A computational method for identifying amino acid candidate mutation sites of an enzyme

Abstract

The application discloses a kind of computing methods for identifying amino acid candidate mutation sites of enzyme, and the computing method includes enzyme protein hinge positioning, residue evolutionary conservation analysis and energy calculation.The application first adopts the method of integrating enzyme protein hinge positioning, residue evolutionary conservation analysis and energy calculation to screen enzyme candidate mutation sites, realizes the high-precision rapid screening of glycosyltransferase mutation sites, significantly improves the enzyme activity of glycosyltransferase on rebaudioside D (RebD) to produce rebaudioside M (RebM), effectively solves the problems of poor substrate specificity and low catalytic activity of the enzyme, reduces production cost, improves the soluble expression capacity of glycosyltransferase, is conducive to large-scale production through microbial fermentation, and is more suitable for commercial and industrial applications.

Description

Technical Field

[0001] The invention belongs to the field of enzyme engineering and relates to a calculation method for identifying candidate amino acid mutation sites of an enzyme. Background Art

[0002] Excessive sugar intake can cause insulin resistance and metabolic syndrome, which in turn increases the risk of various diseases, including hypertension, diabetes, and cardiovascular and cerebrovascular diseases. It is one of the main threats to human health. With increasing awareness of healthy eating, countries around the world have launched sugar reduction initiatives, and a class of green, healthy natural sweeteners, represented by steviol glycosides, has gained popularity. Steviol glycosides are a new type of natural sweetener extracted from the herbaceous plant Stevia rebaudiana. They consist of a common diterpene stevioside backbone (ligand) and a variable glycol (stevioside) composed primarily of glucose molecules. Steviol glycosides are 150-300 times sweeter than sucrose, while containing only 1 / 250 of the calories. After sucrose and beet sugar, they are considered the third natural sugar source and are considered the most promising new sugar source. They are already being used in the production of foods such as baking, dairy products, and beverages.

[0003] Steviosides can be classified into steviol, stevioside, rebaudioside A, B, C, D, E, and M, depending on the type of sugar group, the position of addition (C13 and C19), and the number of sugar groups. Rebaudioside A (RebA) is currently the main commercial stevia product, comprising approximately 2-4% of the dry weight of the leaves. Its sweetness is 350-450 times that of sucrose, but it has a certain bitter aftertaste. In contrast, rebaudioside M (RebM) offers advantages such as high sweetness, rapid sweetness perception, and a clean taste. Compared to other known steviol glycosides, it significantly reduces unpleasant aftertastes such as licorice, sourness, astringency, and bitterness, making it a preferred target for the development of high-efficiency natural sweeteners. However, the content of RebM in stevia leaves is extremely low (about 0.4-0.5% of the dry weight of the leaves). The traditional extraction and separation technology used to prepare RebM from the leaves has a low production volume, a complicated process, and a high cost that is far from meeting the demand, which is an important factor restricting its industrial application. Therefore, the use of biocatalysis to obtain sufficient rebaudioside M has attracted widespread attention.

[0004] CN113462670A discloses a glycosyltransferase mutant and a method for catalyzing the synthesis of rebaudioside M using the same. The method molecularly modifies the glycosyltransferase UGT76G1 through directed evolution, thereby improving its enzymatic activity and catalytic efficiency. The mutant is used to achieve efficient catalytic synthesis of rebaudioside M. However, this method fails to achieve high-precision and rapid screening of UGT76G1 mutation sites.

[0005] CN114574460A discloses a method for efficiently biosynthesizing rebaudioside M using a mutant of the glycosyltransferase UGT76G1. The method successfully obtains a highly efficient mutant by subjecting the glycosyltransferase UGT76G1 to directed evolution based on the protein crystal structure. Furthermore, by constructing a uridine diphosphate glucose (UDPG) cycle system, efficient biosynthesis of Reb M is achieved using an in vitro pure enzyme reaction system. However, this method fails to achieve high-precision and rapid screening of UGT76G1 mutation sites.

[0006] In summary, currently available glycosyltransferase mutants fail to achieve high-precision, rapid screening of mutation sites, making industrial-scale production difficult. Providing a rapid screening method for candidate enzyme mutation sites, effectively identifying mutation sites, and obtaining soluble, catalytically active glycosyltransferase mutants has become a pressing challenge in enzyme engineering. Summary of the Invention

[0007] In response to the deficiencies of the existing technology and actual needs, the present invention provides a calculation method for identifying candidate amino acid mutation sites of enzymes, which solves the problems that the current existing glycosyltransferase mutants cannot achieve high-precision and rapid screening of mutation sites and are difficult to achieve industrial-scale production. It can obtain glycosyltransferase mutants that are soluble and have high catalytic activity.

[0008] In order to achieve the purpose of the invention, the present invention adopts the following technical solutions:

[0009] In a first aspect, the present invention provides a computational method for identifying candidate amino acid mutation sites of an enzyme, the computational method comprising enzyme protein hinge positioning, residue evolutionary conservation analysis, and energy calculation;

[0010] The hinge positioning of the enzyme protein is calculated using the DFI function, which obtains the dynamic elasticity index of each residue by calculating the residue correlation matrix under long-term molecular dynamics simulation. The residue correlation matrix calculates the motion trajectory of protein Cα under molecular dynamics simulation and provides the pairwise correlation of Cα atomic fluctuations in the protein in the form of a covariance matrix. The formula for calculating the residue response vector caused by the perturbation force is shown in formula (1);

[0011] ΔR 3N×1 =G 3N×3N F 3N×1 Formula (1);

[0012] Where, ΔR 3N×1 is the residue response vector caused by the perturbation force, G 3N×3N is the covariance matrix obtained from molecular dynamics (MD) simulation, F 3N×1 is the disturbance force vector;

[0013] The perturbation response matrix is calculated according to formula (2);

[0014]

[0015] Wherein, A N×N is the perturbation response matrix obtained by sequentially applying the perturbation force to the Cα atoms in the protein, |ΔR 1 |1 is the fluctuation response amplitude of the perturbation at site 1 at site 1, |ΔR N |1 is the fluctuation response amplitude of the perturbation at site N at site 1, |ΔR 1 | N |1 is the fluctuation response amplitude of the perturbation at site 1 at site N, |ΔR N | N |1 is the fluctuation response amplitude of the perturbation at site N at site N, N is a natural number greater than or equal to 1;

