Two oligo DNA sets of sgRNA for site-directed knockout of rice gene OsZFP8 and their applications

Abstract

The invention discloses an oligo DNA set of two sgRNAs for knocking out the rice gene OsZFP8 at a fixed point and an application thereof. The two sgRNA nucleotide sequences for gene editing OsZFP8 are shown in the sequence table SEQ ID NO.1 and SEQ ID NO.2. The rice callus is transformed by using the Agrobacterium-mediated method through constructing a Crispr Cas9 gene editing vector, and positive transgenic plants are obtained by screening and identification, so as to achieve the knockout of the rice OsZFP8 gene. The mutant rice with two different mutation modes obtained by using the Crispr Cas9 gene editing system both have a significantly increased chalky grain rate, and the rice endosperm is opaque. The wild-type normal functional OsZFP8 gene CDS sequence is introduced into the mutant by a transgenic method, so that the mutant rice endosperm can be restored to the wild-type transparent phenotype. The sgRNA prepared by the invention can efficiently, quickly and accurately target and edit the rice OsZFP8 gene, which has certain significance in basic research (molecular mechanism of rice endosperm development and rice quality) and production practice (rice quality improvement).

Description

Technical Field

[0001] The invention relates to the technical fields of biotechnology and plant genetic engineering, and in particular to two oligo DNA sets of sgRNA for site-directed knockout of rice gene OsZFP8 and applications thereof. Background Art

[0002] Rice is an important food crop in my country and the staple food of more than half of the world's population. The quality of rice plays a vital role in its commercial value and whether it can meet the people's increasing needs. Chalkiness is the white opaque part in the rice endosperm. Its evaluation indicators include chalkiness, chalky grain rate, chalky area, etc. This is due to the gap between the starch body and protein body in the endosperm. The loose arrangement leads to the opacity caused by the refraction of light. It is an important factor that limits the appearance quality of rice, reduces the commodity value, and also affects rice processing (reducing the whole polished rice rate) and cooking quality. It is one of the main reasons that limit the compliance rate of high-quality rice in my country. For a long time, the improvement of rice appearance quality has been the top priority in the task of rice quality improvement. Therefore, it is necessary to reduce the chalky grain rate of rice and increase the whole polished rice rate while achieving stable yield to achieve the goal of high-quality breeding. At present, researchers have discovered a series of genes related to chalkiness through QTL positioning and map-based cloning of mutant genes, but they still cannot meet the huge demand for quality improvement. Discovering and studying new genes that affect chalkiness traits and applying them to rice variety breeding has important theoretical significance and production application potential. Summary of the invention

[0003] The problem to be solved by the present invention is to provide an oligo DNA group of two sgRNAs for knocking out the rice gene OsZFP8 at a fixed point and its application. The present invention mines a gene for controlling the chalky grain rate of rice (the rice zinc finger protein C2H2 gene is named OsZFP8) from rice. The gene has the function of affecting the chalky grain rate of grains and controlling the thousand-grain weight of rice. It can be used for rice improvement, aiming to use this gene to increase yield and improve rice quality. The present invention provides an sgRNA for knocking out rice OsZFP8 based on CRISPR-CAS9 technology and a vector for knocking out the rice OsZFP8 gene. A method for targeted knocking out rice OsZFP8 using CRISPR / Cas9 technology.

[0004] The technical solution provided by the present invention for solving the above problems is: an oligo DNA group of two sgRNAs for site-directed knockout of the rice gene OsZFP8, including two sgRNA target sites of the OsZFP8 gene, whose DNA sequences are shown in SEQ ID NO.1 and SEQ ID NO.2; four oligo DNAs designed according to the target sequences: one oligo DNA group is OsZFP8(1)F and OsZFP8(1)R, and the other oligo DNA group is OsZFP8(2)F and OsZFP8(2)R. The above four oligo DNAs are shown in the sequence listing SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6.

[0005] The present invention also provides an application of the above two oligoDNA groups of sgRNA for site-directed knockout of rice OsZFP8 gene in rice OsZFP8 gene editing breeding.

