An optical fiber probe, LSPR sensor device, and preparation method for detecting Helicobacter pylori

Abstract

This invention discloses an optical fiber probe, an LSPR sensor device, and a preparation method for detecting Helicobacter pylori, relating to the field of optical fiber sensor technology. The optical fiber probe includes interconnected sensing and non-sensing regions, with the sensing region referring to the fiber core. The surface of the fiber core in the sensing region is modified with nanomaterials, which are modified with nucleic acid aptamers as shown in SEQ ID NO.1 and spacer nucleic acids as shown in SEQ ID NO.2. The nanomaterials are selected from gold nanoparticles, silver nanoparticles, or core-shell structured gold / silver nanospheres. The fiber core in the sensing region includes a straight section and a bent section, with the bent section being J-shaped. Compared to existing U-shaped or Ω-shaped optical fiber probes, the J-shaped optical fiber probe has higher refractive sensitivity. By truncating and optimizing the nucleic acid aptamers for detecting Helicobacter pylori, the specificity and affinity of Helicobacter pylori detection can be improved.

Description

Technical Field

[0001] This invention relates to the field of fiber optic sensor technology, and more specifically, to a fiber optic probe, an LSPR sensor device, and a method for preparing it for detecting Helicobacter pylori. Background Technology

[0002] Helicobacter pylori (Hp) is a spiral-shaped, Gram-negative bacterium with very demanding growth requirements. It grows slowly, is microaerophilic, and colonies take more than 3 days to appear. Hp obligately parasitizes the human gastric mucosa, and its infection is very common in the population. It is known to be a pathogenic factor in some cases of chronic gastritis, duodenal and gastric ulcers, gastric cancer, and gastric mucosa-associated lymphoid tissue (MALT) lymphoma. There are two main routes of Hp infection: direct human-to-human transmission, including fecal-oral and oral-oral routes; and environmental infection, with the consumption of contaminated food and water increasing the risk of infection. Hp can survive in various water bodies; it can be detected in seawater, river water, surface water, and sewage, making waterborne transmission a significant route of infection. Currently, most Hp sensors detect its DNA, requiring nucleic acid extraction, which is a relatively cumbersome process. The fiber optic LSPR sensor based on nucleic acid aptamers enables rapid detection of Helicobacter pylori without the need for nucleic acid extraction.

[0003] Fiber-optic localized surface plasmon resonance (LSPR) technology is a novel technique that combines optical fiber with localized surface plasmon resonance (LSPR). It features label-free operation, small size, simple structure, easy integration, strong resistance to electromagnetic interference, and the ability for long-distance real-time detection. In recent years, fiber-optic LSPR biosensors have attracted widespread attention and have been applied in fields such as biomedicine, drug screening, food safety, and environmental monitoring. However, the low sensitivity of traditional bare fiber LSPR sensors has limited their further application.

[0004] The geometry of the fiber optic probe has a significant impact on the sensitivity of LSPR sensors. In recent years, improving the performance of LSPR sensors by changing the fiber configuration has become a research hotspot for scientists both domestically and internationally. From the initial straight shape to the U-shape, and then to the Ω-shape, the refractive sensitivity of the fiber optic probes has been significantly improved.

[0005] In view of this, the present invention is proposed. Summary of the Invention

[0006] The purpose of this invention is to provide an optical fiber probe, an LSPR sensor device, and a preparation method for detecting Helicobacter pylori to solve the above-mentioned technical problems.

[0007] This invention is implemented as follows:

[0008] This invention provides an optical fiber probe for detecting Helicobacter pylori.

[0009] It includes interconnected sensing and non-sensing regions. The sensing region refers to the fiber core of the optical fiber, and the sensing region does not contain any coating or cladding layer external to the surface of the fiber core. The surface of the fiber core of the sensing region is modified with nanomaterials, and the nanomaterials are modified with nucleic acid aptamers as shown in SEQ ID NO.1 and spacer nucleic acids as shown in SEQ ID NO.2.