[0016] The DFI score of the residue at site i is calculated according to formula (3) DFI i ;

[0017]

[0018] Wherein, DFI i is the ratio of the net response of all residues in the enzyme protein chain when they are sequentially disturbed one by one to the net displacement when all residues are disturbed, |ΔR j | i is the fluctuation response amplitude of the perturbation at site j at site i, i and j are natural numbers greater than or equal to 1 and less than or equal to N;

[0019] The residue evolutionary conservation analysis calculates the mutation frequency of each amino acid in natural evolution through multiple sequence comparison (MSA) of the target enzyme family (sequence number > 500);

[0020] The energy calculation uses the MMPBSA free energy decomposition tool and the motion trajectory under long-time molecular dynamics of the enzyme and the target substrate or product complex to calculate.

[0021] In the present application, the long time is time > μs, and the region with DFI% less than 0.2 is considered to be a hinge closely related to activity.

[0022] The application first adopts a method integrating hinge positioning of integrase protein, residue evolutionary conservation analysis and energy calculation to screen enzyme candidate mutation sites, which can be widely applied to genetic modification of enzymes, for example, high-precision and rapid screening of glycosyltransferase mutation sites, significantly improving the enzyme activity of glycosyltransferase for producing rebaudioside M (RebM) from rebaudioside D (RebD), effectively solving the problems of poor substrate specificity and low catalytic activity of the enzyme, reducing production cost, improving the soluble expression capacity of glycosyltransferase, being conducive to large-scale production through microbial fermentation, and being more suitable for commercial and industrial applications.

[0023] In a second aspect, the application provides a glycosyltransferase mutant, wherein the mutation site of the glycosyltransferase mutant is obtained by the calculation method for identifying the amino acid candidate mutation site of the enzyme according to the first aspect.

[0024] Preferably, the glycosyltransferase mutant has any one or a combination of at least two of the following mutations in the amino acid sequence SEQ ID NO. 1: P84V, L85V, M88V, S195V or L379V.

[0025] In the application, the amino acid sequence represented by SEQ ID NO. 1 is as follows:

[0026] MGALTGTTVAAAAAIILPPVPPGGHIAPILGLAAVLTSLGPSITIPHTALPLTSATPHPTPAPILAAAPGA

[0027] GAISALPTHGPLAGMAIPIIAGHGAAGLAAGLGLLMLASGGAGGVSCLITAALTTPAGSVAASLALAALV

[0028] LMTSSLPAPHAHVSLPGPAGLGTLAPAALTALGGGASGPPMLLVLAILSATSATGILLGILGLMILGTAASS

[0029] GVITASPLGLGGSGLGTVIAGIPAPSPLIPLPLHLTASSSSLLAHAATVPGTLAGGPPSSVLTVSPGSTSGVAG

[0030] LAPLGIAAGLVASLGSPLTVVAPGPVLGSTTVGPLPAGPLGGAGAIVLTVPGGGVLAHGAIGAPTTHSGTA

[0031] STLGSVCGGVPMIPSAPGLAGPLAAATMSAVLLVGVTLGAGTGAGGIAAAIAAVMVAGGGGTIAGAAAV

[0032] LLGLAAVSLMLGGSSTGSLGSLVSTISSL.

[0033] In a third aspect, the present invention provides a nucleic acid molecule comprising a coding sequence for the glycosyltransferase mutant described in the second aspect.

[0034] In a fourth aspect, the present invention provides a recombinant vector comprising the nucleic acid molecule described in the third aspect.

[0035] In a fifth aspect, the present invention provides a recombinant cell, which contains the nucleic acid molecule described in the third aspect and / or the recombinant vector described in the fourth aspect.

[0036] In a sixth aspect, the present invention provides a method for preparing the glycosyltransferase mutant according to the second aspect, the preparation method comprising the following steps:

[0037] (1) Calculating candidate mutation hotspots of glycosyltransferases using the calculation method for identifying candidate amino acid mutation sites of enzymes described in the first aspect;

[0038] (2) inserting the nucleic acid sequence of glycosyltransferase SEQ ID NO.2 into a plasmid to obtain a recombinant plasmid, and using the recombinant plasmid as a template, performing site-directed saturation mutagenesis on any one or a combination of at least two of the 84th, 85th, 88th, 195th and 379th sites of the glycosyltransferase, wherein the nucleic acid sequence of the primer for mutation at site 84 includes the sequences shown in SEQ ID NO.3 and SEQ ID NO.4, the nucleic acid sequence of the primer for mutation at site 85 includes the sequences shown in SEQ ID NO.5 and SEQ ID NO.6, the nucleic acid sequence of the primer for mutation at site 88 includes the sequences shown in SEQ ID NO.7 and SEQ ID NO.8, the nucleic acid sequence of the primer for mutation at site 195 includes the sequences shown in SEQ ID NO.9 and SEQ ID NO.10, and the nucleic acid sequence of the primer for mutation at site 379 includes the sequences shown in SEQ ID NO.11 and SEQ ID NO.12;

[0039] (3) The mutant plasmid obtained in step (2) is transformed into a host bacterium, cultured and purified to obtain the glycosyltransferase mutant.

[0040] Preferably, the plasmid comprises pETDuet-1.

[0041] Preferably, the host bacteria include Escherichia coli, Saccharomyces cerevisiae or Pichia pastoris.

