Module for avoiding path competition by mixed bacteria and its application

Through the co-culture of mixed bacteria and nitrogen source restriction strategies, the metabolic flux imbalance caused by path competition in steroid hormone synthesis is solved, and efficient synthesis and economical production of Δ4-steroids are achieved.

CN115851640BActive Publication Date: 2025-07-08TIANJIN UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202211731558.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-12-30
Publication Date
2025-07-08
Estimated Expiration
2042-12-30

AI Technical Summary

Technical Problem

In the prior art, during the synthesis of steroid hormones, metabolic flux flows to branch paths due to the sharing of multiple substrates between CYP17 and 3β-HSD, resulting in unnecessary accumulation of intermediate metabolites and imbalance of metabolic flux, making it difficult to efficiently synthesize Δ4-steroids.

Method used

The mixed bacterial co-culture strategy is adopted to express heterologous enzymes using different strains. By adjusting the initial inoculation ratio and nitrogen source restriction culture, path simplification and optimization of metabolic flux are achieved to avoid path competition.

Benefits of technology

实现了Δ4-类固醇的高效合成,提高了甾体化合物的生产效率和经济性,减少了发酵过程中的氮源投料量。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004031757700000121
    Figure BDA0004031757700000121
  • Figure BDA0004031757700000131
    Figure BDA0004031757700000131
  • Figure BDA0004031757700000132
    Figure BDA0004031757700000132
Patent Text Reader

Abstract

The present invention relates to the field of biotechnology, and particularly to a module for avoiding pathway competition by mixed bacteria and its application. Through a strategy of co-culturing mixed bacteria and using simple carbon sources as substrates, the present invention realizes the de novo synthesis of steroid compounds with multiple genes, long pathways, and complex reticular pathways. By using a strategy of linearizing the reticular pathway, pathway simplification is achieved and unwanted intermediate reactions / competing reactions are avoided. In the nitrogen source-limited culture strategy, the nitrogen source concentration in the culture medium is relatively low, reducing the amount of nitrogen source input during fermentation and making the fermentation more economical. In the co-culture system, the proportion of bacterial populations during fermentation can be adjusted by simply and easily changing the initial inoculation ratios of several strains. Since different bacterial populations contain different pathway components, it is possible to adjust the expression intensity of pathway components by adjusting the initial inoculation ratios.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and specifically relates to a module for avoiding pathway competition in mixed bacteria and its application. Background Art

[0002] Steroid hormones are a class of tetracyclic aliphatic hydrocarbons with a basic structure of cyclopentane polyhydrophenanthrene nucleus. There are many types of such compounds. Currently, more than 400 steroid drugs have been produced worldwide. With their anti-inflammatory, anti-allergic, endocrine-regulating and other effects, they have been widely used. By 2017, the global sales of steroid hormone drugs reached 100 billion US dollars, ranking as the second largest class of chemical drugs. The "pregnenolone-androstenedione" synthesis pathway composed of CYP17-3β-HSD is located at the intersection of the vertebrate steroid synthesis pathway, which contains key precursors of many steroid hormone drugs (pregnenolone, progesterone, 17-hydroxyprogesterone, 17-hydroxypregnenolone, DHEA, androstenedione, testosterone).

[0003] The development of the production process of steroid hormone intermediates has gone through stages such as plant extraction of saponin, chemical total synthesis, semi-synthesis, and new microbial synthesis methods. Plant extraction and microbial transformation are the main methods for producing steroid hormone drugs. However, the plant extraction method has high costs, limited sources, and environmental pollution problems. Chemical total synthesis of steroid molecules involves limitations such as long processes, complex reactions, and environmental pollution.

[0004] Compared with separating steroids from animal sources, microbial synthesis of steroids has a lower risk of virus / prion contamination. Microbial synthesis of steroids can also avoid the cumbersome reaction steps involved in chemical synthesis. In past studies, Saccharomyces cerevisiae, Escherichia coli, and Yarrowia lipolytica have all been applied to the research of pregnenolone or other steroid synthesis. In the experiment of Saccharomyces cerevisiae, de novo synthesis of pregnenolone and downstream product hydrocortisone from glucose as a substrate was achieved. Saccharomyces cerevisiae, Escherichia coli, and Yarrowia lipolytica achieved the biosynthesis of pregnenolone from biotransformation of sterol substrates. By introducing the P450scc catalytic system into Saccharomyces cerevisiae or Escherichia coli and adding the direct substrate sterol of the P450scc catalytic system to the culture environment, biotransformation of pregnenolone can be achieved. Feeding sterol substrates in the culture environment of a diploid chassis cell of Yarrowia lipolytica heterologously expressing the P450scc system and the P450c17 system can be used for biotransformation to synthesize pregnenolone or 17α-hydroxypregnenolone. However, the strong hydrophobicity of steroids, the poor robustness of commonly used microorganisms Mycobacterium, and the high sterilization cost result in low microbial transformation efficiency.

[0005] Synthetic biology provides a new method for microbial synthesis, enabling the artificial construction of functional microorganisms with heterologous synthesis pathways to produce steroid hormones with specific structures in a low-energy-consuming, efficient, and environmentally friendly manner. It can produce specific steroid compounds using only glucose, glycerol, etc. as the sole carbon source. In 1998, Catherine Duport et al. achieved the synthesis of campesterol by knocking out the endogenous gene erg5 in Saccharomyces cerevisiae and introducing the exogenous gene DHCR7, providing a precursor for the synthesis of pregnenolone. Subsequently, the bovine-derived P450scc catalytic system and 3β-HSD were introduced to achieve the de novo synthesis of progesterone using glucose as the substrate. In 2019, our research group constructed an engineered Yarrowia lipolytica strain for the de novo synthesis of pregnenolone based on a high-yield campesterol chassis through enzyme source screening and promoter co-ordination. In 2003, Florence Ménard Szczebara et al. knocked out ATF2 and introduced CYP17A1, CYP21A1, and CYP11B1 on the basis of a high-yield progesterone Saccharomyces cerevisiae chassis, successfully achieving the de novo synthesis of hydrocortisone. In 2019, patent US10400261B2 integrated multiple copies of the hydrocortisone pathway genes based on Saccharomyces cerevisiae to obtain a high-yield hydrocortisone strain.

[0006] Corticosteroids, androgens, and estrogen steroids have been widely used in the medical field. The synthesis of these downstream products in the animal steroid hormone synthesis pathway all requires the process of conversion to Δ 5- to Δ 4- type steroids (Δ 5- and Δ 4- : the double bonds of the enes located at positions 5, 6 and 4, 5 respectively), which takes pregnenolone (P5) as the substrate and is catalyzed synergistically by 3β-hydroxysteroid dehydrogenase (3β-hsd) and 17α-hydroxylase / 17,20-lyase (Cyp17). Among them, CYP17 takes Δ 5- and Δ 4- steroids as substrates for 17α-hydroxylation modification. At the same time, under the participation of cytochrome b5 (Cyb5), CYP17 will show stronger 17,20-lyase activity (cleavage of the C17-C20 bond), and CYP17 can act on; while 3β-HSD has isomerase activity and can convert Δ 5- steroids into the corresponding Δ 4- isomers, and achieve the migration of metabolic flux from the Δ 5- pathway to the Δ 4- pathway. However, in the process of synthesizing Δ 4- steroids using pregnenolone as the substrate, due to the sharing of multiple substrates between CYP17 and 3β-HSD, 17α-hydroxylation, 17,20-cleavage and Δ 5- Δ 4Isomerization does not occur strictly in sequence, which poses great challenges to the heterologous directed synthesis of the target Δ 4- steroid.

[0007] Similar case: Three recombinant Escherichia coli strains were used to split the rosmarinic acid synthesis pathway. Two of the strains were used to synthesize the precursors caffeic acid and salvianolic acid A respectively, and one strain could uptake extracellular caffeic acid and salvianolic acid A for the synthesis of rosmarinic acid.

[0008] Enzymes in the biosynthetic pathway sharing multiple substrates may cause the metabolic flux to flow into the branch pathway, resulting in the accumulation of unnecessary intermediate metabolites and the imbalance of metabolic flux. Therefore, analyzing and optimizing the Δ 4- steroid synthesis pathway is of crucial significance for the future biological production of downstream steroid drugs. Summary of the Invention

[0009] In view of this, the present invention provides a module for avoiding pathway competition by mixed bacteria and its application.

[0010] The present invention provides a module for avoiding pathway competition by mixed bacteria and its application. Through the co-culture strategy of mixed bacteria, using simple carbon sources as substrates, de novo synthesis of steroid compounds with multiple genes, long pathways, and complex reticular pathways is achieved. By using the strategy of linearizing the reticular pathway, the pathway is simplified and unwanted intermediate reactions / competing reactions are avoided. In the nitrogen source restricted culture strategy, the nitrogen source concentration in the culture medium is low, reducing the nitrogen source feeding amount during fermentation and making the fermentation more economical. In the co-culture system, the proportion of bacteria in the fermentation process is adjusted by simply changing the initial inoculation ratio of several strains. Since different bacterial populations contain different pathway components, it is possible to adjust the expression intensity of pathway components by adjusting the initial inoculation ratio.

[0011] To achieve the above-mentioned invention objectives, the present invention provides the following technical solutions:

[0012] The present invention provides the application of expressing any of the following items in the synthesis of steroid compounds and / or steroid hormone drugs:

[0013] (I), CYP17A1 and POR derived from Equus caballus, Ovis aries, Mesocricetus auratus or Xenopus laevis; and / or

[0014] (II), CYB5 derived from Equus caballus, Ovis aries or Mesocricetus auratus; and / or

[0015] (III), 3β-HSD derived from Bos taurus, Vaccinia virus, Arabidopsis thaliana, Mycobacterium tuberculosis or Homo sapiens (type II); and / or

[0016] (IV), mCYP11A1 derived from Sus scrofa.

