A method for increasing the yield of perylenequinone secondary metabolites produced by Shiraia bambusicola fermentation
Through co-fermentation and culture of fungi and bamboo chlorophyllium, the fermentation conditions are optimized, and the problem of low fermentation yield of bamboo chlorophyllium is solved, and the yield of perylene quinone secondary metabolites has been significantly improved, meeting the needs of the pharmaceutical industry.
Patent Information
- Application Number
- CN202211417883.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2021-03-18
- Publication Date
- 2025-08-05
- Estimated Expiration
- 2041-03-18
AI Technical Summary
In the prior art, the production of perylene quinone secondary metabolites by fermentation of bamboo chlorophyllium is low, which is difficult to meet the needs of the pharmaceutical industry. The chemical synthesis methods are complex and costly, and there is room for improvement in microbial fermentation methods.
Fungus and bamboo chlorophyllium are used to ferment and culture, and solid, semi-solid or deep culture is carried out by adding liquid fermentation mixtures of fungi, pure mycelium, microbial solid culture or sub-subs at different fermentation stages, and the fermentation conditions are optimized to increase the yield of perylene quinone secondary metabolites.
It significantly improved the yield of perylene quinone compounds produced by fermentation of bamboo chlorophenae strains, promoted the growth of biomass and the rapid accumulation of metabolites, and improved the active efficacy of the product.
Smart Images

Figure CN115851864B_ABST
Abstract
Description
[0001] This application is a divisional application with the application date of March 18, 2021, application number "2021102907738", and invention name "A method for increasing the yield of perylenequinone secondary metabolites produced by bamboo yellow fermentation". Technical Field
[0002] The present invention relates to the development and application of fungi and actinomycete resources for promoting the fermentation of bamboo fungi to produce peryquinone pigments, and particularly to a method for increasing the yield of peryquinone secondary metabolites produced by bamboo fungi fermentation, belonging to the field of biotechnology and microbial fermentation technology. Background Art
[0003] Perylenequinone compounds are natural products with polyketide structures produced by fungi. Their unique photosensitivity imparts them with excellent anticancer, antitumor, and antiviral activities, and they have broad application prospects in the pharmaceutical industry. Perylenequinone compounds, represented by the pigments of Hypocrellin A (HA), Hypocrellin B, Hypocrellin C, and Hypocrellin D), have been widely used as photosensitizing probes, pesticide formulations, and food pigments. Currently, perylenequinone compounds are mainly extracted from the stroma of natural bamboo yellow or bamboo red. However, problems such as low stroma yield and limited sources limit the application of perylenequinone compounds in the pharmaceutical industry and the demand for scientific research. The production of perylenequinone compounds through chemical synthesis has disadvantages such as complex pathways, high costs, and numerous side reactions, and cannot meet the needs of industrial pigment production. Microbial fermentation methods have the advantages of mild conditions, no seasonal restrictions, high yield, and easy separation, making them one of the most promising methods for producing perylenequinone compounds. Currently, strains of Shiraia bambusicola are the primary fermentation strain for the production of perylenequinone compounds, particularly perylene pigments. Methods for increasing perylene pigment production in Shiraia bambusicola primarily focus on strain optimization, fermentation conditions, and fermentation control. For example, techniques such as strain mutagenesis, gene editing, the addition of inducing factors, and environmental stimulation such as temperature and light have shown promising results in increasing pigment production.
[0004] Co-cultivation is a microbial culture model that alters the growth and metabolism of one or more strains based on interactions such as competition, symbiosis, collaboration, antagonism, and parasitism among microorganisms. Different strains in a co-fermentation system based on the co-cultivation principle can communicate through direct cell contact or through signaling substances in the fermentation broth, such as through the use of dedicated signals, horizontal gene transfer, competitive competition for resources, collaborative resource provision, or by altering the environment to influence the growth of one another. It has been reported that the addition of the bacterium Pseudomonas fulva can enhance the ability of Shiraia sp. S9 to produce perylenequinone pigments in liquid fermentation.