[0010] The nanomaterials are selected from gold nanoparticles, silver nanoparticles, or core-shell structured gold / silver nanospheres. The core of the sensing region includes straight sections and bent sections, with the bent sections having a J-shape.

[0011] The base sequence of the nucleic acid aptamer is shown in SEQ ID NO.1:

[0012] AGGTTACCAGGAGGACCCTATTCTCGTGTATCGACGAGATCCAGTGA.

[0013] The base sequence of the spacer nucleic acid is shown in SEQ ID NO.2: CCGGCCGGCCGG. The spacer nucleic acid has a short stem-loop structure, which can adjust the aptamer density and effectively prevent the nucleic acid aptamer from collapsing, thus facilitating the binding of aptamers to Helicobacter pylori and improving detection sensitivity.

[0014] The inventors have provided a novel J-shaped fiber optic probe, which exhibits higher refractive sensitivity compared to existing U-shaped or Ω-shaped fiber optic probes. By truncating and optimizing the nucleic acid aptamer for detecting Helicobacter pylori, the specificity and affinity of Helicobacter pylori detection are improved. Combining the J-shaped fiber optic probe with the nucleic acid aptamer results in a fiber optic probe that is label-free, highly sensitive, highly specific, and allows for rapid detection.

[0015] By truncating and optimizing the nucleic acid aptamers for detecting Helicobacter pylori, the affinity of the aptamers for Helicobacter pylori can be improved, and the occurrence of aptamer entanglement can be reduced, thereby helping to improve the sensitivity and specificity of Helicobacter pylori detection. Therefore, the nucleic acid aptamers provided by the inventors can significantly improve the sensitivity, specificity, affinity, and convenience of detection.

[0016] In addition, the preparation cost of the truncated and optimized nucleic acid aptamers is lower.

[0017] In a preferred embodiment of the present invention, the core surface of the sensing area is modified with gold nanoparticles, the particle size of which is between 13-60 nm, with an optimal size of 40 nm.

[0018] In a preferred embodiment of the present invention, both the nucleic acid aptamer and the spacer nucleic acid are linked to the nanomaterial via poly A. Compared to thiol-modified aptamers, poly A-modified aptamers are less expensive and do not require activation with TCEP reagents, greatly simplifying the preparation process.

[0019] In a preferred embodiment of the present invention, the J-shape is obtained by bending and folding an Ω-shaped fiber core. For example, the Ω-shaped fiber core is further bent and folded in half with tweezers in a flame to obtain a J-shaped fiber core. The J-shape includes, but is not limited to, those that are approximately J-shaped in shape.

[0020] In a preferred embodiment of the present invention, the non-sensing region refers to an optical fiber on which a coating layer and a cladding layer are sequentially disposed on the surface of the fiber core. The length of the fiber core in the sensing region is 2-5 cm, preferably 3 cm. The optical fiber is a multimode optical fiber with a fiber core diameter of 125-1000 μm, preferably 600 μm. The length of the optical fiber probe is 5-40 cm.

[0021] For example, the length of the fiber core in the sensing area is 3-5cm, the core diameter is 125-800μm, and the length of the fiber probe is 25-40cm.

[0022] This invention also provides a method for preparing an optical fiber probe, which includes the following steps:

[0023] The fiber with its cladding and coating removed is bent into an Ω shape over a flame, and then bent and folded again to form a J-shaped sensing area.

[0024] The sensing region of an optical fiber is modified with gold nanoparticles, silver nanoparticles, or core-shell structured gold / silver nanospheres. The sensing region of the optical fiber is then immersed in a mixed buffer solution of annealed nucleic acid aptamers and spacer nucleic acids for incubation.

[0025] In a preferred embodiment of the present invention, modifying the sensing area surface of the optical fiber with gold nanoparticles includes: immersing the sensing area of ​​the optical fiber in a gold nanoparticle solution for 2-3 minutes.

[0026] Within the aforementioned modification time, a relatively good modification effect can be obtained, resulting in uniform distribution of gold nanoparticles in the sensing area of ​​the optical fiber. Through modification, the gold nanoparticles are fixed to the surface of the optical fiber by the electrostatic attraction between positive and negative ions.