[0042] In the present invention, the nucleic acid sequence shown in SEQ ID NO.2 is as follows:

[0043] ATGGCGGAACGCGTTCTGACCCGCGTGCATAGCTTACGCGAACGCGTTGATGCGACCCTGGCGG

[0044] CGCATCGTAATGAAATTCTGCTGTTTCTGAGCCGCATTGAAAGCCATGGCAAAGGCATTCTGAAAACCG

[0045] CATGAACTGCTGCGGAATTTGATGCGATTCGCCAGGATGATAAAAATAAACTGAATGAGCACGCGTT

[0046] CGAGGAGCTGCTGAAAAGCACCCAGGAAGCGATTGTGCTGCCGCCGTGGGTTGCGTTAGCGATTCG

[0047] TCTGCGTCCGGGTGTGTGGGAATATATTCGCGTGAATGTGAATGCGCTGGTGGTGGAAGAACTGAGC

[0048] GTGCCGGAATATCTGCAGTTTAAAGAAGAACTGGTGGATGGCGCGAGCAATGGCAATTTTGTGCTGG

[0049] AACTGGATTTTGAACCGTTTACCGCGAGCTTTCCGAAACCGACCCTGACCAAAAGCATTGGCAATGG

[0050] CGTGGAATTTCTGAATCGCCATCTGAGCGCGAAAATGTTTCATGATAAAGAAAGCATGACCCCGCTGC

[0051] TGGAATTTCTGCGGGCGCATCATTATAAAGGCAAAACCATGATGCTGAATGACCGCATTCAGAATAGC

[0052] AATACCCTGCAGAATGTGCTGCGCAAAGCGGAAGAATATCTGATTATGCTGCCGCCGGAAACCCCGTA

[0053] TTTTGAATTTGAACATAAATTCCAGGAGATCGGCCTGGAAAAAGGCTGGGGCGATACCGCGGAACGC

[0054] GTGTTGGAAATGGTGTGCATGCTGCTGGATCTGCTGGAAGCGCCGGATAGCTGCACCCTGGAAAAAT

[0055] TTCTGGGCCGCATTCCGATGGTGTTTAATGTGGTGATTCTGAGCCCGCATGGCTATTTTGCGCAGGAA

[0056] AATGTGCTGGGCTATCCGGATACCGGCGGCCAGGTTGTTTATATTCTGGATCAGGTGCCGGCGCTGGA

[0057] ACGCGAAATGCTGAAACGCATTAAAGAACAGGGCCTGGATATTATTCCGCGCATTCTGATTGTGACCC

[0058] GCCTGCTGCCGGATGCGGTTGGGACCACCTGTGGTCAACGTATTGAAAAAGTGTATGGCGCGGAACA

[0059] TAGCCATATTCTGCGCGTGCCGTTTCGCACCGAAAAAGGCATTGTGCGCAAATGGATTAGCCGCTTTG

[0060] AAGTGTGGCCGTATATGGAAACCTTTATTGAAGATGTGGCGAAAGAAATTAGCGCGGAACTGCAGGC

[0061] GAAACCGGATCTGATTATTGGCAATTATAGCGAAGGCAATCTGGCGGCGAGCCTGCTGGCGCATAAA

[0062] CTGGGTGTTACCCAGTGCACCATTGCGCATGCGCTGGAAAAGACCAAATATCCGGATAGCGATATTTA

[0063] CTGGAAAAAGTTCGACGAGAAGTATCACTTCAGCAGCCAGTTCACCGCGGATCTGATTGCGATGAAT

[0064] CATACCGATTTTATTATCACCAGCACCTTCCAGGAAATCGCGGGCAGCAAAGATACCGTGGGCCAGTA

[0065] TGAAAGCCACATGGCGTTTACCATGCCGGGCCTGTATCGCGTGGTGCATGGCATTAATGTGTTTGATC

[0066] CGAAATTTAACATCGTGAGCCCGGGCGCGGATATTAATCTGTATTTTAGCTATAGCGAAACCGAGAAG

[0067] CGCCTGACCGCGTTTCATCCGGAAATTGATGAACTGCTGTATAGCGATGTGGAAAATGATGAACATCT

[0068] GTGCGTGCTGAAAGATCGCACCAAACCGATTCTGTTTACCATGGCCCGCCTGGATCGCGTGAAAAAT

[0069] CTGACCGGCCTGGTGGAATGGTATGCGAAAAATCCGCGCCTGCGCGGCCTGGTGAATCTGGTTGTTG

[0070] TTGGCGGTGATCGCCGCAAAGAAAGCAAAGATCTGGAAGAACAGGCGGAAATGAAGAAAATGTATG

[0071] AGCTGATTGAAACCCACAACCTGAATGGCCAGTTTCGCTGGATTAGCAGCCAGATGAATCGCGTGCG

[0072] CAATGGCGAACTGTATCGCTATATTGCGGATACCAAAGGCGCGTTTGTGCAGCCGGCGTTTTATGAAG

[0073] CGTTTGGCCTGACCGTGGTGGAAGCGATGACCTGCGGCTTGCCAACCTTTGCGACTAATCATGGCGG

[0074] CCCGGCGGAAATTATTGTGCATGGCAAAAGCGGCTTTCATATTGATCCGTATCATGGCGAACAGGCGG

[0075] CGGATCTGCTGGCGGATTTCTTTGAAAAAATGCAAGAAAGACCCGAGCCATTGGGAAACATTAGCAT

[0076] GGGCGGCCTGAAACGCATTGAAGAAAAATATACCTGGCAGATTTATAGCGAGAGCCTGCTGACCCTG

[0077] GCGGCGGTTTATGGATTTTGGAAACATGTGAGCAAACTGGATCGCCTGGAAATTCGCCGCTATCTGGA

[0078] AATGTTTTTATGCGCTGAAATATCGCAAAATGGCGGAAGCGGTGCCGCTGGCGGCGGAATAA.

[0079] In the present invention, the nucleic acid sequence shown in SEQ ID NO.3 is as follows (underlined bases are mutated):

[0080] CTGCCGACCCATGGC GTG CTGGCGGGTATGCGT.

[0081] In the present invention, the nucleic acid sequence shown in SEQ ID NO.4 is as follows (underlined bases are mutated):

[0082] CAC GCCATGGGTCGGCAGATTGCTAATGCGTTC.

[0083] In the present invention, the nucleic acid sequence shown in SEQ ID NO.5 is as follows (underlined bases are mutated):

[0084] CCGACCCATGGCCCGGTG GCGGGTATGCGTATT.

[0085] In the present invention, the nucleic acid sequence shown in SEQ ID NO.6 is as follows (underlined bases are mutated):

[0086] CAC CGGGCCATGGGTCGGCAGATTGCTAATGCG.