[0017] In some specific embodiments of the present invention, the CYP17A1, POR, CYB5, 3β-HSD and / or mCYP11A1 are obtained by codon optimization and synthesized by adding Sequence 1 and / or Sequence 2;

[0018] The codon optimization is performed using Yarrowia lipolytica;

[0019] The 5' end is added to the Sequence 1, and the Sequence 1 includes:

[0020] (I), the nucleotide sequence shown in SEQ ID NO:1; or

[0021] (II), a nucleotide sequence that encodes the same protein as the nucleotide sequence shown in (I), but is different from the nucleotide sequence shown in (I) due to the degeneracy of the genetic code; or

[0022] (III), a nucleotide sequence obtained by substituting, deleting or adding one or more nucleotide sequences to the nucleotide sequence shown in (I) or (II), and having the same or similar function as the nucleotide sequence shown in (I) or (II); or

[0023] (IV), a nucleotide sequence having at least 80% sequence homology with the nucleotide sequence described in any one of (I) to (III);

[0024] The 3' end is added to the Sequence 2, and the Sequence 2 includes:

[0025] (I), the nucleotide sequence shown in SEQ ID NO:2; or

[0026] (II), a nucleotide sequence that encodes the same protein as the nucleotide sequence shown in (I), but is different from the nucleotide sequence shown in (I) due to the degeneracy of the genetic code; or

[0027] (III), a nucleotide sequence obtained by substituting, deleting or adding one or more nucleotide sequences to the nucleotide sequence shown in (I) or (II), and having the same or similar function as the nucleotide sequence shown in (I) or (II); or

[0028] (IV), a nucleotide sequence having at least 80% sequence homology with the nucleotide sequence described in any one of (I)-(III).

[0029] The present invention also provides a module, including any of the following expressions:

[0030] (I), CYP17A1 and POR derived from Equus caballus, Ovis aries, Mesocricetus auratus or Xenopus laevis; and / or

[0031] (II), CYB5 derived from Equus caballus, Ovis aries or Mesocricetus auratus; and / or

[0032] (III), 3β-HSD derived from Bos taurus, Vaccinia virus, Arabidopsis thaliana, Mycobacterium tuberculosis or Homo sapiens (type II); and / or

[0033] (IV), mCYP11A1 derived from Sus scrofa.

[0034] Based on the above research, the present invention also provides a plasmid, including the said expression element.

[0035] The present invention also provides a host, including the said plasmid.

[0036] In some specific embodiments of the present invention, the host includes one or more of Module 1, Module 2, Module 3, Module 4 or Module 5:

[0037] Module 1 includes: CYP17A1 and POR derived from Equus caballus, Ovis aries, Mesocricetus auratus or Xenopus laevis; Module 1 also includes IntD integration site and / or Leu2 tag with LoxP sites at both ends; and / or

[0038] Module 2 includes: CYB5 derived from Equus caballus, Ovis aries or Mesocricetus auratus; Module 2 also includes IntB integration site and / or Ura3 tag; and / or

[0039] Module 3 includes: 3β-HSD derived from Mus musculus, Bos taurus, Vaccinia virus, Arabidopsis thaliana, Mycobacterium tuberculosis or Homo sapiens (type II) and mCYP11A1 derived from Sus scrofa; the vector to which Module 3 is ligated includes pINA1269; and / or

[0040] Module 4 includes: CYP17A1 and POR derived from Ovis aries and Mesocricetus auratus; Module 4 further includes IntF integration site and / or Leu2 tag with LoxP sites at both ends;

[0041] Module 5 includes: CYP17A1 and POR derived from Equus caballus; Module 5 further includes IntF integration site and / or Leu2 tag with LoxP sites at both ends.

[0042] In some specific embodiments of the present invention, the construction of Module 1 includes: the left arm of the IntD integration site, splicing of terminator 1; splicing the terminal sequence of terminator 2, leucine auxotrophic selection tag Leu2 with LoxP sites at both ends, and the right arm of the IntD integration site to obtain IntD-L and IntD-R; ligating CYP17A1 and POR with the expression module digested by BsmBI, assembling the CYP17A1 and POR modules with the same species origin with pUC18H to obtain an integration plasmid, and obtaining Module 1 after digestion;

[0043] Terminator 1 is the GPM1t terminator of Saccharomyces cerevisiae; terminator 2 is the FBA1t of Saccharomyces cerevisiae;

[0044] The splicing method includes OE-PCR; the expression module includes TEF1inp-LIP2t-GPDt, GPDt-TEF1inp-OCT1t-FBA1t; pUC18H is pUC18H digested by IntD-L, IntD, and HincII; the assembly method includes Gibson; the digestion includes digestion with NotI;

[0045] The integration plasmid includes pIntD-Oa_CYP17-POR, pIntD-Ma_CYP17-POR, pIntD-Ec_CYP17-POR, pIntD-Xl_CYP17-POR.

[0046] In some specific embodiments of the present invention, the construction of Module 2 includes: integrating the left arm of the IntB integration site, a tag, the right arm of the IntB integration site, a promoter, and a terminator with the CYB5 respectively by splicing to obtain an integration plasmid, and obtaining Module 2 after digestion with enzymes;

[0047] The tag includes the auxotrophic uracil tag Ura3; the promoter includes TEF1in; the terminator includes ACOt; the method used for splicing includes Gibson; the digestion with enzymes includes digestion with NotI enzyme.

[0048] In some specific embodiments of the present invention, the construction of Module 3 includes: integrating the mCYP11A1 into the expression cassette with Promoter 1 respectively, integrating the 3β-HSD into the expression cassette with Promoter 2 respectively, and assembling the mCYP11A1 expression cassette and the 3β-HSD expression cassette into the pINA1269 integration plasmid after digestion with enzymes, and finally linearizing the plasmid after digestion with NotI to obtain Module 3;

[0049] The Promoter 1 includes TEF1p; the Promoter 2 includes EXP1p; the method used for assembly includes Gibson; the enzymes used for digesting pINA1269 include SalI and ClaI.

[0050] In some specific embodiments of the present invention, the construction of Module 4 includes: integrating the left arm of the IntF integration site, pUC18H, the leucine nutritional selection tag Leu2 with LoxP sites at both ends, the right arm of the IntD integration site, the CYP17A1 and POR modules by splicing to obtain a fragment containing restriction enzyme sites at both ends, and obtaining Module 4 after digestion with enzymes;

[0051] The pUC18H is pUC18H digested with HincII; the method used for splicing includes Gibson; the restriction enzyme sites include NotI; the digestion with enzymes includes digestion with NotI enzyme.

[0052] In some specific embodiments of the present invention, the construction of Module 5 includes: integrating the left arm of the IntF integration site, pUC18H, the leucine nutritional selection tag Leu2 with LoxP sites at both ends, the right arm of the IntF integration site, the CYP17A1 and POR by splicing to obtain a fragment containing NotI restriction enzyme sites at both ends, and obtaining Module 5 after digestion with NotI;

[0053] The pUC18H is pUC18H digested with HincII; the method used for splicing includes Gibson.

[0054] In some specific embodiments of the present invention, the host further includes an upstream module and a downstream module;

[0055] The upstream module includes the Module III;

[0056] The downstream module includes one or more of the Module I, the Module I with the Leu2 selection marker knocked out, the Module II, the Module IV, or the Module V.

[0057] In some specific embodiments of the present invention, the construction of the upstream module includes: mCYP11A1 is expressed under Promoter 1, 3β-HSD is expressed under Promoter 2, and both are integrated into the pBR322 site at the same time; Promoter 1 includes TEF1p; Promoter 2 includes EXP1p;

[0058] The construction of the downstream module includes: CYP17A1 and POR are both expressed under a promoter and integrated into the IntD site of the chassis strain genome; the promoter includes TEF1inp; the chassis strain includes the high-yield ergosterol-producing Yarrowia lipolytica chassis strain SyBE_Yl2060077 and / or the wild-type Yarrowia lipolytica strain ATCC201249.

[0059] The present invention also provides the use of any of the following in the synthesis of steroid compounds and / or steroid hormone drugs:

[0060] (I), the expression element as described in claim 2; and / or

[0061] (II), the plasmid as described in claim 3; and / or

[0062] (III), the host as described in any one of claims 4 to 6.

