-circRNA preparation was then diluted with PBS buffer and concentrated by ultrafiltration to obtain a circular RNA vaccine against porcine epidemic diarrhea.

Images