[0027] In one alternative embodiment, the modification in the gold nanoparticle solution further includes a drying step. Drying is used to make the gold nanoparticles bind more tightly.

[0028] In one alternative embodiment, after drying, the sensing region of the optical fiber is further immersed in a succinic anhydride solution for a sealing reaction, followed by drying. To reduce non-specific adsorption, the inventors immersed the optical fiber in a succinic anhydride solution to seal unbound amino groups.

[0029] In one optional embodiment, the concentration of the succinic anhydride solution is 8-12 mM, preferably 10 mM. Within this concentration range, a good blocking effect can be achieved. In another optional embodiment, the blocking time is 6-18 hours, for example, overnight.

[0030] In a preferred embodiment of the present invention, the annealing process includes: heating the nucleic acid aptamer and the spacer nucleic acid at 95°C-100°C for 1-5 minutes, then cooling them to room temperature and mixing them.

[0031] Annealing nucleic acid aptamers can induce them to form specific spatial structures, which can be used to specifically capture target analytes.

[0032] In a preferred embodiment of the present invention, the mixture of annealed nucleic acid aptamers and spacer nucleic acids is diluted with sodium chloride solution to obtain a nucleic acid aptamer mixed solution, until the sodium chloride concentration of the nucleic acid aptamer mixed solution is 400-500 mM and the final nucleic acid concentration (total nucleic acid concentration) in the nucleic acid aptamer mixed solution is 1-1.2 μM.

[0033] In one alternative embodiment, an optical fiber with a surface modified with gold nanoparticles is inserted into an aptamer solution and incubated overnight in a metal bath at 35-37°C. Then, cleaning is performed to remove any nucleic acid aptamers not bound to the optical fiber.

[0034] The present invention also provides an optical fiber LSPR sensor device, which includes: a light source, an optical fiber probe, a high-resolution spectrometer, an optical fiber patch cord, and a computer.

[0035] A beam of light of continuous wavelength emitted from the light source propagates along the fiber optic jumper to the fiber optic probe. The light undergoes localized surface plasmon resonance at the probe, which is covered with spherical gold nanoparticles. The wavelength and intensity of the resonance absorption peak change. After the optical signal is processed by a spectrometer, spectral data analysis is performed on the computer.

[0036] When using the aforementioned sensor for detection, first connect the aptamer-modified fiber optic probe to the instrument interface. After turning on the instrument, immerse the bent section (J-shaped fiber core) of the fiber optic probe in a buffer solution for equilibration. Once the absorbance stabilizes, place the bent section in different concentrations of Helicobacter pylori buffer solutions and monitor in real time for half an hour to create a standard curve. Then, when detecting the concentration of Helicobacter pylori in the sample, immerse the bent section of the fiber optic probe in the sample and calculate the concentration of Helicobacter pylori based on the absorbance at the LSPR absorption peak.

[0037] The LSPR biosensor based on J-shaped fiber optic probes and nucleic acid aptamers helps to achieve label-free, highly sensitive, and highly specific rapid detection of Helicobacter pylori in samples. The sensor device provided by this invention is of great significance for protecting public health.

[0038] The present invention has the following beneficial effects:

[0039] (1) The present invention provides a new J-shaped fiber optic probe, which has higher refractive sensitivity than existing U-shaped or Ω-shaped fiber optic probes.

[0040] (2) By truncating and optimizing the nucleic acid aptamers for detecting Helicobacter pylori, it is helpful to improve the specificity and affinity of Helicobacter pylori detection.

[0041] By truncating and optimizing the nucleic acid aptamers for detecting Helicobacter pylori, the affinity of the aptamers for capturing Helicobacter pylori can be improved, and the occurrence of aptamer entanglement can be reduced, thereby helping to improve the detection sensitivity and specificity of Helicobacter pylori. Therefore, the nucleic acid aptamers provided by the inventors can significantly improve the detection sensitivity, specificity, affinity, and convenience. In addition, the truncated and optimized nucleic acid aptamers also help to reduce preparation costs.