[0087] In the present invention, the nucleic acid sequence shown in SEQ ID NO.7 is as follows (underlined bases are mutated):

[0088] GGCCCGCTGGCGGGT GTG CGTATTCCAATTATT.

[0089] In the present invention, the nucleic acid sequence shown in SEQ ID NO.8 is as follows (underlined bases are mutated):

[0090] CAC ACCCGCCAGCGGGCCATGGGTCGGCAGATT.

[0091] In the present invention, the nucleic acid sequence shown in SEQ ID NO.9 is as follows (underlined bases are mutated):

[0092] ATTAAAAGCGCGTAT GTG AACTGGCAGATTCTG.

[0093] In the present invention, the nucleic acid sequence shown in SEQ ID NO.10 is as follows (underlined bases are mutated):

[0094] CAC ATACGCGCTTTTAATATCTTTCACTTTCAG.

[0095] In the present invention, the nucleic acid sequence shown in SEQ ID NO.11 is as follows (underlined bases are mutated):

[0096] TTTAGCGATTTTGGC GTG GATCAGCCGCTGAAT.

[0097] In the present invention, the nucleic acid sequence shown in SEQ ID NO.12 is as follows (underlined bases are mutated):

[0098] CAC GCCAAAATCGCTAAAAATCATCGGCACGCC.

[0099] In a seventh aspect, the present invention provides a use of the glycosyltransferase mutant described in the second aspect in catalyzing a glycosyl transfer reaction.

[0100] Preferably, the substrate for the transglycosylation reaction comprises rebaudioside.

[0101] Preferably, the substrate of the glycosyl transfer reaction includes rebaudioside D.

[0102] In an eighth aspect, the present invention provides a method for preparing rebaudioside M, the preparation method comprising:

[0103] Water, sodium dihydrogen phosphate, sodium hydrogen phosphate, magnesium chloride, a glycosyl donor, rebaudioside D and the glycosyltransferase mutant described in the second aspect are mixed and reacted. After the reaction, the product is purified to obtain the rebaudioside M.

[0104] Compared with the prior art, the present invention has the following beneficial effects:

[0105] The present invention uses for the first time an integrated method of integrase protein hinge positioning, residue evolutionary conservation analysis and energy calculation to screen candidate enzyme mutation sites, achieving high-precision and rapid screening of glycosyltransferase mutation sites, significantly improving the enzyme activity of glycosyltransferase in producing rebaudioside M (RebM) from rebaudioside D (RebD), effectively solving the problems of poor substrate specificity and low catalytic activity of the enzyme, reducing production costs, and improving the soluble expression ability of glycosyltransferase, which is conducive to large-scale production through microbial fermentation and is more suitable for commercial and industrial applications. BRIEF DESCRIPTION OF THE DRAWINGS

[0106] Figure 1 A technical roadmap for rapid screening of candidate enzyme mutation sites;

[0107] Figure 2 Constructing a diagram of the 3D structure of the glycosyltransferase-substrate complex;

[0108] Figure 3A The root mean square deviation results of molecular dynamics simulations of UDPG-SrUGT76G1, RebD-UDPG-SrUGT76G1 and RebM-UDP-SrUGT76G1 are shown;

[0109] Figure 3B Results of gyration radius of molecular dynamics simulation of UDPG-SrUGT76G1, RebD-UDPG-SrUGT76G1 and RebM-UDP-SrUGT76G1

[0110] Figure 3CSolvent accessible surface area results of molecular dynamics simulations for UDPG-SrUGT76G1, RebD-UDPG-SrUGT76G1, and RebM-UDP-SrUGT76G1

[0111] Figure 3D Root mean square fluctuation results of molecular dynamics simulation of UDPG-SrUGT76G1, RebD-UDPG-SrUGT76G1 and RebM-UDP-SrUGT76G1

[0112] Figure 4 This is the molecular mechanics / Poisson-Boltzmann surface area (MMPBSA) result diagram;

[0113] Figure 5 This is a co-evolutionary conservation analysis diagram of glycosyltransferase SrUGT76G1;

[0114] Figure 6 This is a diagram of hinge analysis when screening mutation sites;

[0115] Figure 7 The diagram shows the results of soluble expression and purification of wild-type SrUGT76G1 enzyme protein;

[0116] Figure 8 Figure 2 is the expression and purification results of wild-type SrUGT76G1 and its mutants in Escherichia coli BL21 (DE3);

[0117] Figure 9 is a concentration standard curve of rebaudioside D (RebD) and rebaudioside M (RebM);

[0118] Figure 10 is the result of enzyme activity assay;

[0119] Figure 11 This is a diagram of the construction of the pETDuet1-UGT76G1-STSUS1 recombinant plasmid;

[0120] Figure 12 is the effect of temperature on glycosylation coupling reaction;

[0121] Figure 13 The effect of the mass ratio of RebD to sucrose on the glycosylation coupling reaction;

[0122] Figure 14 is the effect of reaction time on glycosylation coupling reaction;

[0123] Figure 15 This is the effect of crude enzyme concentration on glycosylation coupling reaction. DETAILED DESCRIPTION

[0124] To further illustrate the technical means and effects of the present invention, the present invention is further described below with reference to the embodiments and drawings. It should be understood that the specific embodiments described herein are only used to explain the present invention, rather than to limit the present invention.

[0125] If no specific techniques or conditions are specified in the examples, the experiments were carried out according to the techniques or conditions described in the literature in the field or according to the product instructions. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased through regular channels.

[0126] Example 1

[0127] Construction of glycosyltransferase mutants.

[0128] (1) Reconstruction of the glycosyltransferase-substrate complex structure

[0129] The amino acid sequence of the wild-type glycosyltransferase (SrUGT76G1) was obtained using the Uniprot database, and the UDPG / SrUGT76G1 and UDP / SrUGT76G1 models were obtained by PSI-BLAST search using NCBI. The missing structure of the Loop region was repaired using Modeller software to obtain the complete SrUGT76G1 structure. The substrate binding pocket was analyzed using MOLE software, and AutodockVina was used to obtain the potential optimal binding conformations of the complexes RebD / UDPG / SrUGT76G1 and RebM / UDP / SrUGT76G1, as shown in Figure 5. Figure 2 shown.