[0063] In some specific embodiments of the present invention, the steroid compounds and / or steroid hormone drugs include progesterone, pregnenolone, 17-hydroxypregnenolone, 17-hydroxyprogesterone, androstenedione, and / or testosterone;

[0064] The synthesis of progesterone includes culturing a host expressing the Module III;

[0065] The synthesis of pregnenolone includes:

[0066] (I), culturing a host expressing the Module III and a host co-expressing the Module I and the Module II; and / or

[0067] (II), culturing a host expressing the Module I and a host co-expressing the Module I, the Module II, and the Module III; and / or

[0068] (III) Cultivate the host co-expressing Module 1 and Module 2 and the host co-expressing Module 1, Module 2, and Module 3; and / or

[0069] (IV) Cultivate the host expressing Module 3 and the host co-expressing Module 1, Module 2, and Module 3; and / or

[0070] (V) Cultivate the host co-expressing Module 3, Module 2, and Module 3 and the host expressing Module 3; and / or

[0071] (VI) Cultivate the host expressing Module 1, the host co-expressing Module 1 and Module 2, and the host expressing Module 3;

[0072] The 17 - hydroxyprogesterone de novo synthesis pathway includes:

[0073] (I) Cultivate the host expressing Module 1 and the host expressing Module 3; and / or

[0074] (II) Cultivate the host expressing Module 1 and the host co-expressing Module 3 and Module 1; and / or

[0075] (III) Cultivate the host expressing Module 3 and the host expressing Module 1; and / or

[0076] (IV) Cultivate the host co-expressing Module 3 and Module 2 and the host expressing Module 1; and / or

[0077] (V) Cultivate the host co-expressing Module 3 and Module 1;

[0078] The synthesis of androstenedione and / or testosterone includes: co-culturing the host expressing Module 3 and the host co-expressing Module 1 and Module 2;

[0079] Module 3 includes 3β - HSD; Module 1 includes CYP17A1, POR; Module 2 includes CYB5;

[0080] In some specific embodiments of the present invention, the source of 3β - HSD includes Mus musculus, Bostaurus, Vaccinia virus, Arabidopsis thaliana, Mycobacterium tuberculosis, or Homo sapiens (type II);

[0081] The source of CYP17A1, POR includes Equus caballus, Ovis aries, Mesocricetus auratus, or Xenopus laevis;

[0082] The CYB5 source includes Equus caballus, Ovis aries or Mesocricetus auratus.

[0083] In some specific embodiments of the present invention, the host includes those containing Module 1

[0084] Strains SyBE_Yl2091001 to SyBE_Yl2091004 and strains SyBE_Yl2091005 to SyBE_Yl2091016 in which Module 2 is respectively integrated into the strains SyBE_Yl2091001 to SyBE_Yl2091004.

[0085] In some specific embodiments of the present invention, the host further includes an upstream module strain and a downstream module strain;

[0086] The upstream module strain includes SyBE_Yl2091025 to SyBE_Yl2091028 and SyBE_Yl2090006 containing Module 3, which are obtained by integrating Module 3 into the high-yield campesterol-producing Yarrowia lipolytica chassis strain SyBE_Yl2060077; the downstream module strain includes SyBE_Yl2091006 and SyBE_Yl2091016 containing Module 1 and Module 2, and the strain SyBE_Yl2091030 containing Module 5, Module 2, and Module 1 with the Leu2 selection marker knocked out; the SyBE_Yl2091006 and SyBE_Yl2091016 are obtained by integrating Module 1 and Module 2 into the wild-type Yarrowia lipolytica strain ATCC201249; the SyBE_Yl2091030 is obtained by integrating Module 5 and Module 2 derived from Equus caballus with SyBE_Yl2091004 with the Leu2 selection marker knocked out.

[0087] In some specific embodiments of the present invention, progesterone is obtained by culturing the strains SyBE_Yl2091025 to SyBE_Yl2091028 and SyBE_Yl2090006 alone.

[0088] In some specific embodiments of the present invention, the strains SyBE_Yl2091025 and SyBE_Yl2091006 are co-cultured, and 17-hydroxy pregnenolone, androstenedione are the main products, synthesizing 0.74 mg / L of 17-hydroxy pregnenolone, 0.25 mg / L of 17-hydroxy progesterone, 0.88 mg / L of androstenedione, and 0.32 mg / L of testosterone.

[0089] In some specific embodiments of the present invention, SyBE_Yl091025 and SyB2E_Yl2091016 are co-cultured; with 17-hydroxyprogesterone and androstenedione as the main products, 0.91 mg / L of 17-hydroxyprogesterone, 0.29 mg / L of 17-hydroxypregnenolone, 1.03 mg / L of androstenedione, and 0.34 mg / L of testosterone are synthesized.

[0090] In some specific embodiments of the present invention, Module 3 in SyBE_Yl2091025 is derived from Bostaurus; Module 1 and Module 2 in SyBE_Yl2091006 are derived from Mesocricetus auratus; Module 1 and Module 2 in SyBE_Yl2091016 are derived from Ovis aries.

[0091] In some specific embodiments of the present invention, SyBE_Yl2091025 and SyBE_Yl2091030 are co-cultured, with androstenedione as the main product, and 5.02 mg / L of androstenedione and 1.09 mg / L of testosterone are synthesized.

[0092] The present invention also provides the application of any of the following in improving steroid compounds and / or steroid hormone drugs:

[0093] (I), improving the inoculation ratio of the host; and / or

[0094] (II), adjusting the carbon-nitrogen ratio;

[0095] The inoculation ratio of the host includes 1:5 to 60:1; the carbon-nitrogen ratio includes 6.5:1 to 100:1 and / or when the fixed carbon-nitrogen ratio C / N includes 24:1 to 73:1, the carbon-nitrogen supply is increased in equal proportion;

[0096] Preferably, the inoculation ratio includes 1:5 to 50:1; the carbon-nitrogen ratio includes 6.5:1 to 73:1.

[0097] In some specific embodiments of the present invention, the steroids include: pregnenolone, progesterone, 17-hydroxyprogesterone, 17-hydroxypregnenolone, dehydroepiandrosterone, androstenedione, and / or testosterone.

[0098] In some specific embodiments of the present invention, when the inoculation ratio is preferably 30:1, the content of androstenedione is 6.92 mg / L.

[0099] In some specific embodiments of the present invention, when the carbon-nitrogen ratio is preferably 37:1 to 49:1, the content of androstenedione is 7.71 ± 0.21 mg / L; when the carbon-nitrogen ratio is preferably 37:1, the content of testosterone is 1.80 mg / L.

[0100] In some specific embodiments of the present invention, when the carbon-nitrogen ratio is 24:1, the yield of 4AD per unit cell increases by 28.3%, the biomass decreases by 52.6%, and the total yield of androstenedione is 3.70 mg / L;

[0101] When the carbon-nitrogen ratio is 37:1, the yield of 4AD per unit cell increases by 1.8 times, and the biomass decreases by 26.3%;

[0102] When the carbon-nitrogen ratio is 24:1, the yield of androstenedione is the lowest.

[0103] In some specific embodiments of the present invention, the culture medium used to adjust the carbon-nitrogen ratio includes YPD fermentation medium, NLM fermentation medium, 1.5-NLM fermentation medium, 2-NLM fermentation medium, and / or 3-NLM fermentation medium;

[0104] The carbon-nitrogen ratio C / N of the YPD fermentation medium is 6.5:1; the formula of the YPD fermentation medium includes 50 g / L glucose, 20 g / L peptone, and / or 10 g / L yeast extract;

[0105] The carbon-nitrogen ratio C / N of the NLM fermentation medium is 73:1; the formula of the NLM fermentation medium includes 50 g / L glucose, 1.7 g / L YNB, 1 g / L ammonium sulfate, and / or 1.7 g / L yeast extract; the YNB contains no amino acids and / or ammonium sulfate;

[0106] The carbon-nitrogen ratio C / N of the 1.5-NLM fermentation medium is 49:1; the formula of the 1.5-NLM fermentation medium includes 50 g / L glucose, 1.7 g / L YNB, 1.5 g / L ammonium sulfate, and / or 2.25 g / L yeast extract; the YNB contains no amino acids and / or ammonium sulfate;

[0107] The carbon-nitrogen ratio C / N of the 2-NLM fermentation medium is 37:1; the formula of the 2-NLM fermentation medium includes 50 g / L glucose, 1.7 g / L YNB, 2 g / L ammonium sulfate, and / or 3 g / L yeast extract; the YNB contains no amino acids and / or ammonium sulfate;

[0108] The carbon-nitrogen ratio C / N of the 3-NLM fermentation medium is 24:1; the formula of the 3-NLM fermentation medium includes 50 g / L glucose, 1.7 g / L YNB, and / or 3 g / L ammonium sulfate, 4.5 g / L yeast extract; the YNB contains no amino acids and / or ammonium sulfate.

[0109] The present invention also provides a method for synthesizing steroid compounds and / or steroid hormone drugs. Take the host, culture it, and collect the culture.

[0110] In some specific embodiments of the present invention, the synthesis of the steroid compound and / or steroid hormone drug includes the synthesis of progesterone, pregnenolone, 17-hydroxypregnenolone, 17-hydroxyprogesterone, androstenedione, and / or testosterone;

[0111] The synthesis of the progesterone includes culturing a host expressing the module three;

[0112] The synthesis of the pregnenolone includes:

[0113] (I), culturing hosts expressing a and b respectively; and / or

[0114] (II), culturing hosts expressing c and d respectively; and / or

[0115] (III), culturing hosts expressing b and d respectively; and / or

[0116] (IV), culturing hosts expressing a and d respectively; and / or

[0117] (Ⅴ), culturing hosts expressing a, b, and a respectively; and / or

[0118] (Ⅵ), culturing hosts expressing c, b, and a respectively;

[0119] The de novo synthesis pathway of the 17-hydroxyprogesterone includes:

[0120] (I), culturing hosts expressing c and a respectively; and / or

[0121] (II), culturing hosts expressing c and e respectively; and / or

[0122] (III), culturing hosts expressing a and c respectively; and / or

[0123] (IV), culturing hosts expressing f and c respectively; and / or

[0124] (Ⅴ), culturing a host expressing e; and / or

[0125] The synthesis of the androstenedione and / or testosterone includes: co-culturing hosts expressing a and b respectively;

[0126] The a includes 3β-HSD; the b includes CYP17A1, POR, and / or CYB5; the c includes CYP17A1 and POR; the d includes 3β-HSD, CYP17A1, POR, and / or CYB5; the e includes 3β-HSD, CYP17A1, and POR; the f includes 3β-HSD and / or CYB5;

[0127] The method further includes any of the following:

[0128] (I) One or more of the first module, the second module, the third module, the fourth module, or the fifth module are expressed in the same space;

[0129] (II) One or more of the first module, the second module, the third module, the fourth module, or the fifth module are respectively expressed in multiple spaces;

[0130] The space includes strains, cells, and / or organelles;

[0131] The multiple includes two and / or more than two.