[0005] Table 1 Existing Technologies for Improving the Fermentation of Shiraia bambusicola to Produce Hypocrellin
[0006]
[0007] References:
[0008] [1]Sun C X, Ma Y J, Wang J W. Improved hypocrellin A production in Shiraia bambusicola by light - dark shift[J]. Journal of Photochemistry and Photobiology B: Biology, 2018, 182: 100 - 107.
[0009] [2]Lei X Y, Zhang M Y, Ma Y J, et al. Transcriptomic responses involved in enhanced production of hypocrellin A by addition of Triton X - 100 in submerged cultures of Shiraia bambusicola[J]. Journal of industrial microbiology & biotechnology, 2017, 44(10): 1415 - 1429.
[0010] [3]Du W, Liang Z Q, Zou X, et al. Effects of microbial elicitor on production of hypocrellin by Shiraia bambusicola[J]. Folia microbiologica, 2013, 58(4): 283 - 289.
[0011] [4]Liu B, Bao J Y, Zhang Z B, et al. Enhanced production of perylenequinones in the endophytic fungus Shiraia sp. Slf14 by calcium / calmodulin signal transduction[J]. Applied microbiology and biotechnology, 2018, 102(1): 153 - 163.
[0012] [5]Ma YJ, Zheng LP, Wang J W. Inducing perylenequinone production from a bambusicolous fungus Shiraia sp.S9 through co-culture with a fruiting body-associated bacterium Pseudomonas fulva SB1[J]. Microbial cell factories, 2019, 18(1):121-134.
[0013] The applicant's previous patent, "CN110172409A," discloses a high-yield strain of the bambusicola strain MH-02, Shiraia bambusicola, isolated from the fruiting bodies of a bambusicola plant in Zhejiang, China. Its classification and designation is Shiraia bambusicola, with a GDMCC deposit number of 60438. The main metabolite of this strain is hypocrellin A. Based on this, the applicant has further optimized the production of hypocrellin A from Shiraia bambusicola to improve fermentation efficiency. Summary of the Invention
[0014] On the basis of the existing technology, in order to improve the fermentation efficiency of the bamboo fern strain, the present invention further optimizes the fermentation culture, and further provides a method for increasing the yield of perylenquinone secondary metabolites produced by bamboo fern fermentation.
[0015] The present invention is achieved through the following technical solutions:
[0016] The present invention uses one or more fungi, such as species of the genera Alternaria, Arthrinium, Epicoccum, Fusarium, Neopestalotiopsis, and Shiraia, to co-ferment with the bamboo fungus. The addition time is the initial stage of bamboo fungus fermentation (the first 1 / 3 of the fermentation cycle), the middle stage (the 1 / 3 to 2 / 3 of the fermentation cycle), and the final stage (the last 1 / 3 of the fermentation cycle). The addition form is a liquid fermentation mixture of the fungus, pure mycelium, a solid microbial culture, or a stroma or fruiting body, as well as a stroma. The co-fermentation method for producing perylenequinone compounds includes three methods: solid-state, semi-solid-state, or submerged culture.
[0017] Specifically, the following technical solutions are adopted:
[0018] A method for increasing the yield of perylenequinone secondary metabolites produced by fermentation of bamboo shoots, characterized in that the method comprises the following steps:
[0019] Co-fermentation culture of bamboo fungus and fungi;
[0020] Optionally,
[0021] Isolation and / or purification of perylenequinone secondary metabolites.
[0022] Furthermore, the bamboo fungus is GDMCC 60438.
[0023] Furthermore, the fungus is isolated from bamboo.
[0024] Furthermore, the fungus is added in the form of a liquid fermentation mixture of the fungus, pure mycelium, microbial solid culture, stroma or fruiting body.
[0025] Furthermore, in the fermentation culture, the fungus is added at the early, middle or late fermentation stage of the bamboo fungus.
[0026] Furthermore, the co-fermentation culture is solid-state, semi-solid-state or submerged culture.
[0027] Furthermore, the fungus is selected from the group consisting of Arthrospora, Epicococcus, Fusarium, Alternaria, Bambusa, and Neodiscoideum.
[0028] Furthermore, the perylenequinone secondary metabolite is hypocrellin A.
[0029] Furthermore, the fungus is isolated from the bamboo nodes of bitter bamboo where the bamboo yellow fungus parasitizes.