[0006] The present invention also provides a vector of two sgRNAs for knocking out the rice OsZFP8 gene at a fixed point. The vector is a CRISPR / Cas Vector-BGK03. Two groups of oligo DNAs: OsZFP8(1)F and OsZFP8(1)R, OsZFP8(2)F and OsZFP8(2)R are mixed, annealed to form a dimer structure, and connected with a linearized BGK03 vector fragment to construct BGK03-ZFP8-cas9 plasmids containing the rice OsZFP8 gene target sequence. The nucleotide sequence of OsZFP8(1)F is shown in SEQ ID NO.3, the nucleotide sequence of OsZFP8(1)R is shown in SEQ ID NO.4, the nucleotide sequence of OsZFP8(2)F is shown in SEQ ID NO.5, and the nucleotide sequence of OsZFP8(2)R is shown in SEQ ID NO.6.

[0007] The present invention also provides two pairs of primer pairs for identifying the editing status of the sgRNA target region of the OsZFP8 gene, the DNA sequences of the sgRNA1 target region primer pair are shown in SEQ ID NO.7 and SEQ ID NO.8, and the DNA sequences of the sgRNA2 target region primer pair are shown in SEQ ID NO.9 and SEQ ID NO.10.

[0008] The present invention also provides a gene encoding a zinc finger transcription factor (C2H2), wherein the gene is one of the following nucleotide sequences:

[0009] 1) The genomic nucleotide sequence of the gene is shown in the sequence listing SEQ ID NO.11, and its CDS sequence is shown in the sequence listing SEQ ID NO.12;

[0010] 2) The amino acid sequence of the encoded protein is shown in the sequence listing SEQ ID NO.13;

[0011] 3) The nucleotide sequences of the two mutant genes edited by the gene are shown in the sequence listing as SEQ ID NO.14 and SEQ ID NO.15, and the CDS sequences are shown in the sequence listing as SEQ ID NO.16 and SEQ ID NO.17;

[0012] 4) The amino acid sequence of the protein encoded by the mutant gene is shown in the sequence listing SEQ ID NO.18 and SEQ ID NO.19.

[0013] The present invention also provides a use of the gene encoding the zinc finger transcription factor (C2H2) as described above in cultivating transgenic plants with a change in the rate of chalky grains in rice endosperm.

[0014] The present invention also provides a sgRNA for knocking out rice OsZFP8 based on CRISPR-CAS9 technology and a vector for knocking out the rice OsZFP8 gene. The method for targeted knocking out rice OsZFP8 using CRISPR / Cas9 technology comprises the following steps:

[0015] a) Select two target sites of the OsZFP8 gene sequence, 436-455 (coding region 3-22) and 2217-2236 (coding region 789-808) as the target sequences of the CRISPR / Cas9 system:

[0016] (SEQ ID NO.1):GCTGAGTTCTTGCGCGCCGA CGG

[0017] (SEQ ID NO.2):AATGGTGAGTCCCCGTGCTG CGG

[0018] Design four oligo DNAs according to the target sequence:

[0019] (SEQ ID NO.3)ZFP8(1)F: TGATTGGCTGAGTTCTTGCGCGCCGA

[0020] (SEQ ID NO.4)ZFP8(1)R:AAACTCGGCCGCAAGAACTCAGCCA

[0021] (SEQ ID NO.5)ZFP8(2)F: TGATTGAATGGTGAGTCCCCGTGCTG

[0022] (SEQ ID NO.6)ZFP8(2)R:AAACCAGCACGGGGACTCACCATTCA

[0023] b) The oligo DNA groups ZFP8(1)F and ZFP8(1)R, ZFP8(2)F and ZFP8(2)R were mixed respectively, heated at 95°C for 3 min in a PCR instrument, then cooled to 20°C at a constant rate (at a rate of about 0.2°C / s) to form a dimer structure by annealing reaction; and connected with the linearized CRISPR / Cas Vector-BGK03 vector fragment (reacted at 20°C for 1 h) to construct BGK03-ZFP8-cas9 plasmids containing the rice OsZFP8 gene target sequence.

[0024] c) Infect rice callus with Agrobacterium tumefaciens EHA105 containing the BGK03-ZFP8-cas9 plasmid, and select positive transgenic rice plants with hygromycin.