[0132] In some specific embodiments of the present invention, the source of 3β-HSD includes Mus musculus, Bostaurus, Vaccinia virus, Arabidopsis thaliana, Mycobacterium tuberculosis, or Homo sapiens (type II);

[0133] The sources of CYP17A1 and POR include Equus caballus, Ovis aries, Mesocricetus auratus, or Xenopus laevis;

[0134] The source of CYB5 includes Equus caballus, Ovis aries, or Mesocricetus auratus.

[0135] Specifically, the present invention provides a method for synthesizing steroid compounds and / or steroid hormone drugs, which includes: inoculating the host in a seed medium for cultivation, inoculating with an initial cell concentration in a YPD fermentation medium for cultivation, and monitoring the yield.

[0136] In some specific embodiments of the present invention, the formula of the seed medium includes 20 g / L glucose, 20 g / L peptone, and / or 10 g / L yeast extract powder; the cultivation temperature of the seed medium is 30 °C, the rotation speed is 220 rpm, and the time is 14 - 16 h; the initial cell concentration is OD 600 = 0.1; the formula of the YPD fermentation medium includes 50 g / L glucose, 20 g / L peptone, and / or 10 g / L yeast extract powder; the cultivation temperature of the YPD fermentation medium is 28 °C, the rotation speed is 220 rpm, and the time is 8 days;

[0137] The quantification method of pregnenolone and / or campesterol includes taking the cultivated host, centrifuging, resuspending, boiling, adding a saponification reaction solution for reaction, adding an extraction solvent, concentrating, and detecting;

[0138] The centrifugation speed is 12,000 g and the centrifugation time is 2 min; the solution used for resuspension is hydrochloric acid; the concentration of the hydrochloric acid is 3 mol / L; the boiling temperature is 100 °C; the saponification reaction solution is a potassium hydroxide-methanol solution; the concentration of the potassium hydroxide-methanol solution is 2 mol / L; the extraction solvent is n-hexane; the concentration is carried out using a vacuum centrifugal concentrator; the concentration temperature is 25 °C, the time is 30 min, and the rotation speed is 7,000 rpm;

[0139] The method for quantifying progesterone, 17-hydroxy pregnenolone, 17-hydroxyprogesterone, dehydroepiandrosterone or androstenedione includes: taking the cultured host, adding glass beads and an extraction solvent, concentrating, and detecting;

[0140] The extraction solvent is ethyl acetate; the concentration temperature is 25 °C, the time is 1,200 min, and the rotation speed is 7,000 rpm.

[0141] In some specific embodiments of the present invention, the preferred sources of module three for progesterone synthesis preferably include Vacciniavirus, Homo sapiens (type II) and / or Bos taurus.

[0142] The present invention provides a method for 17-hydroxylation conversion: inoculating the host containing the module one into a seed medium for culture, inoculating it into a conversion medium at the initial cell concentration for further culture, adding a progesterone substrate mother liquor for incubation, and detecting the content.

[0143] The present invention provides a method for 17,20-lysis conversion: inoculating the host containing the module one and the module two into a seed medium for culture, inoculating it into a conversion medium at the initial cell concentration for culture, adding a 17-hydroxyprogesterone substrate mother liquor for incubation, and detecting the content.

[0144] In some specific embodiments of the present invention, the culture temperature of the seed medium is 30 °C, the rotation speed is 220 rpm, and the time is 14 - 16 h; the initial cell concentration is OD 600 = 0.1; the formula of the conversion medium includes 20 g / L glucose, 20 g / L peptone and / or 10 g / L yeast extract powder; the culture temperature of the conversion medium is 28 °C, the rotation speed is 220 rpm, and the time is 24 h; the concentration of the progesterone substrate mother liquor is 1.75 g / L (50% EtOH-Tween80); the concentration of the 17-hydroxyprogesterone solution is 1.75 g / L (50% EtOH-Tween80); the incubation time is 120 h.

[0145] In some specific embodiments of the present invention, the synthesis of 17 - hydroxyprogesterone includes Module One, Module Two, and Module Three; the sources of Module One and Module Two preferably include Ovis aries; the source of Module Three preferably includes Bos taurus; the yield of 17 - hydroxyprogesterone is 0.91 mg / L.

[0146] In some specific embodiments of the present invention, the synthesis of 17 - hydroxypregnenolone includes Module One, Module Two, and Module Three; the sources of Module One and Module Two preferably include Mesocricetus auratus; the source of Module Three preferably includes Bos taurus; the yield of 17 - hydroxypregnenolone is 0.74 mg / L.

[0147] The present invention provides a method for synthesizing androstenedione by mixed bacteria: inoculating the host containing the upstream module and the host containing the downstream module into a seed medium for cultivation respectively, inoculating them into a YPD fermentation medium for cultivation according to the OD 600 ratio respectively, and measuring the steroid yield; the OD 600 ratio is 10:1.

[0148] In some specific embodiments of the present invention, the upstream module host includes Module Three; the source of Module Three preferably includes Bos taurus; the downstream module host includes one or more of Module One, Module One with the Leu2 selection marker knocked out, Module Two, or Module Five.

[0149] In some specific embodiments of the present invention, the synthesis of androstenedione and / or testosterone includes Module Five, Module Two, and Module One; the source of Module Two preferably includes Equus caballus; the source of Module One preferably includes Ovisaries with the Leu2 selection marker knocked out; the yield of androstenedione is 5.02 mg / L, and the yield of testosterone is 1.09 mg / L.

[0150] The present invention provides a module for mixed bacteria to avoid pathway competition and its application. Taking the de novo synthesis of testosterone from androstenedione in Yarrowia lipolytica as an example, the present invention provides a method for realizing the de novo synthesis of Δ4 - steroids in yeast strains using a mixed bacteria strategy. This method is applicable to the biosynthesis of other steroid molecules based on Δ4 - steroids as substrates, and can also be used for the optimization of various enzyme coupling systems involving multiple common substrates in microbial synthesis. BRIEF DESCRIPTION OF THE DRAWINGS

[0151] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for description in the embodiments or the prior art.

[0152] Figure 1Shows the route design for the synthesis of androstenedione by mixed bacteria in Example 1;

[0153] Figure 2 Shows the test of the effect of 3β-HSD from different sources on the synthesis of progesterone in recombinant yeast in Example 1;

[0154] Figure 3 Shows the yield of androstenedione synthesized by mixed bacteria in Example 1; among them, the left side of the figure shows

[0155] The yield of androstenedione synthesized by the mixed bacteria SyBE_Yl2091025-SyBE_Yl20910016; the right side of the figure shows the yield of androstenedione synthesized by the mixed bacteria SyBE_Yl2091025-SyBE_Yl2091006;

[0156] Figure 4 Shows the efficiency of catalyzing 17α-hydroxylation and 17,20-lysis by CYP17A1 and CYB5 components from different sources in Example 2 using biotransformation; among them, the left figure shows the efficiency of catalyzing 17α-hydroxylation with P4 as the substrate; the right figure shows the efficiency of catalyzing 17,20-lysis with 17OHP4 as the substrate;

[0157] Figure 5 Shows the yield of 4AD synthesized by mixed bacteria in Example 2; among them, the left side of the figure shows

[0158] The yield of 4AD synthesized by the mixed bacteria SyBE_Yl2091025-SyBE_Yl2091016, and the right side shows:

[0159] The yield of 4AD synthesized by the mixed bacteria SyBE_Yl2091025-SyBE_Yl2091030;

[0160] Figure 6 Shows the 4AD synthesis efficiency at different mixed bacteria ratios in Example 3;

[0161] Figure 7 Shows the steroid synthesis patterns under different media in Example 4;

[0162] Figure 8 Shows the growth of mixed bacteria cells and the 4AD synthesis efficiency under different carbon-nitrogen ratios of the media in Example 4. Detailed implementation manners

[0163] The present invention discloses a module for avoiding pathway competition by mixed bacteria and its applications. Those skilled in the art can draw on the content of this article and appropriately improve process parameters to achieve the same. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are all considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments. It is obvious that relevant personnel can make changes or appropriate alterations and combinations to the methods and applications described herein without departing from the content, spirit, and scope of the present invention to implement and apply the technology of the present invention.

[0164] Taking the de novo synthesis of androstenedione and testosterone in Yarrowia lipolytica as an example, the present invention provides a method for de novo synthesizing △ 4- steroids by using a mixed-bacteria strategy in yeast strains, which is applicable to the biosynthesis of other steroid-based steroidal molecules and can also be used for the optimization of various enzyme-coupled systems involving multiple common substrates in microbial synthesis. 4- Specifically, the present invention uses a mixed-bacteria strategy to split and simplify the synthesis pathway for multi-enzyme pathways of common substrates to avoid pathway competition reactions, (2) screening and combining the sources of key enzymes, (3) using a nitrogen-source limitation strategy to improve the product synthesis efficiency, and (4) obtaining the corresponding target products through the combination of different pathway module strains. Through the combined optimization of the above methods, the efficient synthesis of specific target steroids in the microbial system is achieved.

[0165] Briefly speaking, the present invention uses a mixed-bacteria strategy to split and simplify the synthesis pathway for multi-enzyme pathways of common substrates to avoid pathway competition reactions, (2) screening and combining the sources of key enzymes, (3) using a nitrogen-source limitation strategy to improve the product synthesis efficiency, and (4) obtaining the corresponding target products through the combination of different pathway module strains. Through the combined optimization of the above methods, the efficient synthesis of specific target steroids in the microbial system is achieved.