[0042] (3) Combining J-shaped fiber probes with nucleic acid aptamers gives the fiber probes the characteristics of being label-free, highly sensitive, highly specific and fast in detection.

[0043] (4) Compared with the prior art, when the optical fiber probe provided by the present invention detects the sample, no additional pretreatment steps are required for the sample, and it can be directly detected and analyzed.

[0044] (5) The J-shaped fiber optic sensor device of the present invention is small in size and easy to integrate. The detection process can be carried out at room temperature without the need for additional instruments, which can meet the needs of on-site detection of Helicobacter pylori.

[0045] (6) The detection principle adopted in this invention is the specific binding of nucleic acid aptamers connected to the optical fiber to the analyte, which has high specificity and affinity for the analyte. At the same time, the sample does not need to be labeled, reducing damage and contamination to the sample.

[0046] (7) The fiber optic probe provided by the present invention can also monitor the sample reaction process in real time and can truly reflect the interaction process between Helicobacter pylori cells and nucleic acid aptamers. Attached Figure Description

[0047] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0048] Figure 1 This is a physical image of a J-shaped fiber optic probe.

[0049] Figure 2 The graph shows the statistical results of absorbance measured in sucrose solutions of various concentrations for U-shaped, Ω-shaped, and J-shaped optical fibers.

[0050] Figure 3 This is a schematic diagram of the secondary structure of the Helicobacter pylori nucleic acid aptamer;

[0051] Figure 4 The LSPR signal (increase in absorbance) of Helicobacter pylori was detected using five aptamers. n=3;

[0052] Figure 5 This figure shows time-lapse monitoring (TLC) spectra of different concentrations of Helicobacter pylori detected by a J-shaped fiber optic LSPR sensor. All data in the figure are from the absorbance of the fiber at 530 nm. Curve a represents the blank control, i.e., the change in absorbance of the fiber in the buffer solution; curves b and h represent the absorbance changes of the fiber at 1.0 × 10⁻⁶ nm, respectively. 2 cfu / mL, 1.0×10 3 cfu / mL, 1.0×10 4 cfu / mL, 1.0×10 5 cfu / mL, 1.0×10 6 cfu / mL, 1.0×10 7 cfu / mL and 1.0×10 8 Changes in absorbance over time in a CFU / mL Helicobacter pylori solution;

[0053] Figure 6 The fitted curves for Helicobacter pylori and LSPR signals are shown. n=3;

[0054] Figure 7 Method specificity evaluation results. AF represents Escherichia coli, Staphylococcus aureus, Salmonella, Pseudomonas aeruginosa, Listeria monocytogenes, and Helicobacter pylori, respectively. Detailed Implementation

[0055] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.

[0056] The features and performance of the present invention will be further described in detail below with reference to embodiments.

[0057] Example 1

[0058] This embodiment provides an optical fiber probe for detecting Helicobacter pylori and its preparation method.

[0059] Specifically, the fabrication method of the fiber optic probe is as follows:

[0060] (1) Cut the optical fiber into several 25cm long segments. Burn off approximately 3cm of the outer sheath (as the sensing area) under the outer flame of a butane torch. Bend the exposed quartz core into an Ω-shaped core (i.e., the probe) in the outer flame. Then, further bend and fold the core with tweezers to obtain a J-shaped core (the bent section). Figure 1 As shown. Next, about half a centimeter of the outer sheath at both ends of the optical fiber is burned off, and then polished with diamond sandpaper to make the ends neat and smooth, so that the ends of the optical fiber can be tightly installed into the instrument later.

