A molecular marker linked to the sex QTL of kiwifruit and its application

Abstract

The present invention discloses a molecular marker linked to the kiwifruit sex QTL and its application, which relates to the technical fields of molecular biology and genetic breeding. The nucleotide sequence of the molecular marker is as shown in SEQ ID NO.1; there is a SNP locus at 287 bp of the molecular marker, which is T or C. The present invention locates the QTL linked to the kiwifruit sex in kiwifruit and provides a molecular marker tightly linked to the kiwifruit sex QTL. In the conventional breeding method, it is very difficult to judge the growth traits of kiwifruit trees at the seedling stage, and the accuracy and breeding efficiency are relatively low. By detecting the above-mentioned molecular marker linked to the kiwifruit sex QTL, the sex traits of kiwifruit plants can be predicted, and then early screening can be carried out, which not only saves production costs but also greatly improves the selection efficiency.

Description

Technical Field

[0001] The present invention relates to the technical fields of molecular biology and genetic breeding, and particularly relates to a molecular marker linked to the sex QTL of kiwifruit and its application. Background Art

[0002] Molecular marker technology is based on nucleotide sequence variations among individuals and is a direct reflection of genetic variations in organisms. It can detect differences in nucleotide sequences among biological individuals. Compared with traditional morphological markers and cytological markers, it has many advantages: it is not affected by factors such as climate and environment, can be detected in various tissues, organs, and developmental stages of plants, and has high polymorphism. Currently, this technology is widely used in genetic diversity analysis, germplasm resource identification, genetic map construction, phylogenetic research, and molecular marker-assisted breeding, etc.

[0003] Kiwifruit is rich in nutrients such as vitamin C, protein, sugar, and minerals such as calcium, phosphorus, and iron, and is deeply loved by consumers. Kiwifruit (Actinidia) is a dioecious perennial vine plant of the genus Actinidia in the family Actinidiaceae, and is one of the four most successful wild fruit trees domesticated and cultivated in the 20th century. Kiwifruit is a unisexual flower plant species where female and male flowers are located on different plants, that is, female plants only produce female flowers and male plants only produce male flowers. In actual production, the economic value of female plants is greater than that of male plants, but it is difficult to distinguish the sex morphologically before flowering. Using molecular marker technology for early sex identification in the juvenile stage can effectively improve the breeding efficiency. Summary of the Invention

[0004] The purpose of the present invention is to provide a molecular marker linked to the sex QTL of kiwifruit and its application to solve the problems existing in the above-mentioned prior art. The molecular marker provided by the present invention is tightly linked to the sex QTL of kiwifruit and can be used to predict the sex traits of kiwifruit plants.

[0005] To achieve the above purpose, the present invention provides the following solutions:

[0006] The present invention provides a molecular marker linked to the sex QTL of kiwifruit, and the nucleotide sequence of the molecular marker is as shown in SEQ ID NO.1; there is a SNP site at 287bp of the molecular marker, which is T or C.

[0007] Further, the genotype of the SNP site is TT or TC.

[0008] Further, when the genotype of the SNP site is TT, the kiwifruit plant is a female plant; when the genotype of the SNP site is TC, the kiwifruit plant is a male plant.

[0009] The present invention also provides a method for identifying the gender of kiwifruit plants using the above-mentioned molecular markers, comprising the following steps:

[0010] (1) Obtain the genomic DNA of the kiwifruit plant to be identified;

[0011] (2) Use the primer pair shown in SEQ ID NO. 2-3 to perform PCR amplification on the genomic DNA to obtain an amplification product, and then sequence to obtain the genotype of 287 bp of the amplification product. When the genotype is TT, the kiwifruit plant is a female plant; when the genotype is TC, the kiwifruit plant is a male plant.

[0012] Further, in step (1), the reaction system for the PCR amplification comprises: 2×Hieff Plus PCR Master Mix (With Dye) 25 μL, 2 μL of each of the forward and reverse primers, 3 μL of the genomic DNA template, and ddH2O is added to make up to 50 μL.

[0013] Further, in step (1), the reaction program for the PCR amplification is: 98°C for 3 min; 98°C for 10 sec, 56°C for 20 sec, 72°C for 30 sec; 72°C for 5 min.

[0014] The present invention also provides a kit for identifying the gender of kiwifruit plants, comprising the primer pair shown in SEQ ID NO. 2-3.

[0015] The present invention also provides the application of the above-mentioned molecular marker or kit in kiwifruit breeding.

[0016] Further, the application is to identify the gender of kiwifruit plants.

[0017] The present invention discloses the following technical effects:

[0018] The present invention has mapped QTLs linked to the gender of kiwifruit. In conventional breeding methods, it is difficult to judge the growth traits of kiwifruit trees at the seedling stage, and the accuracy and breeding efficiency are relatively low. By detecting molecular markers linked to the traits, not only the production cost is saved but also the selection efficiency is greatly improved. In the present invention, the position of the QTL locus for kiwifruit gender is clear, and the detection method of the molecular marker locus is convenient and fast, and is not affected by climate, environment, etc. By detecting the molecular marker linked to the trait, the gender trait of the kiwifruit plant can be predicted, and early screening can be carried out. Description of the Drawings

[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on these drawings.