[0166] As an unconventional yeast, Yarrowia lipolytica has the following advantages in steroid synthesis: (1) Its genomic sequence is known, it can be genetically manipulated, and it has strong proliferation ability, which is beneficial for metabolic engineering and large-scale production. (2) Acetyl-CoA, as a precursor for steroid synthesis, has a high metabolic flux in Yarrowia lipolytica, which is beneficial for steroid synthesis. (3) After metabolic engineering, this species has a high heterologous protein expression level. At the same time, compared with Saccharomyces cerevisiae, the post-transcriptional glycosylation modification of its cells is closer to that of mammalian cells, which is beneficial for the expression of mammalian-derived proteins and thus the synthesis of animal-derived steroids. (4) It has GRAS (generally regarded as safe) level of safety and can be considered as a chassis for drug synthesis. (5) Yarrowia lipolytica has a wide substrate spectrum and can use oils as substrates in addition to glucose. Therefore, it can use industrial by-products and waste to produce target products. (6) When Yarrowia lipolytica uses oil as a carbon source, the intracellular lipid accumulation will cause the lipid droplets to become larger, providing storage space for storing non-polar products (such as steroids) and facilitating the reduction of the burden on cells caused by product accumulation. (7) Compared with the traditional host Saccharomyces cerevisiae for heterologous steroid synthesis, Yarrowia lipolytica does not have a homologous gene of ATF2 (alcohol O-acetyltransferase), which will cause steroid esterification in Saccharomyces cerevisiae and hinder the further biotransformation of steroids in cells.

[0167] In order to solve the accumulation of branched pathways, the commonly used methods are: ① knocking out or inhibiting key genes in the competitive pathway, ② shortening the physical distance of key proteins in the pathway that needs to enhance flux by connecting peptides or protein scaffolds, and ③ organelle localization strategy (Subcellular compartmentalization). Using signal peptide sequences, the enzymes in the pathway are distributed in different organelles within a single cell, and the cell membrane system is used to change the availability of common substrates to different enzymes to achieve competitive pathway inhibition. ④ Mixed bacteria strategy (co-culture). The enzymes of the competitive substrates in the pathway are expressed in different strains, and multiple engineered bacteria are mixed and cultured. During the culture process, intermediates in the pathway that are easily expelled and absorbed by the strains will be transferred and modified by different strains, and the pathway can be redirected. The common feature of schemes ③ and ④ is to use the cell membrane system to isolate the competing enzyme components and precursors to avoid fierce competition between pathways. Due to its modular characteristics, the mixed bacteria co-culture strategy has the following advantages: (1) As a modular system at the cellular level, it can effectively avoid enzymes from being mistakenly targeted to non-target modules after transcription, thereby achieving precise path segmentation in physical space; (2) Multiple enzymes in the path are expressed in different cells, which can effectively alleviate the metabolic burden of heterologous protein expression on a single strain; (3) Compared with time-consuming and labor-intensive iterative gene editing, the mixed bacteria strategy allows the metabolic flux between modules to be balanced by simply adjusting the ratio between engineered bacteria. 4- In steroid biosynthesis, multiple substrates are shared by pathway reactions, and the complexity of the pathway increases accordingly.

[0168] This study used a mixed bacterial strategy to segment the androstenedione biosynthesis pathway at the cellular level and successfully diverted the metabolic flux to △ 4- Steroid synthesis, and achieve different targets by switching between different modules△ 4- Synthesis of steroids.

[0169] The purpose of the present invention is to overcome the deficiencies in the prior art and provide a method for heterologous synthesis of △ 4- A mixed bacteria strategy for steroids and complex steroids with steroids as intermediates. A second object of the present invention is to provide an optimization strategy for a multi-substrate competition pathway. The present invention uses the synthesis of androstenedione from glucose as an example to construct a co-culture system of Yarrowia lipolytica.

[0170] The present invention provides the following:

[0171] 1. The present invention expresses different pathway elements in two strains to achieve pathway segmentation. Alternative solutions include: ① expressing different pathway elements in different organelles of the same strain to achieve pathway segmentation. ② expressing different pathway elements in multiple (≥2) strains to achieve pathway segmentation.

[0172] 2. (For de novo synthesis of androstenedione), the present invention expresses "pregnenolone de novo synthesis pathway - 3β - HSD" and "CYP17A1, POR, CYB5" in two modules respectively. Similar effects can also be achieved when the pathway components are redistributed. For example: ① Express "pregnenolone de novo synthesis pathway - CYP17A1, POR, CYB5" and "3β - HSD" in two modules respectively. ② Express "pregnenolone de novo synthesis pathway - CYP17A1, POR", "3β - HSD, CYP17A1, POR, CYB5" in two modules respectively. ③ Express "pregnenolone de novo synthesis pathway - CYP17A1, POR, CYB5" and "CYP17A1, POR, CYB5, 3β - HSD" in two modules respectively. ④ Express "pregnenolone de novo synthesis pathway - 3β - HSD", "CYP17A1, POR, CYB5, 3β - HSD" in two modules respectively. ⑤ Express "pregnenolone de novo synthesis pathway - 3β - HSD"

[0173] "CYP17A1, POR, CYB5" and "3β - HSD" in three modules respectively. ⑥ Express "pregnenolone de novo synthesis pathway - CYP17A1, POR", "CYP17A1, POR, CYB5", "3β - HSD" in three modules respectively.

[0174] 3. (For de novo synthesis of 17 - hydroxyprogesterone), possible methods are: ① Express "pregnenolone de novo synthesis pathway - CYP17A1, POR" and "3β - HSD" in two modules respectively. ② Express "pregnenolone de novo synthesis pathway - CYP17A1, POR", "3β - HSD, CYP17A1, POR" in two modules respectively. ③ Express "pregnenolone de novo synthesis pathway - 3β - HSD" and "CYP17A1, POR" in two modules respectively. ④ Express "pregnenolone de novo synthesis pathway - 3β - HSD, CYB5", "CYP17A1, POR" in two modules respectively. ⑤ Express "pregnenolone de novo synthesis pathway - CYP17A1, POR, 3β - HSD" in the same strain.

[0175] 4. (For adjusting nitrogen source content to enhance steroid synthesis), possible methods are: ① Based on the formula of nitrogen - limited medium (NLM) in Example 4, add amino acid powder additionally to enhance steroid synthesis. ② Under the condition of nitrogen - limited medium (carbon - nitrogen ratio C / N = 24:1 - 73:1), fix the carbon - nitrogen ratio and increase the supply of carbon and nitrogen sources in the medium proportionally to enhance steroid synthesis.

[0176] The recombinant strains and plasmids involved in the present invention are shown in Table 1 and Table 2:

[0177] Table 1: Recombinant Yarrowia lipolytica strains

[0178]

[0179]

[0180]

[0181] Table 2 Plasmids

[0182]

[0183]

[0184]

[0185] Ss_mCYP11A1 (SEQ ID NO: 3):

[0186]

[0187] Oa_CYP17A1 (SEQ NO: 4):

[0188]

[0189] Ma_CYP17A1 (SEQ NO: 5):

[0190]

[0191] Ec_CYP17A1 (SEQ NO: 6):

[0192]

[0193] Xl_CYP17A1 (SEQ NO: 7):

[0194]

[0195] Oa_POR (SEQ NO: 8):

[0196]

[0197] Ma_POR (SEQ NO: 9):

[0198]

[0199] Ec_POR (SEQ NO: 10):

[0200]

[0201] Xl_POR (SEQ NO: 11):

[0202]

[0203] Oa_CYB5 (SEQ NO: 12):

[0204] ATGGCCGAGGAGTCTAGTAAACCAGTCAAGTACTACACCCTAGAGGAAATCCAGAAGCACAACCACAGCAAATCGACCTGGCTGATTCTGCACTACAAGGTCTACGACCTCACAAAGTTCCTGGAAGAGCACCCGGGAGGAGAGGAGGTGCTTAGAGAGCAGGCTGGTGGTGATGCAACTGAGAACTTTGAGGACGTTGGCCATTCAACGGATGCCCGAGAACTTAGCAAGACCTTCATCATTGGCGAGCTGCATCCCGACGACCGGTCCAAGATCACCAAGCCCTCTGAGTCCATCATCACAACTATTGACTCCAACTCGTCGTGGTGGACCAACTGGCTCATTCCTGCCATTTCTGCTCTGGTGGTTGCGCTCATGTACCATTTGTATACTTCTGAAAATTAA

[0205] Ma_CYB5 (SEQ NO: 13):

[0206] ATGGCCGGCCAGGCAGACAAGGATGTCAAATACTATACGTTGGAAGAAATCCAGAAGCACAAAGACTCCAAGTCTACGTGGGTCATTCTTCACCACAAGGTCTACGACCTGACCAAGTTTCTGGAGGAACATCCCGGTGGCGAGGAGGTACTTCGGGAGCAGGCTGGAGGAGATGCCACCGAGAACTTTGAGGATGTGGGCCACTCGACCGACGCTCGAGAGCTCTCAAAGACATTCATCATTGGAGAGCTGCATCCTGACGACCGCAGCAAGATTGCCAAGCCCAGCGAGAGTCTCATCACCACTGTGGAGTCCAACTCCTCTTGGTGGACCAACTGGGTTATTCCGGCAGTTTCTGCGCTGGCCGTGGCTCTGATGTACCGACTCTACATGGGCAGACGACTGACCTGTTTCTCGAAACCTGGAACAGGGGAGGGTCTGCCCCAACGACGAGGTGAAAAGAAGCCTGTGTTGATCACTTCGGCCGATAGAAATCTACCACTTAAGGGCAAGTAA