[0061] (2) Before functionalizing the optical fiber, all glassware and the portion of the optical fiber with the outer sheath removed were immersed in aqua regia for about 10 minutes, rinsed with ultrapure water and dried, and then modified according to the following steps:

[0062] Prepare a piranha solution (30% hydrogen peroxide: concentrated sulfuric acid, volume ratio = 3:7), immerse the J-shaped fiber core in it, react in a 90℃ oven for 30 min to hydroxylate the probe surface, then wash with ultrapure water, sonicate for 5 min, and dry at 70℃ for 10 min; prepare a 1% (V / V) 3-APTMS solution (ethanol and acetic acid mixed in a 5:2 volume ratio, then add 1% 3-APTMS), immerse the hydroxylated J-shaped fiber core in it, react for 15 min to connect amino groups; transfer the optical fiber to ethanol, sonicate for 15 min, then transfer to ultrapure water and sonicate for 5 min, and dry in an oven.

[0063] The J-shaped fiber core was immersed in a synthetic gold nanoparticle solution (gold nanoparticle size 13-60 nm) for 2 minutes to modify it, allowing the gold nanoparticles to be fixed to the fiber surface by electrostatic attraction between positive and negative ions. After rinsing with ultrapure water, it was dried in a 90℃ oven for 30 minutes to make the gold nanoparticles more tightly bound. To reduce non-specific adsorption, the fiber was immersed in a 10 mM succinic anhydride solution overnight to block unbound amino groups, then washed and dried.

[0064] (3) Modify the nucleic acid aptamers.

[0065] Aptamers that can specifically bind to Helicobacter pylori are immobilized on gold nanoparticles on the surface of optical fibers to capture the DNA to be tested.

[0066] This embodiment uses a polyA-modified aptamer, which is less expensive than a thiol-modified aptamer and does not require activation with TCEP reagent.

[0067] The experimental steps are as follows: First, the aptamer was annealed to form a specific spatial structure, thereby achieving specific capture of the target. The molar ratio of the nucleic acid aptamer and the spacer nucleic acid was 1:2. The sequences of the nucleic acid aptamer (A5) and the spacer nucleic acid are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively. For the nucleic acid aptamer shown in SEQ ID NO.1, a portion of primers was removed from both ends of the Apt1 aptamer shown in Comparative Example 4, retaining the portion (47bp) that can form a secondary structure with the intermediate fragment. The aptamer was diluted to 2 μM with binding buffer, heated at 95 °C for 5 min, and then slowly cooled to room temperature. An equal volume of 1 mol / L NaCl solution was added to make the final concentration of the aptamer solution 1 μM and the salt concentration 500 mM. The J-shaped fiber core modified with gold nanoparticles was immersed in the aptamer solution and incubated overnight in a metal bath at 37 °C. Afterward, the probe was washed with binding buffer and then immersed in the buffer for later use.

[0068] This embodiment also provides a fiber optic LSPR sensor device, which consists of a tungsten lamp light source, a J-shaped fiber optic probe, a high-resolution spectrometer, fiber optic patch cords, and a computer (analysis software). A beam of continuous wavelength light emitted from the light source propagates along the fiber optic patch cord to the fiber optic probe. The light undergoes localized surface plasmon resonance at the J-shaped probe covered with spherical gold nanoparticles, causing changes in both the wavelength and intensity of the resonance absorption peak. After processing by the spectrometer, the optical signal is analyzed as spectral data on the computer.

[0069] When using this sensor for detection, first connect the J-shaped optical fiber modified with the aptamer to the instrument interface. After turning on the instrument, immerse the J-shaped fiber core in the binding buffer to equilibrate. Once the absorbance stabilizes, place the probe in different concentrations of Helicobacter pylori buffer solutions and monitor in real time for half an hour. Create a standard curve. Then, when detecting the concentration of Helicobacter pylori in the sample, immerse the bent section of the optical fiber probe in the sample and calculate the concentration of Helicobacter pylori based on the absorbance at the LSPR absorption peak.

[0070] Example 2

[0071] Compared with Example 1, the only difference is the surface modification of the fiber core; in this example, it is a nano-silver nucleic acid aptamer.

[0072] Example 3

[0073] Compared with Example 1, the only difference is the surface modification of the fiber core. This example uses a core-shell structured gold / silver nanosphere nucleic acid aptamer.