[0130] (2) Molecular dynamics simulation study of the catalytic mechanism of glycosyltransferases

[0131] Microsecond molecular dynamics simulations (Figure 3) were performed using the GROMACS 2019.6 software package for the three complex models: UDPG / SrUGT76G1 (before substrate binding), RebD / UDPG / SrUGT76G1 (before product synthesis), and RebM / UDP / SrUGT76G1 (after product synthesis) at 313 K and 1 bar. Following the simulations, MOLE software was used to observe changes in the catalytic pocket size and channel of SrUGT76G1. RMSF, RMSD, SASA, and Rg commands were used to determine amino acid residue fluctuations, system stability, and changes in protein structural compactness. The interactions between the substrate and the amino acid residues surrounding SrUGT76G1 were analyzed to further elucidate the mechanism by which SrUGT76G1 catalyzes the synthesis of RedM from RebD.

[0132] (3) Determination of glycosyltransferase mutation hotspots

[0133] Based on the molecular dynamics simulation results of step (2), the energy contribution between the substrate and SrUGT76G1 was decomposed into each residue using the MMPBSA tool, where the amino acid residues with a total energy contribution >|2| kJ / mol were defined as hotspot amino acid residues (e.g. Figure 4 The conservation of SrUGT76G1 sequence was analyzed using ConSurf and WebLogo servers (as shown in Figure 5 As shown in ), the common SrUGT76G1 non-conservative sequence was obtained by analyzing the intersection of non-conservative sequences. The sequence alignment file required by the WebLogo server was provided by the MEGA-X software. The sequence alignment file contained homologous sequences with a sequence number of >500 retrieved from NCBI (sequence identity >40%). The protein hinge positioning was achieved based on the DFI function. The DFI function can obtain the dynamic elasticity index of each residue by calculating the residue correlation matrix under long-term (>μs) molecular dynamics simulation. The region with a DFI% of less than 0.2 was considered to be a hinge closely related to activity (as shown in ). Figure 6 Finally, non-conserved sites and non-hinge sites were retrieved from the hotspot amino acid residues as mutation hotspots.

[0134] (4) The wild-type glycosyltransferase SrUGT76G1 gene sequence was subjected to site-directed mutagenesis. The mutation sites screened were: Gly83, Pro84, Leu85, Ala86, Gly87, Met88, Arg89, Ile90, Ser195, Asn196, Thr284, Ser285, Asp376, Phe377, Gly378, and Leu379;

[0135] (5) The nucleotide sequence of the glycosyltransferase SrUGT76G1 mutant was expressed to obtain a recombinant plasmid, and PCR amplification technology was used with the recombinant plasmid as a template and primers G38V-F / G38V-R, P84V-F / P84V-R, L85V-F / L85V-R, A86V-F / A86V-R, G87V-F / G87V-R, M88V-F / M88V-R, R89V-F / R89V-R, I90V-F / I90V-R, S195V-F / S196V-R. PCR amplification of the site-directed mutant-encoding genes was performed for 5V-R, N196V-F / N196V-R, T284V-F / T284V-R, S285V-F / S285V-R, D376V-F / D376V-R, F377V-F / F377V-R, F377G-F / F377G-R, G378V-F / G378V-R, and L379V-F / L379V-R (primers are shown in Table 1; the mutated bases are underlined) to construct recombinant plasmids carrying the mutants. The 50 μL PCR reaction system for target plasmid amplification consisted of: 1 μL each of 10 ng / μL forward and reverse primers; 25 μL Prime STAR MAX; 1 μL of 1 ng / μL template plasmid; and 22 μL of sterile dd HO. Digest the template with 1 μL of Dpn I at 37°C for 2 hours to ensure that the mutant library is free of maternal mutations. PCR amplification products were verified by agarose gel electrophoresis. Successful amplification products were recovered from the gel and the nucleic acid concentration was determined using a nucleic acid quantifier.

[0136] (6) The recombinant plasmid was sequenced and transformed into Escherichia coli BL21 (DE3) competent cells to obtain a recombinant strain; the recombinant bacteria used Escherichia coli BL21 (DE3) as the host cell and pETDuet-1 as the expression vector: after being transformed into the Escherichia coli BL21 (DE3) competent cells, the cells were placed on ice for 30 minutes, heat-shocked at 42°C for 90 seconds, and then placed on ice for 2 minutes. 600 μL of LB medium was added, and the medium was prepared by 10 g / L NaCl, 5 g / L yeast powder, and 10 g / L peptone. The culture was shaken at 37°C at 200 rpm for 45 minutes, and the entire bacterial liquid was evenly spread on an LB plate containing ampicillin resistance and cultured overnight at 37°C. Four single colonies on the plate were picked and inoculated into LB liquid culture medium, and the culture medium was prepared by 10 g / L NaCl, 5 g / L yeast powder, and 10 g / L peptone. After 9 hours, store the bacterial suspension in a glycerol tube and sequence it later. Bacterial suspensions with correct sequencing results are stored in glycerol at -80°C.

[0137] (7) Site-directed orthogonal combination mutagenesis screening of multiple mutants of glycosyltransferase SrUGT76G1

[0138] The enzyme activity of the single-point mutants of glycosyltransferase SrUGT76G1 was screened by in vitro enzyme activity assay, and several single-point mutants of glycosyltransferase SrUGT76G1 with higher enzyme activity than the wild type were obtained (such as Figure 10 As shown). Orthogonal combination directed mutagenesis was performed on different mutation sites of the glycosyltransferase SrUGT76G1 to obtain a combination mutant of the glycosyltransferase SrUGT76G1 that produces high RebM.

[0139] Table 1

[0140]

[0141]

[0142] Example 2

[0143] Inducible expression of recombinant strains.

[0144] The recombinant strain constructed in Example 1 was activated and transferred to a LB liquid test tube containing ampicillin at a concentration of 1‰, and cultured in a shaking incubator at 37°C and 200 rpm for 16 h to prepare a seed solution.