[0207] Ec_CYB5(SEQ NO: 14):

[0208] ATGGCCGAGCAGAGCGACAAGGCAGTCAAGTACTACACCCTCGAAGAGATCAAGAAGCACAACCACTCGAAATCTACCTGGCTGATTCTGCACCACAAGGTCTATGACCTCACCAAGTTCCTGGAGGATCATCCAGGAGGAGAGGAGGTGCTTCGAGAACAGGCTGGTGGTGATGCCACAGAGAACTTTGAGGATATTGGCCATTCTACAGACGCGAGAGAACTTAGTAAAACGTTCATCATCGGCGAGCTGCATCCCGACGACCGGTCCAAGATTGCCAAGCCCGTGGAGACTTTGATCACCACTGTGGACTCCAATTCATCGTGGTGGACCAACTGGGTCATTCCTGCCATTTCTGCTGTAGTTGTTGCTCTCATGTACCGAATCTACACTGCAGAAGATTAA

[0209] Ss_CYB (SEQ NO: 15):

[0210] ATGGCCGAGCAGTCCGACAAGGCCGTCAAGTACTACACCCTGGAGGAGATCCAGAAGCACAACAACTCCAAGTCCACCTGGCTGATCCTGCACCACAAGGTCTACGACCTGACCAAGTTCCTGGAGGAGCACCCCGGCGGTGAGGAGGTCCTGCGAGAGCAGGCCGGCGGTGACGCTACCGAGAACTTCGAGGACGTCGGCCACTCCACCGACGCCCGAGAGCTGTCCAAGACCTTTATCATTGGCGAGCTCCACCCCGACGACCGATCCAAGATCGCCAAGCCCTCCGAGACTCTGATCACCACCGTCGAGTCCAACTCCTCCTGGTGGACCAACTGGGTCATCCCCGCCATCTCCGCCCTGGTTGTCTCCCTGATGTACCACTTCTACACCTCCGAGAACTAA

[0211] Hs_3β-HSD2 (L236S) (SEQ NO: 16):

[0212]

[0213] Hs_3β-HSD2 (SEQ NO: 17):

[0214]

[0215] Hs_3β-HSD1 (SEQ NO: 18):

[0216]

[0217] Hs_3β-HSD1(L237S) (SEQ NO: 19):

[0218]

[0219] Mm_3β-HSD (SEQ NO: 20):

[0220]

[0221] At_3β-HSD (SEQ NO: 21):

[0222] ATGGCCGCTCCCGACTCTTCCATCAACAACCACCAGCTGCAGTACTCTGTGAACGTCCAGGGAACCCAGAACGTCATCGACGCTTGTGTGGACGTCGGTGTGAAGCGACTGATCTACACCTCTTCCCCCTCTGTGGTCTTCGACGGCGTGCACGGAATCCTGAACGGCACCGAGTCCATGGCTTACCCCATTAAGCACAACGACTCTTACTCCGCTACCAAGGCCGAGGGAGAGGAGCTGATTATGAAGGCCAACGGTCGAAACGGCCTGCTGACCTGTTGCATCCGACCCTCTTCCATTTTCGGTCCTGGCGACCGACTGCTGGTCCCTTCTCTGGTGGCCGCTGCCCGAGCTGGCAAGTCCAAGTTCATCATTGGAGACGGTAACAACCTGTACGACTTCACCTACGTCGAGAACGTGGCTCACGCTCACGTCTGCGCTGAGCGAGCTCTGGCTTCTGGAGGAGACGTGTCCACCAAGGCTGCCGGACAGGTGTTCGCCTTCTCCTAA

[0223] Bt_3β-HSD (SEQ NO: 22):

[0224]

[0225] Mt_3β-HSD (SEQ NO: 23):

[0226]

[0227] Vv_3β - HSD (SEQ NO: 24):

[0228]

[0229] The raw materials and reagents used in the module for avoiding pathway competition by mixed bacteria provided by the present invention and its applications can all be purchased from the market.

[0230] The present invention will be further described below in conjunction with examples:

[0231] Example 1: Construction of the 4AD pathway synthesis module and combination of the modules into the target steroid compound

[0232] 1. Obtaining of chassis strains

[0233] Provided by the research group of Yuan Yingjin, the high-yield ergosterol-producing Yarrowia lipolytica chassis strain is numbered SyBE_Yl2060077, and the wild-type Yarrowia lipolytica strain is numbered ATCC201249. The SyBE_Yl2060077 strain is mentioned in the literature "Pregnenolone Overproduction in Yarrowia lipolytica by Integrative Components Pairing of the Cytochrome P450scc System", and the ATCC201249 strain is mentioned in the literature "Multiplex gene editing of the Yarrowia lipolytica genome using the CRISPR-Cas9 system".

[0234] 2. Obtaining of exogenous functional gene elements

[0235] The sources of the genes CYP17A1 (17-alpha-hydroxylase / 17,20-lyase), POR (NADPH-cytochrome P450 reductase), 3β-HSD (3β-hydroxysteroid dehydrogenase), CYB5 (Cytochrome b5), and mCYP11A1 (mature P450scc) involved in the present invention are shown in Table 3.

[0236] Table 3 Sources of the genes involved in the present invention

[0237]

[0238]

[0239] The above four component genes used in the present invention are all obtained by artificial synthesis after codon optimization of Yarrowia lipolytica and appropriate avoidance of common restriction enzyme cutting sites, with 5'-end gcggccgcggtctcca (as shown in SEQ NO: 1) and 3'-taaaggagaccgcggccgc (as shown in SEQ NO: 2) added additionally at both ends of the gene. The route design for the mixed bacteria to synthesize androstenedione is as Figure 1 shown.

[0240] 3. Test method:

[0241] Seed medium: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract powder;

[0242] YPD fermentation medium: 50 g / L glucose, 20 g / L peptone, 10 g / L yeast extract powder.

[0243] Fermentation method: Inoculate the strain cultured on the plate into 5 mL of seed medium, culture at 220 rpm and 30 °C for 24 h, then transfer it to 5 mL of fresh seed medium at a concentration of OD 600 = 0.2, culture at 220 rpm and 30 °C for 16 h, and then transfer it to 50 mL of YPD fermentation medium at a concentration of OD 600 = 0.1, culture at 220 rpm and 28 °C for 192 h, and then end the fermentation.

[0244] Quantification method for pregnenolone (P5) and campesterol: Take 1 mL of the fermentation broth, centrifuge at 12000 g for 2 min to collect the bacterial cells, and wash them twice with water. Add 1 mL of 3 mol / L hydrochloric acid to resuspend the bacterial cells, place them in boiling water at 100 °C for 5 min, centrifuge at 12000 rpm for 1 min to collect the cell precipitate. Wash the cells 3 times with 1 mL of distilled water. Add 420 μL of 2 mol / L potassium hydroxide-methanol solution to the broken cell precipitate, and react in a constant temperature incubator at 37 °C for 2 hours. Take out the saponification reaction centrifuge tube, cool it to room temperature (25 °C ± 5 °C), add an equal volume of n-hexane, vortex for 10 min, centrifuge at 12000 rpm for 1 min, and take the upper n-hexane phase to a new centrifuge tube. Repeat the extraction of the lower layer with n-hexane once, and combine the two n-hexane phases. Concentrate the n-hexane phase with a vacuum centrifugal concentrator (when the sample solvent is n-hexane: 25 °C, 30 min, 7000 rpm). The solid remaining in the tube after concentration is the steroid substance. Add 100 μL of MSTFA and react at 37 °C for 2 hours, add 100 μL of n-hexane, filter, and then detect by gas chromatography-mass spectrometry.

[0245] Quantitative methods for progesterone, 17-hydroxypregnenolone (17OHP5), 17-hydroxyprogesterone (17OHP4), dehydroepiandrosterone, androstenedione, and testosterone: Take 1 mL of the fermentation broth, add glass beads and 700 μL of ethyl acetate, and shake and extract for 10 minutes. Collect the upper organic phase and re-extract the aqueous phase with fresh ethyl acetate once. Combine the organic phases from the two extractions, and concentrate the liquid using a vacuum centrifugal concentrator (when the sample solvent is ethyl acetate: 25 °C, 1200 min, 7000 rpm). The solid remaining in the tube after concentration is the steroid substance. For samples of progesterone (P4), dehydroepiandrosterone (DHEA), androstenedione (4AD), and testosterone (TS), add 100 μL of MSTFA and react at 37 °C for 2 hours. Add 100 μL of n-hexane, filter, and then detect by gas chromatography-mass spectrometry. Samples of 17-hydroxypregnenolone and 17-hydroxyprogesterone are dissolved in 200 μL of absolute ethanol, filtered, and then detected by ultra-high performance liquid chromatography.

[0246] 4. Construction of modular integration plasmids

[0247] For the construction of the upstream module strain; mCYP11A1 is expressed under the TEF1p promoter, and 3β-HSD is expressed under the EXP1p promoter. Both are simultaneously integrated into the pBR322 site. For the construction of the downstream module strain, CYP17A1 and POR are both expressed under the TEF1inp promoter and integrated into the IntD site of the chassis strain genome.