[0074] Comparative Example 1

[0075] The only difference between this comparative example and Example 1 is that in step (1), the optical fiber is bent into a U-shape and the probe is prepared using the U-shaped optical fiber. Then, about half a centimeter of the outer sheath at both ends of the optical fiber is burned off, and the ends are polished with diamond sandpaper to make the ports neat and smooth, so that the two ends of the optical fiber can be tightly installed into the instrument later. The remaining steps are the same.

[0076] Comparative Example 2

[0077] The only difference between this comparative example and Example 1 is that in step (1), the optical fiber is bent into an Ω shape and the probe is prepared using the Ω-shaped optical fiber. Then, about half a centimeter of the outer sheath at both ends of the optical fiber is burned off, and the ends are polished with diamond sandpaper to make the ports neat and smooth, so that the two ends of the optical fiber can be tightly installed into the instrument later. The remaining steps are the same.

[0078] Comparative Example 3

[0079] The only difference between this comparative example and Example 1 is that the nucleic acid aptamer is modified with a thiol group; the other steps are the same.

[0080] The aptamer is a key component in the sensor constructed in this experiment. Shortening the aptamer length eliminates unnecessary sequences, which not only improves affinity and detection sensitivity and reduces synthesis costs, but also effectively prevents the binding site from being obscured by entanglement on the solid surface due to excessively long sequences. The secondary structure of the Helicobacter pylori nucleic acid aptamer is referenced. Figure 3 As shown in the comparative examples 4-7 below, four different aptamer sequences were extracted for comparison and screening. The specific sequence in the middle must be retained; the four sequences differ only in the extraction of the primers at the beginning and end.

[0081] Comparative Example 4

[0082] The only difference between this comparative example and Example 1 is the sequence of the nucleic acid aptamer. This is the truncated nucleic acid aptamer. Wu's team reported in 2021 their screened Helicobacter pylori aptamer, totaling 80 bases, including 20bp pre- and post-primers and a 40bp specific sequence in the middle. That is, it contains the pre- and post-primers (pre- + middle + post-primer, 80bp). The sequence of the nucleic acid aptamer is as follows:

[0083] Apt1(A1):

[0084] AAGGAGCAGCGTGGAGGTTACCAGGAGGACCCTATTCTCGTGTATCGACGAGATCCAGTGACCACGACGACACACCCTAA.

[0085] Comparative Example 5

[0086] The only difference between this comparative example and Example 1 is the sequence of the nucleic acid aptamer; Apt2 has removed the back primer (front + middle, 60bp). The sequence of the nucleic acid aptamer is as follows:

[0087] Apt2 (A2):

[0088] AAGGAGCAGCGTGGAGGTTACCAGGAGGACCCTATTCTCGTGTATCGACGAGATCCAGTG.

[0089] Comparative Example 6

[0090] The only difference between this comparative example and Example 1 is the sequence of the nucleic acid aptamer; Apt3 has removed the front primer (middle + back, 60bp). The sequence of the nucleic acid aptamer is as follows:

[0091] Apt3 (A3):

[0092] CCAGGAGGACCCTATTCTCGTGTATCGACGAGATCCAGTGACCACGACGACACACCCTAA.

[0093] Comparative Example 7

[0094] The only difference between this comparative example and Example 1 is the sequence of the nucleic acid aptamer; Apt4 has removed the front and rear primers (40 bp). The sequence of the nucleic acid aptamer is as follows:

[0095] Apt4 (A4):

[0096] CCAGGAGGACCCTATTCTCGTGTATCGACGAGATCCAGTG.

[0097] The inventors compared the detection effects of the aptamer sequences in Example 1 and Comparative Examples 4-7 on Helicobacter pylori detection, and added a polyA10 segment to the 5' end of each aptamer. Following the steps of Example 1, after annealing, the aptamer was attached to the AuNP on the surface of an optical fiber, immersed in binding buffer, and after the absorbance stabilized, the probe was placed at a 1.0 × 10⁻⁶ ohmmeter. 5 The absorbance changes were monitored in a CFU / mL solution of Helicobacter pylori. The results are as follows: Figure 4 As shown, A1 signal is the highest, followed by A5, and the difference between the two is not significant. Taking all factors into consideration, the nucleic acid aptamer of Example 1 was selected as the aptamer for subsequent experiments.