[0145] The seed solution was transferred to LB liquid medium containing ampicillin resistance at 3% and cultured until OD 600 =0.6, isopropyl-β-D-thiogalactopyranoside (IPTG) inducer was added for overnight induction culture, and the cells were collected by centrifugation at 10,000 rpm for 30 min at 4°C. The IPTG inducer concentration was 0.6 mM, the induction expression temperature was 30°C, and the induction expression time was 17 h.

[0146] Example 3

[0147] Purification of the glycosyltransferase SrUGT76G1 mutant.

[0148] The bacteria collected in Example 3 were resuspended in an appropriate amount of buffer and ultrasonically disrupted (power 150W, 0°C, disruption 1s, rest 3s), and centrifuged at 10000rpm for 30min at 4°C to collect the supernatant, which was the crude enzyme solution for purification. Purification was performed using a Ni-NTA 1mL gravity column, which was balanced with a BufferA column before purification. After loading, 10mL BufferA was added to clean non-specific binding proteins, and then gradient elution was performed using Buffer B (pH 8.0, 10, 30, 100, 250, 300mM imidazole, 300mMNaCl, 50mMNaH2PO4, 10% glycerol) with different imidazole concentrations. The collected samples were analyzed by SDS-PAGE to determine the optimal elution concentration. The eluted protein group with higher purity was concentrated and desalted using a 30kDa ultrafiltration tube, and glycerol was added to a final concentration of 20%, and stored at -80°C for the determination of enzymatic properties. Figure 7 As shown in the figure, E. coli BL21(DE3) / pETDuet-1-SrUGT76G1 expressed a 51 kDa protein band upon IPTG induction at 16°C, 20°C, and 25°C, consistent with the theoretical molecular weight of the glycosyltransferase SrUGT76G1. The enzyme protein expression level was higher when the induction temperature was 25°C. Figure 8 The results showed that all mutants of glycosyltransferase SrUGT76G1 could be soluble expressed in Escherichia coli, and the molecular weights of the bands were correct.

[0149] Example 4

[0150] The glycosyltransferase SrUGT76G1 mutant obtained in Example 3 catalyzes the synthesis of RebM from RebD.

[0151] This glycosylation reaction used UDPG as the glycosyl donor and utilized the glycosyltransferase SrUGT76G1 mutant obtained in Example 4 to catalyze the synthesis of RebM from the substrate RebD. The catalytic reaction conditions were: a reaction system of 10 mM RebD, 20 mM UDPG, 60 mM MgCl2, and 50 mM NaH2PO4-Na2HPO4 buffer, at 60°C for 32 hours, with a buffer pH of 9.0.

[0152] Example 5

[0153] Glycosyltransferase activity assay.

[0154] The total enzymatic reaction system (50 mM NaH2PO4-Na2HPO4 buffer, pH 7.2) consisted of 3 mL, containing 1 mg of crude enzyme protein, 1 mM substrate Reb D, 2 mM UDPG, and 3 mM MgCl2. The reaction was incubated at 30°C, with samples collected every 30 minutes. The samples were then heated at 95°C for 10 minutes, centrifuged, filtered through a 0.22 μm organic filter, and analyzed by HPLC. Glycosyltransferase activity (U) was defined as the amount of enzyme required to produce 1 μmol of Reb M from Reb D per minute.

[0155] HPLC analysis of Reb D and Reb M: Shimadzu liquid chromatography system, INERTSIL ODS-SP 5UM 4.6×250 mm C18 column, mobile phase A (1.38 g / L sodium dihydrogen phosphate buffer): B (acetonitrile) = 68:32, isocratic elution, injection volume 10 μL, flow rate 1 mL / min, column temperature 40°C, detection wavelength 210 nm. A standard curve (Reb D: y = 2×10 6 x+28112,R 2 =0.9928; RebM:y=2×10 6 x+27390,R 2 =0.996)(e.g. Figure 9 The results showed that the concentrations of RebD and RebM had a good linear relationship with their peak areas within the range of 0.005–0.3 mM, indicating that the method was feasible. The content of RebD and RebM in the samples was analyzed using an external standard method.

[0156] The specific enzyme activities of SrUGT76G1, G83V, P84V, L85V, A86V, G87V, M88V, R89V, I90V, S195V, N196V, T284V, S285V, D376V, F377V, F377G, G378V and L379V were as follows: Figure 10 The results showed that the five mutants (P84V, S195V, L85V, M88V, and L379V) exhibited higher activity than the wild-type glycosyltransferase SrUGT76G1. The specific enzyme activity of the mutant M88V was 247.16±16.86 U / mg, which was 70.33% higher than that of the wild-type glycosyltransferase SrUGT76G1.

[0157] Example 6

[0158] Kinetic parameter detection of wild-type SrUGT76G1 and the mutant enzyme obtained in Example 3.

[0159] The detection method is as follows: the reaction is carried out at 30℃ in 50 mM sodium phosphate buffer (pH 7.2) containing different concentrations of RebD (100, 125, 250, 500, 1000 and 2000 μM), 2 mM UDPG, 3 mM MgCl2 and an appropriate amount of purified enzyme. Sample every 10 min, and heat at 95℃ for 15 min to terminate the reaction. After centrifugation, the contents of RebD and RebM are determined by the HPLC method described in Example 5, and the kinetic parameters (K cat , K m and K cat / K m ) are obtained by fitting the data to the Michaelis equation using the double-reciprocal plot method.

[0160] The detection results are shown in Table 2.

[0161] Table 2

[0162] SrUGT76G1 K m (μM) K cat (min -1 )]]> K cat / K(μM -1 min -1 )]]> Wild type 464.31±2.00a 12.67 0.027 M88V 210.72±4.79d 27.68 0.131 P84V 467.10±4.63a 11.14 0.024 L85V 455.70 ± 3.31 ab 13.31 0.029 S195V 440.46±4.74b 15.5 0.035 L379V 402.78±7.60c 18.07 0.045

[0163] The results show that the SrUGT76G1 mutants of the application have better performance. Compared with the wild-type SrUGT76G1, the Km values of the mutants M88V, L379V and S195V are significantly reduced, and the Km value of the mutant M88V is 210.72 ± 4.79 μM, which is more than 50% lower than that of the wild-type SrUGT76G1, indicating that the affinity of the mutant M88V to the substrate is significantly improved. The kcat values of the mutants M88V and L379V are 2.18 times and 1.43 times that of the wild-type UGT76G1, respectively, and the kcat / Km values of the mutants M88V and L379V are 4.85 times and 1.67 times that of the wild-type UGT76G1, respectively, indicating that the catalytic efficiency of the two mutants is significantly improved.