[0248] Construction of Module 1: The left arm of the IntD integration site and the terminator of Saccharomyces cerevisiae GPM1t were spliced together by OE-PCR; the 40-bp terminal sequence of the terminator of Saccharomyces cerevisiae FBA1t, the leucine auxotrophic selection tag Leu2 with LoxP sites at both ends, and the right arm of the IntD integration site were spliced together by OE-PCR to obtain a fragment containing NotI restriction sites at both ends, which were named IntD-L and IntD-R respectively; then, four artificially synthesized CYP17A1 and POR from different sources were respectively ligated with the expression modules TEF1inp-LIP2t-GPDt and GPDt-TEF1inp-OCT1t-FBA1t digested by BsmBI to obtain integration plasmids. The CYP17A1 and POR modules with the same species source were assembled with IntD-L, IntD, and pUC18H digested by HincII through Gibson assembly to obtain integration plasmids, and Module 1 was obtained after digestion with NotI. Construction of Module 2: The left arm of the IntB integration site, the defective uracil tag Ura3, the right arm of the IntB integration site, the promoter TEF1in, and the terminator ACOt were respectively assembled with CYB5 from three sources by Gibson method to obtain integration plasmids, and Module 2 was obtained after digestion with NotI. Construction of Module 3: Porcine-derived mCYP11A1 was respectively integrated into the expression cassette with the TEF1p promoter, and five different sources of 3β-HSD were respectively integrated into the expression cassette with the EXP1p promoter. The mCYP11A1 expression cassette and the five different 3β-HSD expression cassettes were assembled into the pINA1269 integration plasmid digested by SalI and ClaI through Gibson assembly. Finally, the plasmid was linearized after digestion with NotI to obtain Module 3. The integration plasmids of Modules 1-3 constructed above were respectively transformed into Escherichia coli competent DH5α, screened by colony PCR, and the plasmids were extracted for single and double enzyme digestion verification and sequencing verification to ensure that the target fragments were ligated correctly and the base sequences did not mutate.

[0249] Construction of Module 5: The left arm of the IntF integration site, pUC18H digested by HincII, the leucine auxotrophic selection tag Leu2 with LoxP sites at both ends, the right arm of the IntF integration site, and CYP17A1 and POR from Equus caballus (the method is the same as the construction of Module 1) were assembled together by Gibson method to obtain a fragment containing NotI restriction sites at both ends, and Module 5 was obtained after digestion with NotI.

[0250] 5. Experimental Results

[0251] First, Module 1 and Module 2 containing genes from the same species source were integrated into the wild-type Yarrowia lipolytica strain ATCC201249 to obtain strains SyBE_Yl2091006 (containing Mesocricetus auratus genes) and SyBE_Yl2091016 (containing Ovis aries genes) as downstream module strains. Module 3 containing genes from different species sources was respectively integrated into the high-yield campesterol Yarrowia lipolytica chassis strain SyBE_Yl2060077 to obtain strains SyBE_Yl2091025 - SyBE_Yl2091028 and SyBE_Yl2090006 as upstream module strains.

[0252] First, the present invention obtains progesterone through the monoculture of upstream module strains. The upstream module strains are inoculated into 5 mL of seed medium and cultured at 30 °C and 220 rpm for 14 - 16 h. With an initial cell concentration of OD 600 = 0.1, they are respectively inoculated into 50 mL of YPD fermentation medium and cultured at 28 °C and 220 rpm. The cell density (OD 600 ) and progesterone production ([[]] Figure 2 [[]]) during the fermentation process are monitored. The upstream module strains with Vaccinia virus source, type II Homo sapiens source, and Bos taurus source are cultured in YPD fermentation medium containing 50 g / L glucose at 28 °C and 220 rpm for 8 days, and progesterone yields of 9.56 mg / L, 9.12 mg / L, and 5.53 mg / L can be obtained respectively. The 3β-HSD from Vaccinia virus source, type II Homo sapiens source, and Bos taurus source is the preferred source for de novo synthesis of progesterone.

[0253] Next, the present invention obtains the target steroid through the co-fermentation of combined modules. The upstream module strain SyBE_Yl2091025 with Bos taurus source and two downstream module strains SyBE_Yl2091006 and SyBE_Yl2091016 are respectively inoculated into 5 mL of seed medium and cultured at 30 °C and 220 rpm for 14 - 16 h. The strain SyBE_Yl2091025 is respectively mixed with SyBE_Yl2091006 and SyBE_Yl2091016 at a ratio of 10:1 of OD 600 , and with a final OD 600 = 0.1, they are respectively inoculated into 50 mL of YPD fermentation medium and cultured at 28 °C and 220 rpm for 8 days. The cell density (OD 600 ) and steroid production during the fermentation process are monitored.

[0254] ​​In the mixed culture system of SyBE_Yl2091025 - SyBE_Yl2091006, with 17 - hydroxypregnenolone and androstenedione as the main products, 17 - hydroxypregnenolone at 0.74 mg / L, 17 - hydroxyprogesterone at 0.25 mg / L, androstenedione at 0.88 mg / L, and testosterone at 0.32 mg / L were synthesized. In the mixed culture system of SyBE_Yl2091025 - SyBE_Yl2091016, with 17 - hydroxyprogesterone and androstenedione as the main products, 17 - hydroxyprogesterone at 0.91 mg / L, 17 - hydroxypregnenolone at 0.29 mg / L, androstenedione at 1.03 mg / L, and testosterone at 0.34 mg / L were synthesized( Figure 3 ). Thus, the present invention achieved the de novo synthesis of androstenedione and testosterone using a mixed culture system. The Δ4 steroids (P4, 17OHP4, 4AD) synthesized by the co - culture system accounted for 56.5 - 83.1% of the total steroid products, and the intermediate product 17OHP5 accounted for only 12.2% - 37.3% of the total steroids. These results indicate that the co - culture system design successfully alleviated the substrate competition between 3β - HSD and CYP17A1 by forcing the substrate P5 to be preferentially utilized by 3β - HSD, enabling more steroid flux to be used for △ 4- steroid synthesis.

[0255] Example 2: Screening and Verification of Element Combinations of an Efficient CYP17 Catalytic Module

[0256] 1. Obtaining Experimental Materials

[0257] The acquisition of wild - type Yarrowia lipolytica by alcoholysis, the construction of modular integration plasmids (Modules 1 - 3), and the acquisition of exogenous functional gene elements were the same as described in Example 1.

[0258] Construction of Module 4: The left arm of the IntF integration site, pUC18H digested with HincII, the leucine auxotrophic selection tag Leu2 with LoxP sites at both ends, the right arm of the IntD integration site, and the CYP17A1 and POR modules with the same species origin (Ovisaries and Mesocricetus auratus) in Example 1 were spliced together by the Gibson method to obtain a fragment containing NotI restriction sites at both ends, and Module 4 was obtained after digestion with NotI.

[0259] Construction of strains for verifying 17 - hydroxylation conversion experiments. Four modules 1 containing genes from different sources were respectively integrated into ATCC201249 to obtain strains SyBE_Yl2091001 - SyBE_Yl2091004.

[0260] Construction of strains for experimental verification of 17,20-lyase conversion: Three modules II containing genes from different sources were respectively integrated into the above-constructed strains SyBE_Yl2091001 to SyBE_Yl2091004 to obtain strains SyBE_Yl2091005 to SyBE_Yl2091016.

[0261] Obtaining SyBE_Yl2091030: The Leu2 selection marker of SyBE_Yl2091004 was knocked out using the Cre-loxP system to obtain SyBE_Yl2091004 without the Leu2 tag. Module V linearized with NotI and module II containing Equine Ec_CYB5 were integrated into the genome of SyBE_Yl2091004 without the Leu2 tag through yeast transformation to obtain strain SyBE_Yl2091030.

[0262] 2. Experimental methods

[0263] Transformation medium: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract

[0264] Seed medium: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract

[0265] YPD fermentation medium: 50 g / L glucose, 20 g / L peptone, 10 g / L yeast extract

[0266] Steroid substrate stock solution: 1.75 g / L (50% EtOH-Tween80) progesterone, 1.75 g / L (50% EtOH-Tween80) 17-hydroxyprogesterone solution

[0267] 17-Hydroxylation conversion experiment: SyBE_Yl2091001 to SyBE_Yl2091004 were inoculated into 5 mL of seed medium and cultured at 30 °C and 220 rpm for 14 - 16 h. They were respectively inoculated into 5 mL of transformation medium at an initial cell concentration of OD600 = 0.1 and cultured at 28 °C and 220 rpm for 24 h. 150 μL of progesterone substrate stock solution was added and incubation continued for 16 h. 1 mL of the sample was taken and the 17OHP4 content was detected by the method in Example 1.

[0268] 17,20-Lyase conversion experiment: SyBE_Yl2091005 to SyBE_Yl2091016 were inoculated into 5 mL of seed medium and cultured at 30 °C and 220 rpm for 14 - 16 h. At an initial cell concentration of OD 600They were inoculated into 5 mL of transformation medium at 0.1 and cultured at 28 °C and 220 rpm for 24 h. Then 150 μL of 17-hydroxyprogesterone substrate stock solution was added and incubation continued for 120 h. 1 mL of the sample was taken and the androstenedione content was detected according to the method in Example 1.

[0269] Experiment on mixed bacteria for androstenedione synthesis: The upstream module strain SyBE_Yl2091025 and two downstream module strains SyBE_Yl2091016 and SyBE_Yl2091030 were inoculated into 5 mL of seed medium respectively and cultured at 30 °C and 220 rpm for 14 - 16 h. The upstream module strain and the two downstream module strains were inoculated into 50 mL of YPD fermentation medium at a ratio of 10:1 with a final OD 600 ratio and a final OD 600 = 0.1 respectively, and cultured at 28 °C and 220 rpm for 8 days to determine the steroid yield.

[0270] 3. Experimental results

[0271] In the biotransformation experiment, the strain containing CYP17A1 from Ovis aries showed the strongest 17-hydroxylation ability for progesterone.