[0020] Figure 1 It is a genetic map of Actinidia chinensis hybrid population. Detailed implementation manners

[0021] Now, various exemplary implementation manners of the present invention will be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0022] It should be understood that the terms described in the present invention are only for describing specific implementation manners and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

[0023] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0024] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific implementation manners of the present invention specification, which are obvious to those skilled in the art. Other implementation manners obtained from the present invention specification are also obvious to those skilled in the art. The present invention specification and embodiments are only exemplary.

[0025] Regarding the terms "comprising", "including", "having", "containing", etc. used herein, they are all open-ended terms, meaning including but not limited to.

[0026] Embodiment 1

[0027] I. Method

[0028] 1. Using Actinidia chinensis 'Hongyang' as the female parent and the compatible male plant 'Boshan Jasper' as the male parent, the F1 generation was obtained through hybridization, and 173 individual plants were selected as the research objects from it.

[0029] 2. Fresh young leaves of 173 individual plants in the hybrid population and the hybrid parents were taken. After being quickly frozen in liquid nitrogen, genomic DNA was extracted using the SDS method, and the DNA quality was detected.

[0030] 3. The qualified genomic DNA was randomly fragmented by enzymes, then end-repaired, A-tailed added, and Illumina sequencing adapters were added. PCR amplification enrichment and product purification were carried out on the DNA fragments to construct sequencing libraries for the diploid Actinidia chinensis 'Hongyang', the compatible male plant 'Boshan Jasper' of Actinidia chinensis, and 173 offspring individual plants. The sequencing libraries were detected, and real-time PCR was used for library quantification. Finally, sequencing was carried out on the Novaseq6000 sequencer using the PE150 sequencing strategy.

[0031] 4. The raw data on the Illumina platform was filtered using FASTP (version 0.18.0), and the filtering criteria were as follows: (1) reads containing ≥10% unknown nucleotides (N) were removed; (2) reads with ≥50% bases with phred quality score ≤20 were removed; (3) reads containing sequencing adapters were deleted. The filtered reads were aligned to the reference genome using the mem algorithm of the alignment software BWA (version 0.7.12), and the alignment parameter was -k32 -M; after alignment, the results were marked using the software picard (version 1.129), and the population SNP detection was carried out using the variant detection software GATK. The distribution of the SNP detection results on the genome is shown in Table 1.

[0032] Table 1 Distribution of SNP detection results on the genome

[0033]

[0034] 5. According to the SNP information obtained from the above analysis, the treebest software was used to construct a phylogenetic tree using the neighbor-joining methods. The plink and GCAT64 software were used for principal component analysis, and the admixture software was used to analyze the population structure to complete the population analysis of the mapping population.

[0035] 6. After preliminary quality filtering and variant detection, a VCF file containing variant information is obtained, and it is further filtered according to the following criteria: (1) Use the bcftools software to filter SNP markers; (2) Use Plink software to remove markers with a genotype missing rate greater than 0.02, remove samples with a sample missing rate greater than 0.03, and remove markers with a minor allele frequency less than 0.05; (3) Use the R program to retain markers with parental genotypes of "0 / 0×0 / 1", "0 / 1×0 / 0", "0 / 1×0 / 1", "0 / 1×1 / 1", "1 / 1×0 / 1", and remove markers that do not segregate in the offspring; (4) Perform a chi-square test to remove markers with severe segregation distortion. The summary of SNP filtering results is shown in Table 2.

[0036] Table 2 Summary of SNP filtering results

[0037]

[0038] 7. Use the Lep-MAP3 software to construct a genetic map, and the results are shown in Figure 1 . Each linkage group is repeated 5 times, and the one with the highest likelihood value is selected as the final result. Obtain the genetic positions between markers and the LOD value matrix of markers to each genetic position, and construct a high-density genetic linkage map of the diploid Actinidia chinensis hybrid population.

[0039] 8. Measure and evaluate 173 hybrid offspring individual plants, and identify the sex by the male and female organs of the flowers.

[0040] 9. QTL mapping is performed using R / qtl, using the cim() function of the composite interval mapping method, with a scanning step of 1 cM and a LOD threshold set to 3. Finally, a QTL locus related to sex is detected.

[0041] 10. Molecular marker detection steps:

[0042] (1) Take fresh young leaves of 173 individual plants in the hybrid population and the hybrid parents. After quick-freezing in liquid nitrogen, extract genomic DNA using the SDS method and detect the DNA quality.

[0043] (2) According to the instructions of the 2×Hieff PlusPCRMasterMix (WithDye) kit, design a 50 μL reaction system: 2×Hieff PlusPCRMasterMix (WithDye) 25 μL, 2 μL each of forward and reverse primers, 3 μL of Actinidia genomic DNA template, and make up to 50 μL with ddH2O.