[0164] Example 7

[0165] Establishment of a double-enzyme coupling reaction system of a glycosyltransferase mutant and sucrose synthase.

[0166] Using molecular cloning technology, a genetically engineered bacterium for heterologous expression of a glycosyltransferase mutant and sucrose synthase is obtained, and after induced fermentation to produce enzymes, a double-enzyme cycle reaction system is established by directly catalyzing the reaction with cell crude extract.

[0167] Codons optimized for heterologous expression in E. coli were synthesized from the coding regions of S. rebaudiana UGT76G1 (NCBI reference sequence: AGL95113.1) and potato sucrose synthase StSuS1 (UniProtKB / Swiss-Prot: P10691) and cloned into the E. coli expression vector pETDuet-1 using GenScript. The codon-optimized UGT76G1 gene was inserted between the BamHI and HindIII restriction endonuclease sites, and the modified StSUS1 gene was inserted between the NdeI and KpnI restriction endonuclease sites to construct the pETDuet-1 vector. Figure 11 The expression vector pETDuet1-UGT76G1-STSUS1 was transformed into BL21 (DE3) competent cells.

[0168] Example 7

[0169] Effect of temperature on the coupled glycosylation reactions of glycosyltransferase and sucrose synthase.

[0170] The glycosylation coupling reaction system was 3 mL, consisting of 5.0 mg / mL crude enzyme extracts of the glycosyltransferase SrUGT76G1 mutant and sucrose synthase, 20 g / L RebD, 100 g / L sucrose, and NaH2PO4-Na2HPO4 buffer (50 mM, pH 7.2). The reaction was carried out at 20°C, 30°C, 40°C, 50°C, and 60°C for 30 h. After the reaction was completed, the reaction was terminated by heating at 95°C for 10 min, centrifuged for 5 min, and filtered through a 0.22 μM filter. The concentration of RebM in the reaction system was determined by the HPLC method described in Example 5, and the RebM yield was calculated using formula (4). The effect of temperature on the glycosylation coupling reaction of glycosyltransferase and sucrose synthase was determined. The results showed that when the temperature was between 30 and 40°C, the RebM yield could reach more than 65% ( Figure 12 ).

[0171]

[0172] Example 8

[0173] Effect of the mass ratio of substrate RebD to sucrose on the coupled glycosylation reaction of glycosyltransferase and sucrose synthase.

[0174] The glycosylation coupling reaction system was 3 mL, consisting of 5.0 mg / mL crude enzyme extracts of the glycosyltransferase SrUGT76G1 mutant and sucrose synthase, 20 g / L RebD, NaH2PO4-Na2HPO4 buffer (50 mM, pH 7.2), and different substrate RebD to sucrose mass ratios (1:2, 1:4, 1:6, 1:8, and 1:10). The reaction was placed at 30°C for 30 hours. After the reaction was completed, the reaction was terminated by heating at 95°C for 10 minutes, centrifuged for 5 minutes, and filtered through a 0.22 μM filter membrane. The yield of RebM was determined using the method in Example 7 to determine the effect of the substrate RebD to sucrose mass ratio on the glycosylation coupling reaction of glycosyltransferase and sucrose synthase. The results showed that when the RebD to sucrose mass ratio reached 1:6 or above, the yield of RebM could reach the highest value, about 70% or more ( Figure 13 ).

[0175] Example 9

[0176] Effect of reaction time on the coupled glycosylation reaction of glycosyltransferase and sucrose synthase.

[0177] The glycosylation coupling reaction system was 3 mL, consisting of 5.0 mg / mL crude enzyme extracts of the glycosyltransferase SrUGT76G1 mutant and sucrose synthase, 20 g / L RebD, 100 g / L sucrose, and NaH2PO4-Na2HPO4 buffer (50 mM, pH 7.2). The reaction was carried out at 30°C, and the reaction mixtures were tested at 6, 12, 18, 24, and 30 hours. After the reaction was completed, the reaction was terminated by heating at 95°C for 10 minutes, centrifuged for 5 minutes, and filtered through a 0.22 μM filter. The yield of RebM was determined using the method in Example 7, and the effect of different reaction times on the glycosylation coupling reaction of glycosyltransferase and sucrose synthase was determined. The results showed that when the glycosylation coupling reaction time reached 24 hours or more, the yield of RebM reached a stable level, with the highest value reaching over 70% ( Figure 14 ).

[0178] Example 10

[0179] Effect of crude enzyme extract concentration on coupled glycosylation reactions of glycosyltransferase and sucrose synthase.

[0180] The glycosylation coupling reaction system consisted of 3 mL of crude enzyme extracts of the glycosyltransferase SrUGT76G1 mutant and sucrose synthase at different concentrations (2.0, 4.0, 6.0, 8.0, and 10.0 mg / mL), 20 g / L RebD, 100 g / L sucrose, and NaH2PO4-Na2HPO4 buffer (50 mM, pH 7.2). The reaction was allowed to proceed at 30°C for 30 h. After completion of the reaction, the reaction was terminated by heating at 95°C for 10 min, centrifuged for 5 min, and filtered through a 0.22 μM filter. The yield of RebM was determined using the method described in Example 7. The effect of different crude enzyme extract concentrations on the glycosylation coupling reaction of glycosyltransferase and sucrose synthase was determined. The results showed that when the crude enzyme concentration reached 6 mg / mL or above, the yield of RebM reached a stable level, with the highest value reaching over 70% ( Figure 15 ).