[0272] In the 17,20-lyase conversion experiment ( Figure 4 right), in the current CYP17A1-CYB5 combination, CYP17A1 and CYB5 from Equus caballus showed general 17,20-lyase ability. Therefore, in the reconstruction of the downstream strain, the Leu2 tag of SyBE_Yl2091004 was removed by the Cre-loxp method, and module two and module five with genes from Equus caballus were introduced to obtain strain SyBE_Yl2091030. As can be seen from Figure 4 the left, Ec_CYP17A1 and Xl_CYP17A1 had weak catalytic activity for 17α-hydroxylation of P4. Ma_CYP17A1 and Oa_CYP17A1 had strong 17α-hydroxylation activity for P4. Among the tested △ 4,5 type CYP17A1, Ma_CYP17A1 had the strongest 17α-hydroxylation activity for P4, but it was only 13.8% of the corresponding activity of the △ 5 type CYP17A1 from sheep.

[0273] From Figure 5It can be seen that in the co-culture fermentation experiment of SyBE_Yl2091025-SyBE_Yl2091030, androstenedione was the main product, with 5.02 mg / L of androstenedione and 1.09 mg / L of testosterone obtained. In the co-culture fermentation experiment of SyBE_Yl2091025-SyBE_Yl2091030, the production of androstenedione increased by 3.9 times compared with the co-culture system before optimization. The above results indicate that by introducing Ec_CYP17A1 from Equus caballus with strong 17,20-lyase ability, Oa_CYP17A1 from sheep with strong 17α-hydroxylation ability, and Ec_CYB5 from horse that can simultaneously promote the 17,20-lyase ability of Ec_CYP17A1 and Oa_CYP17A1, the substrate conversion efficiency of the downstream pathway can be effectively improved, effectively promoting the conversion of steroid intermediates to 4AD.

[0274] Example 3: Adjusting the ratio of co-cultured bacteria to promote the synthesis of 4AD by co-cultured bacteria

[0275] 1. Obtaining experimental materials

[0276] The strains SyBE_Yl2091025-SyBE_Yl2091030 were obtained as described in Example 2.

[0277] 2. Experimental method

[0278] Seed medium: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract powder;

[0279] YPD fermentation medium: 50 g / L glucose, 20 g / L peptone, 10 g / L yeast extract powder.

[0280] Adjusting the ratio of co-cultured bacteria: Inoculate the upstream module strain SyBE_Yl2091025 and the downstream module strain SyBE_Yl2091030 into 5 mL of seed medium respectively, and culture at 30 °C and 220 rpm for 14-16 h. The upstream module strain and the downstream module strain were inoculated into 50 mL of YPD fermentation medium at an inoculation ratio of 1:5, 1:1, 5:1, 10:1, 20:1, 30:1, 40:1, 50:1 respectively, with a final OD 600 = 0.1, and cultured at 28 °C and 220 rpm for 8 days to measure the steroid production.

[0281] 3. Experimental results

[0282] The results showed ( Figure 6) In the range of 1:5 to 30:1, the biosynthesis of P4 is relatively strong, and the 4AD yield increases with the increase of the inoculation ratio. However, when the inoculation ratio is greater than 30:1, since the conversion ability of the downstream module is insufficient to undertake the P4 provided by the upstream module, the 4AD synthesis gradually decreases. Therefore, the present invention believes that 30:1 is the optimal inoculation ratio of the upstream and downstream modules for 4AD synthesis. Under this condition, the 4AD yield reaches 6.92 mg / L.

[0283] Example 4: Adjustment of nitrogen source concentration to promote AD synthesis

[0284] 1. Obtaining of experimental materials

[0285] The strains SyBE_Yl2091025 - SyBE_Yl2091030 were obtained as described in Example 2.

[0286] 2. Experimental method

[0287] Seed medium: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract powder;

[0288] YPD fermentation medium (carbon-nitrogen ratio C / N = 6.5:1): 50 g / L glucose, 20 g / L peptone, 10 g / L yeast extract powder.

[0289] NLM fermentation medium (carbon-nitrogen ratio C / N = 73:1): 50 g / L glucose, 1.7 g / L YNB (without amino acids, ammonium sulfate), 1 g / L ammonium sulfate, 1.7 g / L yeast extract powder

[0290] 1.5-NLM fermentation medium (carbon-nitrogen ratio C / N = 49:1): 50 g / L glucose, 1.7 g / L YNB (without amino acids, ammonium sulfate), 1.5 g / L ammonium sulfate, 2.25 g / L yeast extract powder.

[0291] 2-NLM fermentation medium (carbon-nitrogen ratio C / N = 37:1): 50 g / L glucose, 1.7 g / L YNB (without amino acids, ammonium sulfate), 2 g / L ammonium sulfate, 3 g / L yeast extract powder.

[0292] 3-NLM fermentation medium (carbon-nitrogen ratio C / N = 24:1): 50 g / L glucose, 1.7 g / L YNB (without amino acids, ammonium sulfate), 3 g / L ammonium sulfate, 4.5 g / L yeast extract powder.

[0293] Adjustment of mixed bacteria ratio: The upstream module strain SyBE_Yl2091025 and the downstream module strain SyBE_Yl2091030 were respectively inoculated into 5 mL of seed medium and cultured at 30 °C and 220 rpm for 14 - 16 h. The upstream module strain and the downstream module strain were inoculated at an inoculation ratio of 30:1, with a final OD600 =0.1 was inoculated into 50 mL YPD, NLM, 1.5-NLM, 2-NLM, and 3-NLM fermentation media, respectively, and cultured at 28°C and 220 rpm for 8 days to measure steroid production.

[0294] 3. Experimental results

[0295] The steroid synthesis and bacterial growth patterns under nitrogen-limited conditions (NLM medium, C / N=73:1) are quite different from those under complete medium conditions (YPD medium, C / N=6.5:1). Compared with the "step-by-step modification" 4AD synthesis pattern under complete medium, the steroid products under nitrogen-limited conditions have a brief accumulation of 17OHP4 in the first 24 hours of fermentation, and then almost "one step" from P5 to 4AD is achieved. 4AD synthesis runs through almost the entire fermentation cycle. The present invention also noted that during cell growth, the proportion of downstream bacterial communities increased rapidly in the early stages of fermentation, quickly taking over and transforming the products of upstream bacteria.

[0296] ( Figure 7 )

[0297] In addition, the increase in C / N was accompanied by an increase in 4AD synthesis per strain and a decrease in biomass ( Figure 8 ). When C / N increased from 6.5:1 to 24:1, the 4AD yield per unit cell increased by 28.3%, while the biomass decreased by 52.6%. When the carbon-nitrogen ratio was 24:1, the total 4AD yield per unit cell was only 3.70 mg / L; however, as C / N further increased from 24:1 to 37:1, the 4AD yield per unit cell increased by 1.8 times, while the biomass only decreased by 26.3%. As the C / N ratio further increased, the changes in the 4AD yield per unit cell and the biomass tended to be flat. Under the combined effect of the accumulation of bacterial biomass and the production efficiency per unit cell, the total 4AD yield was the lowest when C / N was 24:1, and the total 4AD yield reached the highest level when C / N was in the range of 37:1 to 49:1, which was 7.71±0.21 mg / L. When C / N was 37:1, the TS synthesis reached a maximum of 1.80 mg / L.

[0298] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Use of a host in increasing the synthesis amount of steroid compounds and / or steroid hormone drugs: The host is the wild-type Yarrowia lipolytica strain ATCC201249; The host includes Module 1; The first module includes: CYP17A1 and POR derived from Ovis aries; Module 1 also includes the IntD integration site and / or the Leu2 tag with LoxP sites at both ends; The nucleotide sequence of the CYP17A1 is as shown in SEQ ID NO:4; The nucleotide sequence of the POR is as shown in SEQ ID NO:8; (I), The inoculation ratio of the host is 1:5 to 60:1; and (II), When the carbon-nitrogen ratio of the culture medium is 6.5:1 to 100:1 and / or the fixed carbon-nitrogen ratio C / N is 24:1 to 73:1, the carbon and nitrogen supply amounts are increased in equal proportion; The steroid compounds and / or steroid hormone drugs are 17OHP5 and / or 17OHP4.

2. The application according to claim 1, characterized in that The inoculation ratio is 1:5 to 50:1; the carbon-nitrogen ratio is 6.5:1 to 73:

1.

3. A method for synthesizing steroid compounds and / or steroid hormone drugs, characterized in that, Take the host, culture it, and collect the culture; The host is the wild-type Yarrowia lipolytica strain ATCC201249; The host includes Module 1; Module 1 includes: CYP17A1 and POR derived from Ovis aries; Module 1 also includes the IntD integration site and / or the Leu2 tag with LoxP sites at both ends; The nucleotide sequence of the CYP17A1 is as shown in SEQ ID NO:4; The nucleotide sequence of the POR is as shown in SEQ ID NO:8; The steroid compounds and / or steroid hormone drugs are 17OHP5 and / or 17OHP4; In the wild-type Yarrowia lipolytica strain ATCC201249, Oa_CYP17A1 and Oa_POR are co-heterologously expressed to construct the recombinant strain SyBE_Y12091004, which synthesizes 17OHP5 using pregnenolone as a substrate and synthesizes 17OHP4 using progesterone as a substrate.

4. The method according to claim 3, wherein It also includes: De novo synthesis of 17-hydroxy pregnenolone using a carbon source, CYP17A1, and POR in a microbial chassis.

Citation Information

Patent Citations

  • Genetically transformed yeasts capable of producing a molecule of interest at a high titre

    US10400261B2