[0044] (3) The PCR amplification program is shown in Table 3.

[0045] Table 3

[0046]

[0047] After the PCR amplification program is completed, store at 4°C.

[0048] (4) Perform Sanger sequencing on the PCR products to detect the marker sites, and predict the sex of kiwifruit based on the base types at the molecular markers, so as to achieve the purpose of efficient breeding.

[0049] II. Results

[0050] 1. The molecular marker information related to the sex traits of kiwifruit is shown in Table 4.

[0051] Table 4 Molecular marker information related to the sex traits of kiwifruit

[0052]

[0053] Amplified product (SEQ ID NO.1):

[0054] ACTTTCTTGCTGAACACCACCATAACAAAGTTTCATTGGAACAACATCCTATAATATTCCAAGTATGCACTGCGGGATCTAGAACTGCTATTCTGAAGCAGAAGCACTACGTATTTTAGAAGACTACTCCCTACATTAAAGAGGCCAAAGGTTAAAATGTCACCATAATTAAACAAATATTTCCCTTGCAGGCACAAGTGTATTTTATTCACAGGACTCCTATTACAATTCTTGAATTCCATAGTACAATTTATATCTAGCACCAACCATAAGCCATAGATAAAAG T TCTAACATGCGAGATATTCCAATTGAAGAAAATGAGGCAACCTTAAACATTAAATAAGTTAACCTTAAACATTAGGTAAGCACAATCAGCAGTTTTCCTTTTTTTCGTGCTATATGCAACTAGAGTTTTTTTCCTGAACTTCAAACACAAAAATGAATAAGATGACCACATCCCACGATGCTTCTCATTCT; The underlined part is T or C.

[0055] Table 5 Correlation analysis between molecular markers and sex traits of kiwifruit

[0056]

[0057] As shown in Table 5 and Table 6, for the 20,402,182nd base of the kiwifruit Group 14 chromosome, i.e., 287 bp of SEQ ID NO.1, the genotype of the female plant at this locus is TT, and the genotype of the male plant at this locus is TC.

[0058] Table 6 Sex identification results of single plant samples

[0059]

[0060]

[0061]

[0062]

[0063] Note: There are 173 single plants, among which 124 have flowered during the detection and their genders can be identified; the remaining 49 single plants have not flowered yet, and their genders are temporarily undetermined; AC_female represents the female parent, and AC_male represents the male parent.

[0064] The above-described embodiments are only descriptions of the preferred embodiments of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. A method for identifying the gender of kiwifruit plants using molecular markers, characterized in that, Including the following steps: (1) Obtain the genomic DNA of the kiwifruit plant to be identified; (2) Use the primer pair shown in SEQ ID NO. 2-3 to perform PCR amplification on the genomic DNA to obtain an amplification product, and then sequence to obtain the genotype of the base at 287 bp of the amplification product. When the genotype is TT, the kiwifruit plant is a female plant; when the genotype is TC, the kiwifruit plant is a male plant; The kiwifruit plant is the variety described in (a), (b), or (c); (a) Actinidia chinensis cv. Hongyang; (b) Actinidia chinensis cv. Boshan Biyu; (c) The F1 generation obtained by crossing Actinidia chinensis cv. Hongyang as the female parent and Actinidia chinensis cv. Boshan Biyu as the male parent.

2. The method according to claim 1, wherein In step (1), the reaction system for PCR amplification includes: 2×Hieff Plus PCR Master Mix (With Dye) 25 μL, 2 μL each of forward and reverse primers, 3 μL of genomic DNA template, and ddH2O is added to make up to 50 μL.

3. The method according to claim 1, characterized in that, In step (1), the reaction program of the PCR amplification is: 98°C for 3 min; 98°C for 10 sec, 56°C for 20 sec, 72°C for 30 sec; 72°C for 5 min.

4. A kit for identifying the gender of kiwifruit plants, characterized in that, Containing the primer pair shown in SEQ ID NO. 2-3; The kiwifruit plant is the variety described in (a), (b), or (c); (a) Actinidia chinensis cv. Hongyang; (b) Actinidia chinensis cv. Boshan Biyu; (c) The F1 generation obtained by crossing Actinidia chinensis cv. Hongyang as the female parent and Actinidia chinensis cv. Boshan Biyu as the male parent.

5. Use of a molecular marker or the kit according to claim 4 in identifying the gender of a kiwifruit plant, characterized in that The nucleotide sequence of the molecular marker is as shown in SEQ ID NO. 1; there is a SNP site at 287 bp of the molecular marker, which is T or C; when the genotype of the SNP site is TT, the kiwifruit plant is a female plant; when the genotype of the SNP site is TC, the kiwifruit plant is a male plant; The kiwifruit plant is the variety described in (a), (b), or (c); (a) Actinidia chinensis cv. Hongyang; (b) Actinidia chinensis cv. Boshan Biyu; (c) The F1 generation obtained by crossing Actinidia chinensis cv. Hongyang as the female parent and Actinidia chinensis cv. Boshan Biyu as the male parent.

Images