[0098] Experimental Example 1

[0099] This experimental example demonstrates the sensitivity and specificity testing of the fiber optic probe from Example 1.

[0100] Sensitivity of J-fiber LSPR sensor

[0101] Under optimized conditions, this experiment further investigated the response of the J-shaped fiber optic LSPR sensor to a series of concentrations of Helicobacter pylori. For example... Figure 5 As shown, the maximum absorption of the resonance peak of the fiber optic LSPR sensor gradually increases with the increase of Helicobacter pylori concentration. A linear fitting correction was performed using the LSPR absorbance at 30 min against the logarithmic value of Helicobacter pylori concentration, and the results are as follows. Figure 6 As shown, the LSPR response value of the optical fiber is related to the concentration of Helicobacter pylori at 1.0 × 10⁻⁶. 2 cfu / mL to 1.0×10 8 The linearity was good within the range of cfu / mL, with a regression equation of y = 0.01646x - 0.02646, R² = 0.9887, and a detection limit of 45.23 cfu / mL. This demonstrated good sensitivity for direct detection of Helicobacter pylori without signal amplification.

[0102] Specificity of J-shaped fiber optic LSPR sensors

[0103] To investigate the specificity of the established sensor, in addition to detecting the target bacterium—Helicobacter pylori—Escherichia coli, Staphylococcus aureus, Salmonella, Pseudomonas aeruginosa, and Listeria monocytogenes were also tested. After the fiber optic probe was equilibrated in blank buffer until its absorbance stabilized, it was placed at 1.0 × 10⁻⁶. 5 In bacterial cultures with cfu / mL, changes in the LSPR resonance absorption peak were monitored in real time, such as... Figure 7 As shown, when the sensor constructed in this experiment detects the above-mentioned non-target bacteria, the change in absorbance value is much lower than that of Helicobacter pylori, indicating that this sensor has good specificity in the detection of Helicobacter pylori.

[0104] The absorbance of sucrose solutions of different concentrations in Examples 1 and Comparative Examples 1-2 was measured, referring to... Figure 2 As shown in the figure, the three curves a, b, and c represent the RIS curves of J-shaped, Ω-shaped, and U-shaped optical fibers, respectively. The results show that the optical fiber probe provided in Example 1 has higher sensitivity.

[0105] The Refractive Intensity Sensitivity (RIS) of U-shaped, Ω-shaped, and J-shaped optical fibers was compared. Three U-shaped, Ω-shaped, and J-shaped optical fibers were fabricated. Following the steps in Example 1, the probe portion (with the outer sheath removed) of the fiber was hydroxylated and amination treated. Then, the three types of fibers were modified with a gold nanoparticle solution prepared from Na3Ct and HAuCl4 in a 3:1 volume ratio until the same absorbance increment was achieved (the absorbance difference before and after modification was 1 OD). The fibers were then fixed at high temperature. The fiber probes were immersed in sucrose solutions with mass concentrations of 0%, 4%, 8%, 12%, 16%, and 20%, respectively. The absorbance values ​​were measured and recorded. A linear fit was performed between the absorbance and the corresponding sucrose refractive index, and the slope of the fitted curve was taken as the refractive sensitivity (RIS) of the fiber. The resonance absorption spectra of the three fiber shapes in sucrose solutions of different concentrations and their respective RIS are shown below. Figure 2 As shown, the absorbance of all three optical fiber shapes at a fixed wavelength increases linearly with increasing sucrose concentration; the absorbance variation of the J-shaped fiber is significantly higher than that of the U-shaped and Ω-shaped fibers. Through fitting calculations, the RIS of the U-shaped fiber is 13.72 (au) / RIU, the RIS of the Ω-shaped fiber is 21.13 (au) / RIU, and the RIS of the J-shaped fiber is 39.71 (au) / RIU. Therefore, the J-shaped fiber, proposed for the first time in this experiment, has the highest refractive sensitivity.