[0025] d) using specific primers ZFP8-CX1-F (SEQ ID NO.7) and ZFP8-CX1-R (SEQ ID NO.8) and ZFP8-CX2-F (SEQ ID NO.9) and ZFP8-CX2-R (SEQ ID NO.10), the sequences containing the two target sequences were amplified and sequenced to screen and identify the editing status of OsZFP8;

[0026] (SEQ ID NO.7)ZFP8-CX1-F:TAAGGGAAGAGGTGGGAGT

[0027] (SEQ ID NO.8)ZFP8-CX1-R:GTGGGAGGGGTCGTGGTGG

[0028] (SEQ ID NO.9)ZFP8-CX2-F:TTCATCGAGCACCAGGAC

[0029] (SEQ ID NO. 10) ZFP8-CX2-R:GGCGAAGAGGAAGCGTAG.

[0030] Compared with the prior art, the advantages of the present invention are: after the gene editing vector BGK03-ZFP8-cas9 transforms rice, it can achieve efficient, rapid and specific targeted editing and knockout of the rice OsZFP8 gene. Compared with the wild type, the transgenic strains all showed reduced seed weight and significantly increased endosperm chalky grain rate, indicating that the OsZFP8 gene can regulate the appearance quality and thousand-grain weight of rice, and can be used for high-yield and high-quality rice breeding. The transgenic materials obtained by research can be directly used to study the function and mechanism of action of OsZFP8, laying the foundation for better use of the OsZFP8 gene for genetic improvement in production practice. It provides new gene resources for high-quality breeding of cereal crops such as rice, and also provides technical support for cloning related genes in other crops. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] The drawings described herein are used to provide further understanding of the present invention and constitute a part of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0032] Figure 1 . is a vector map of the gene editing vector CRISPR / Cas Vector-BGK03 used in the present invention.

[0033] Figure 2 This is an information diagram of the target sites of OsZFP8 gene knockout.

[0034] Figure 3 This is the sequencing peak diagram of target site 1 sequence.

[0035] Figure 4 This is the sequencing peak diagram of target site 2 sequence.

[0036] Figure 5 The following are the phenotypes and scanning electron micrographs of wild-type and mutant brown rice.

[0037] Figure 6 This is a statistical graph of grain shape, grain weight and chalky grain rate of the wild type and mutant. DETAILED DESCRIPTION

[0038] The following will describe the implementation methods of the present invention in detail with reference to the accompanying drawings and embodiments, so that the implementation process of how the present invention applies technical means to solve technical problems and achieve technical effects can be fully understood and implemented accordingly.

[0039] It should be understood that when used in this specification and the appended claims, the terms "include" and "comprises" indicate the presence of described features, integers, steps, operations, elements and / or components, but do not exclude the presence or addition of one or more other features, integers, steps, operations, elements, components and / or combinations thereof.

[0040] It should also be understood that the terms used in this description of the embodiments of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the embodiments of the present invention. As used in the description of the embodiments of the present invention and the appended claims, unless the context clearly indicates otherwise, the singular forms of "a", "an" and "the" are intended to include plural forms.

[0041] Example 1: Design and synthesis of rice OsZFP8 gene sgRNA sequence

[0042] The genomic nucleotide sequence, CDS nucleotide sequence and protein sequence of the rice OsZFP8 gene are shown in SEQ ID NO.11, SEQ ID NO.12 and SEQ ID NO.13.

[0043] The CRISPR / Cas9 editing target sequence in this example is 19 bp in length and is located in the nucleotide sequence 789-808 on the 1st exon and the 3rd exon of the conserved sequence of the coding region of the OsZFP8 gene. The editing target sequence is (SEQ ID NO. 1): GCTGAGTTCTTGCGCGCCGA CGG ;(SEQ ID NO.2):AATGGTGAGTCCCGTG CTG CGG , this sequence is specific to the rice genome and the off-target probability is extremely low.