[0030] Furthermore, the initial fermentation period is the first 1 / 3 of the fermentation period; the middle fermentation period is 1 / 3-2 / 3 of the fermentation period; and the final fermentation period is the last 1 / 3 of the fermentation period.
[0031] The technical advantages of the present invention mainly include but are not limited to the following aspects:
[0032] Natural bamboo yellow sclerotia grow on bamboo nodes, and the sclerotia has a low water activity. The advantage of the present invention over pure bamboo yellow culture or co-fermentation with bacteria is that it adopts a fungal co-culture method to co-ferment with the bamboo yellow strain, which is closer to the microecological environment where natural bamboo yellow sclerotia grow and develop on bamboo nodes. It can better stimulate the production of new metabolites in the system, coordinate the enzyme system ratio between microorganisms, increase the activity and efficacy of the product, etc. It is conducive to the growth of the bamboo yellow strain biomass and the rapid accumulation of metabolites, greatly improving the yield of the bamboo yellow strain fermentation production of perylenequinone compounds. BRIEF DESCRIPTION OF THE DRAWINGS
[0033] Figure 1: Colony morphology of S. bambusicola (GDMCC 60438) colony (A), Arthrinium sp. AF-5 colony (B), and co-culture of S. bambusicola (GDMCC 60438) and Arthrinium sp. AF-5 on a plate (C).
[0034] Figure 2 : Arthrinium sp.AF-5 seed solution (A-1), S.bambusicola (GDMCC 60438) seed solution (A-2), Arthrinium sp.AF-5 seed solution was inoculated into fermentation medium and fermentation did not produce HA (B-1), Arthrinium sp.AF-5 and S.bambusicola (GDMCC 60438) seed solution were inoculated into fermentation medium and co-cultured to produce HA (B-2).
[0035] Figure 3 Effect of inoculation method on HA production in co-fermentation of Arthrinium sp. AF-5. FFM represents fresh mycelium without culture medium, FS represents fermentation suspension without mycelium, and FP represents exopolysaccharide without mycelium.
[0036] Figure 4 : Effect of the addition time of Arthrinium sp.AF-5 on the HA yield in co-fermentation.
[0037] Figure 5 : Effect of the addition amount of Arthrinium sp.AF-5 on the co-fermentation HA production.
[0038] Figure 6 :The change of HA production in co-fermentation of Arthrinium sp.AF-5 and S.bambusicola (GDMCC 60438) with co-fermentation time. DETAILED DESCRIPTION
[0039] Those skilled in the art can refer to the content of this article and appropriately improve the process parameters. It is particularly important to point out that all similar replacements and modifications are obvious to those skilled in the art and are considered to be included in the present invention. The products and methods of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the products and methods described herein without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention. In order to further understand the present invention, the present invention is described in detail below with reference to the embodiments.
[0040] The experimental design of the present invention and the implementation of the above-mentioned cases are carried out and explained based on achieving the purpose of the present invention. The specific implementation methods and operating conditions are not limited by the present invention. Other experts and scholars in this field may make improvements and optimizations without departing from the spirit and principles of the present invention, and all such improvements and optimizations shall be included in the scope of protection of the present invention.
[0041] Example 1
[0042] The fungus was isolated from bamboo by tissue separation. After obtaining fresh tissue, it was inoculated into medium 1-4 and cultured for 5-7 days. After two subcultures, pure culture strains were obtained. The culture temperature was 22℃-30℃.
[0043] Medium No. 1: Finished resistant potato dextrose agar medium (PDA, potato 300 g / L, glucose 20 g / L, agar 15 g / L, chloramphenicol 0.1 g / L, natural pH).
[0044] Culture medium No. 2: potato glucose water 24 g / L, agar 15 g / L.
[0045] Culture medium No. 3: potato extract 4 g / L, glucose 20 g / L, agar 15 g / L.
[0046] Culture medium No. 4: potato extract 4 g / L, glycerol 10 g / L, beef extract 12 g / L, agar 15 g / L.
[0047] The isolated microorganisms were numbered and their DNA genomes were extracted. The internal transcribed spacer (ITS) region was amplified by PCR using the extracted DNA as a template using primers ITS5 (GGAAGTAAAAGTCGTAACAAGG) and ITS4 TCCTCCGCTTATTGATATGC) and sequenced.