[0181] In summary, the present invention, for the first time, uses an integrated method of integrase protein hinge positioning, residue evolutionary conservation analysis, and energy calculation to screen candidate enzyme mutation sites, achieving high-precision and rapid screening of glycosyltransferase mutation sites, significantly improving the enzyme activity of glycosyltransferase in producing rebaudioside M (RebM) from rebaudioside D (RebD), effectively solving the problems of poor substrate specificity and low catalytic activity of the enzyme, reducing production costs, and improving the soluble expression ability of glycosyltransferase, which is conducive to large-scale production through microbial fermentation and is more suitable for commercial and industrial applications.

[0182] The applicant states that the present invention is intended to illustrate the detailed methods of the present invention through the above-described embodiments, but the present invention is not limited to the above-described detailed methods, that is, it does not mean that the present invention must rely on the above-described detailed methods in order to be implemented. Those skilled in the art should understand that any improvements to the present invention, equivalent substitutions for various raw materials in the products of the present invention, addition of auxiliary ingredients, and selection of specific methods, etc., are all within the scope of protection and disclosure of the present invention.

Claims

1. A computational method for identifying candidate amino acid mutation sites of an enzyme, characterized in that: The computational methods include enzyme protein hinge positioning, residue evolutionary conservation analysis and energy calculation; The hinge positioning of the enzyme protein is calculated using the DFI function. The DFI function obtains the dynamic elasticity index of each residue by calculating the residue correlation matrix under long-term molecular dynamics simulation. The residue correlation matrix calculates the motion trajectory of protein Cα under molecular dynamics simulation and provides the pairwise correlation of Cα atomic fluctuations in the protein in the form of a covariance matrix. The formula for calculating the residue response vector caused by the perturbation force is shown in formula (1); Formula (1); Where, ΔR 3N×1 is the residue response vector caused by the perturbation force, G 3N×3N is the covariance matrix obtained from molecular dynamics simulation, F 3N×1 is the disturbance force vector; Calculate the disturbance response matrix according to formula (2); Formula (2); Among them, A N×N is the perturbation response matrix obtained by sequentially applying the perturbation force to the Cα atoms in the protein, |ΔR 1 |1 is the amplitude of the fluctuation response generated by the disturbance at site 1, |ΔR N |1 is the amplitude of the fluctuation response generated by the disturbance at site N at site 1, |ΔR 1 | N is the amplitude of the fluctuation response generated by the disturbance at site 1 at site N, |ΔR N | N is the amplitude of the fluctuation response generated by the disturbance at site N, where N is a natural number greater than or equal to 1; The DFI score of residue i at position i is calculated according to formula (3): i ; Formula (3); Among them, DFI i is the ratio of the net response when all residues in the enzyme protein chain are perturbed one by one in sequence to the net displacement when all residues are perturbed, |ΔR j | i is the amplitude of the fluctuation response generated by the disturbance at site j at site i, where i and j are natural numbers greater than or equal to 1 and less than or equal to N; The residue evolution conservation analysis calculates the mutation frequency of each amino acid in natural evolution by comparing multiple sequences of the target enzyme family; The energy calculation is performed using the MMPBSA free energy decomposition tool and the motion trajectory of the enzyme and the target substrate or product complex under long-term molecular dynamics.

2. A glycosyltransferase mutant, characterized in that: The mutation site of the glycosyltransferase mutant is obtained by the calculation method for identifying candidate amino acid mutation sites of an enzyme according to claim 1; The glycosyltransferase mutant has any one or a combination of at least two of the following mutations based on the amino acid sequence of SEQ ID NO. 1: P84V, S195V, L85V, M88V or L379V.

3. A nucleic acid molecule, characterized in that The nucleic acid molecule contains the coding sequence of the glycosyltransferase mutant according to claim 2.

4. A recombinant vector, characterized in that The recombinant vector contains the nucleic acid molecule according to claim 3.

5. A recombinant cell, characterized in that The recombinant cell contains the nucleic acid molecule according to claim 3 and / or the recombinant vector according to claim 4.

6. A method for preparing the glycosyltransferase mutant according to claim 2, characterized in that: The preparation method comprises the following steps: (1) Calculating candidate mutation hotspots of glycosyltransferases using the calculation method for identifying candidate amino acid mutation sites of enzymes according to claim 1; (2) inserting the nucleic acid sequence SEQ ID NO.2 of the glycosyltransferase into a plasmid to obtain a recombinant plasmid, and using the recombinant plasmid as a template, performing site-directed saturation mutagenesis on any one or a combination of at least two of the 84th, 85th, 88th, 195th and 379th sites of the glycosyltransferase, wherein the nucleic acid sequence of the primer for the mutation at site 84 includes the sequences shown in SEQ ID NO.3 and SEQ ID NO.4, the nucleic acid sequence of the primer for the mutation at site 85 includes the sequences shown in SEQ ID NO.5 and SEQ ID NO.6, the nucleic acid sequence of the primer for the mutation at site 88 includes the sequences shown in SEQ ID NO.7 and SEQ ID NO.8, the nucleic acid sequence of the primer for the mutation at site 195 includes the sequences shown in SEQ ID NO.9 and SEQ ID NO.10, and the nucleic acid sequence of the primer for the mutation at site 379 includes the sequences shown in SEQ ID NO.11 and SEQ ID NO.12; (3) The mutant plasmid obtained in step (2) is transformed into a host bacterium, cultured and purified to obtain the glycosyltransferase mutant.

7. The method for preparing a glycosyltransferase mutant according to claim 6, wherein: The plasmid includes pETDuet-1; The host bacteria include Escherichia coli, Saccharomyces cerevisiae or Pichia pastoris.

8. Use of the glycosyltransferase mutant according to claim 2 in catalyzing a glycosyl transfer reaction.

9. The use according to claim 8, characterized in that The substrate for the glycosyl transfer reaction includes rebaudioside D.

10. A method for preparing rebaudioside M, characterized in that: The preparation method comprises: Water, sodium dihydrogen phosphate, sodium hydrogen phosphate, magnesium chloride, a glycosyl donor, rebaudioside D and the glycosyltransferase mutant according to claim 2 are mixed and reacted. After the reaction is completed, the product is purified to obtain the rebaudioside M.

Images