[0044] Four oligo DNAs are synthesized according to the target sequence:

[0045] (SEQ ID NO.3)ZFP8(1)F: TGATTGGCTGAGTTCTTGCGCGCCGA

[0046] (SEQ ID NO.4)ZFP8(1)R:AAACTCGGCCGCAAGAACTCAGCCA

[0047] (SEQ ID NO.5)ZFP8(2)F: TGATTGAATGGTGAGTCCCCGTGCTG

[0048] (SEQ ID NO.6)ZFP8(2)R:AAACCAGCACGGGGACTCACCATTCA

[0049] Example 2: Construction of OsZFP8 editing vector BGK03-ZFP8-cas9

[0050] The oligo DNA groups ZFP8(1)F and ZFP8(1)R, ZFP8(2)F and ZFP8(2)R were mixed, heated at 95℃ for 3min, and then cooled to 20℃ (at a rate of about 0.2℃ / s) by annealing reaction to form a dimer structure; they were connected with the linearized CRISPR / Cas Vector-BGK03 vector fragment (reacted at 20℃ for 1h) to construct BGK03-ZFP8-cas9 plasmids containing the rice OsZFP8 gene target sequence. The ligation products were transformed into Escherichia coli DH5α by heat shock method (42℃), evenly spread on LB solid medium containing kan antibiotics, and cultured at 37℃ overnight. Single colonies were selected and cultured in LB liquid medium (+kan) for 4h, and sequenced after bacterial inspection. The bacteria with correct sequencing were selected to extract plasmid DNA, and the editing vector BGK03-ZFP8-cas9 containing the rice OsZFP8 gene target sequence was obtained. The vector map is shown in Figure 1 The distribution of the target sites designed in the experiment on the gene is as follows Figure 2 shown.

[0051] Example 3, BGK03-ZFP8-cas9 vector Agrobacterium transformation

[0052] The BGK03-ZFP8-cas9 plasmid was transformed into Agrobacterium tumefaciens by freeze-thaw method. 10 μL of plasmid DNA was added to 200 μL of Agrobacterium EHA105 competent cells, ice bathed for 30 minutes, frozen in liquid nitrogen for 3 minutes, and water bathed at 37°C for 5 minutes. 1 mL of YEB medium was added and shaken at 28°C for 3-4 hours. Centrifuged at 6000 rpm for 1 minute at room temperature, the supernatant was discarded, and 200 μL of YEB medium was added to resuspend the cells, which were then spread on YEB solid medium (+ rifampicin) and cultured at 28°C for 3 days. Single colonies were picked for identification.

[0053] Example 4, genetic transformation

[0054] This implementation uses Agrobacterium to transform the recipient rice variety Zhonghua 11 (ZH11, japonica rice) to obtain gene-edited mutants. 300 grains of Zhonghua 11 brown rice were selected and soaked in 75% ethanol for 1 minute, then the waste liquid was discarded, and then disinfected with sodium hypochlorite solution for 30 minutes, washed with sterile water 5-6 times, and dried with sterile gauze and placed on NB induction medium containing 2,4-D (2mg / L). After about 2 weeks of culture, the vigorously growing callus was selected for Agrobacterium infection. The callus tissue was infected with the EHA105 strain containing the 2 editing vector (BGK03-ZFP8-cas9), and after co-cultivation for 3 days in the dark and 25°C, it was cultured in the light on the screening medium containing 50mg / LHygromycin for about 14 days, and the selected pre-differentiated callus was transferred to the differentiation medium for culture. After obtaining resistant transgenic plants, they were removed from the test tube and transferred to the field for planting.

[0055] Example 5. Detection of mutation type of gene-edited mutant OsZFP8

[0056] DNA extraction: In this experiment, the CTAB method was used to extract genomic DNA from rice samples.

[0057] (1) Grinding: Cut the leaves into pieces and transfer them to a 2 mL centrifuge tube. Fill the tube to about 1 / 4 of its height. Add a steel ball to the tube. Cover the tube and freeze it in liquid nitrogen for about 1-2 min. Quickly fix it on a sampler for grinding.

[0058] (2) Add 600 μL of 1.5X CTAB extraction buffer to the centrifuge tube, shake well, and incubate at 65°C for 20-30 min, inverting and mixing every 5-10 min;

[0059] (3) Add an equal volume (600 μL) of chloroform / isoamyl alcohol mixture (24:1), mix by inverting for 10 min. This step should be performed in a fume hood and should be performed with caution.