[0106] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. An optical fiber probe for detecting Helicobacter pylori, characterized by, The optical fiber probe comprises a sensing region and a non-sensing region which are connected with each other, the sensing region refers to a fiber core of the optical fiber, and the sensing region is free of a coating layer and a cladding layer which are arranged on the surface of the fiber core, the surface of the fiber core of the sensing region is modified with a nanomaterial, the nanomaterial is modified with an annealed nucleic acid aptamer shown as SEQ ID NO. 1 and a spacer nucleic acid shown as SEQ ID NO. 2, and the nucleic acid aptamer and the spacer nucleic acid are connected with the nanomaterial through ploy A; The nanomaterial is nano-gold, the fiber core of the sensing region comprises a straight section and a bending section, the bending section has a J shape, and the J shape is obtained by folding the Ω-shaped fiber core.

2. The optical fiber probe of claim 1, wherein, The particle size of the nano-gold is 13-60 nm.

3. The optical fiber probe of claim 2, wherein, The particle size of the nano-gold is 40 nm.

4. The optical fiber probe of claim 1, wherein, The non-sensing region refers to the optical fiber in which the coating layer and the cladding layer are sequentially arranged on the surface of the fiber core, the length of the fiber core of the sensing region is 2-5 cm, the optical fiber is a multi-mode optical fiber, the diameter of the fiber core of the optical fiber is 125-1000 μm, and the length of the optical fiber probe is 5-40 cm.

5. The optical fiber probe of claim 4, wherein, The length of the fiber core of the sensing region is 3 cm, and the diameter of the fiber core of the optical fiber is 600 μm.

6. A method of making an optical fiber probe as claimed in any one of claims 1-5, characterized in that, The method comprises the following steps: The optical fiber of the sensing region is bent into an Ω shape on a flame, and then folded to form a J shape; The nano-gold is modified on the surface of the sensing region of the optical fiber, and then the sensing region of the optical fiber is immersed in a mixed buffer solution of the annealed nucleic acid aptamer and the spacer nucleic acid for incubation.

7. The production method according to claim 6, characterized by, The nano-gold is modified on the surface of the sensing region of the optical fiber by immersing the sensing region of the optical fiber in a nano-gold solution for 2-3 min.

8. The method of claim 7, wherein, After modification in the nano-gold solution, a drying step is further included.

9. The production method according to claim 8, characterized by, After drying, a blocking reaction of the sensing region of the optical fiber by immersing the sensing region of the optical fiber in a succinic anhydride solution and drying is further included.

10. The method of claim 9, wherein, The concentration of the succinic anhydride solution is 8-14 mM.

11. The method of claim 10, wherein, The concentration of the succinic anhydride solution is 10 mM.

12. The method of claim 7, wherein, The annealing process comprises: heating the nucleic acid aptamer and the spacer nucleic acid at 95-100 ℃ for 1-5 min, respectively, and then mixing after cooling to room temperature.

13. The method of claim 12, wherein, The mixed solution of the annealed nucleic acid aptamer and the spacer nucleic acid is diluted with a sodium chloride solution to prepare a nucleic acid aptamer mixed solution, so that the concentration of sodium chloride in the nucleic acid aptamer mixed solution is 400-500 mM, and the final concentration of nucleic acid in the nucleic acid aptamer mixed solution is 1-1.2 μM.

14. The method of claim 13, wherein, The optical fiber modified with the nano-gold on the surface is inserted into the nucleic acid aptamer mixed solution, and metal bathed at 35-37 ℃ overnight.

15. An optical fiber LSPR sensor device, characterized by The method comprises: a wide-spectrum light source, the optical fiber probe according to any one of claims 1-5, a high-resolution spectrometer, an optical fiber jumper and a computer.

Images