[0060] (4) Centrifuge at 12,000 rpm for 10 min, and transfer the supernatant (400 μL) to a new 1.5 ml centrifuge tube. Be careful not to suck up solid residue or chloroform when aspirating the supernatant;

[0061] (5) Add 2 volumes of (pre-cooled) anhydrous ethanol or an equal volume of isopropanol, shake well, and place at -20°C for 20 min.

[0062] (6) Centrifuge at 12,000 rpm for 10 min and discard the supernatant. Add 1 mL of 75% ethanol to suspend the precipitate, centrifuge at 12,000 rpm for 5 min, discard the ethanol, blow dry the precipitate on a clean bench or air dry it naturally, add 100 μL of ddH2O to dissolve it, and store it at -20°C for later use. Take 2 μL of DNA and use 1% (w / v) agarose gel electrophoresis to check the DNA quality. Take 3 μL of DNA for PCR amplification detection.

[0063] PCR reaction system

[0064] Components Volume (μL) DNA 3 Primer (F+R) 5 2*KOD-buffer 25 KOD-Fx 1 <![CDATA[ddH2O]]> To 50

[0065] PCR procedure

[0066]

[0067] DNA was extracted from leaves of the T0 transgenic plants, and the positive transgenic plants were determined using hygromycin gene primers hyg-F and hyg-R. Sequencing primers ZFP8-CX1-F and ZFP8-CX1-R, ZFP8-CX2-F and ZFP8-CX2-R were used to amplify the two target sites of the positive transgenic plants, and the sequences near the OsZFP8 gene target site were analyzed by sequencing ( Figure 3-4 The sequencing results of some edited plants are shown in Figure 2). The primer sequences for amplifying sequences near the target site are:

[0068] ZFP8-CX1-F(SEQ ID NO.7):TAAGGGAAGAGGTGGGAGT

[0069] ZFP8-CX1-R(SEQ ID NO.8):GTGGGAGGGGTCGTGGTGG

[0070] ZFP8-CX2-F(SEQ ID NO.9):TTCATCGAGCACCAGGAC

[0071] ZFP8-CX2-R(SEQ ID NO.10):GGCGAAGAAGAAGCGTAG

[0072] Example 6. Phenotypic identification of the gene-edited mutant OsZFP8

[0073] According to the sequencing comparison results, the obtained gene editing materials were classified, and the two homozygous mutants were named oszfp8-1 and oszfp8-2. The gDNA sequences of the two mutant materials are shown in SEQ ID NO.14 and SEQ ID NO.15, and their CDS sequences are shown in SEQ ID NO.16 and SEQ ID NO.17. The phenotypes of the mutants were carefully observed, and it was found that the endosperms of the mutants showed a significant increase in the rate of chalky grains and a significant decrease in grain weight ( Figure 5-6 ). Using scanning electron microscopy to observe the natural cross-sections of mature seeds of wild-type ZH11, oszfp8-1 and oszfp8-2 mutants, it was found that the starch granules in the opaque part of the endosperm abdomen of oszfp8-1 and oszfp8-2 mutant seeds became round and loosely arranged, while the starch granules in the transparent part showed an irregular polyhedral structure and were closely arranged; the starch granules in the endosperm of wild-type ZH11 all showed a dense polygonal structure ( Figure 5 The above results indicate that the gene OsZFP8 can control the chalky grain rate and 1000-grain weight of rice, and can be used for breeding high-quality, high-yield and stable-yield rice.

[0074] The above description is only for the best embodiment of the present invention, but it should not be understood as limiting the claims. The present invention is not limited to the above embodiments, and its specific structure is allowed to be changed. All changes made within the scope of protection of the independent claims of the present invention are within the scope of protection of the present invention.

Claims

1. An application of a mutant gene of a rice C2H2 zinc finger transcription factor in increasing the rate of chalky grains in rice endosperm, characterized in that: The sequence characteristics of the mutant gene are: 1) The nucleotide sequences of the gene editing are shown in the sequence listing SEQ ID NO.14 and SEQ ID NO.15, and the CDS sequences are shown in the sequence listing SEQ ID NO.16 and SEQ ID NO.17; 2) The amino acid sequence of the protein encoded by the mutant gene is shown in the sequence listing SEQ ID NO.18 and SEQ ID NO.19.

Images