[0048] The isolated microorganism was numbered AF-5 and identified by comparison as a fungus of the genus Arthrinium, named Arthrinium sp. AF-5 (deposited in the patent strain collection of Guangdong Institute of Microbiology GDMCC61084, isolated from a bamboo node of bitter bamboo parasitized by Bambusa serrata). Its ITS sequence is as follows:
[0049] .
[0050] The strain was cultured in liquid for 3-5 days to obtain seed liquid, which was mixed with S.bambusicola (GDMCC No.60438) mycelium in a ratio of 1:1, and inoculated with 5% (V / V) in a medium with 4g potato extract powder, 10g glycerol, 12g beef extract, and natural pH, at 28°C and 150rpm / min for 24h. The co-fermentation liquid was treated and the perylenequinone pigment was extracted to determine the strain that promoted the pigment production. The determination and calculation of biomass, bamboo red fungus A content, yield, etc. were carried out according to the method reported in the literature (Identification of a wild bamboo yellow fungus and optimization of its extraction and fermentation conditions for bamboo red fungus A production [J]. Journal of Edible Fungi, 2020, 27(01):49-62.), and the results are shown in Table 2.
[0051] See attached for the symbiotic results. Figure 1When S. bambusicola (GDMCC 60438) is cultured alone, a bright red pigment is secreted from the center agar block, and concentric yellow-brown circles appear on the reverse side of the plate. When Arthrinium sp. AF-5 is cultured alone, a long, dense ring of hyphae grows in the center of the plate on the front side, while the reverse side is smooth and clean, with no pigment secreted from the center agar block. When the two strains are co-cultured on the same plate, the yellow-brown color of both the front and reverse sides of the plate becomes significantly darker at the junction of the two strains, and the growth area of Arthrinium sp. AF-5 on the plate is larger than that of S. bambusicola (GDMCC 60438). When Arthrinium sp. AF-5 and S. bambusicola (GDMCC 60438) are inoculated separately into seed culture medium, neither produces pigment. Arthrinium sp. AF-5 does not produce pigment in fermentation medium. The two strains were co-fermented in the fermentation medium. Arthrinium sp.AF-5 could significantly promote the production of HA by S.bambusicola (GDMCC 60438). Figure 2 ), benefiting from the interaction mechanism between strains.
[0052] After 60 hours of culture in PDB medium, Arthrinium sp.AF-5 was processed into three addition forms: mycelium, fermentation suspension without mycelium, and exopolysaccharide. These were added to the fermentation broth of S.bambusicola (GDMCC 60438) to observe the pigment metabolism. The addition of fresh mycelium effectively stimulated the production of HA in S.bambusicola (GDMCC 60438). Compared with conventional culture, the HA yield increased from 14.23 mg / g carbon source to 24.77 mg / g carbon source, an increase of about 74.07%. However, the fermentation suspension without mycelium and exopolysaccharide did not show a significant effect ( Figure 3 After 12 hours of fermentation of S.bambusicola (GDMCC 60438), when the addition of Arthrinium sp.AF-5 was 0.06 g FW / mL, the HA production was significantly improved, the pigment content in the mycelium reached 55.43 mg / g, about 3.08 times that of the control group, and the HA yield was 44.74 mg / g carbon source, about 3.8 times that of the control group ( Figure 4 At the 84th hour of fermentation, the biomass of the co-fermentation system reached 8.28 g DW / L, which was 50% higher than that of the control group cultured for the same time. The HA content in the mycelium reached the highest level, which was 80.68 mg / g ( Figure 5 The HA yield was 66.75 mg / g carbon source, which was 5.2 times that of S.bambusicola (GDMCC 60438) cultured alone ( Figure 6 ).
[0053] Example 2
[0054] Strain isolation and identification were performed as described in Example 1. The isolated microorganism was designated AF-4 and identified by comparison as a Fusarium sp. fungus, named Fusarium sp. (deposited in the Guangdong Institute of Microbiology patent strain collection GDMCC61164, isolated from bamboo leaves infested with Fusarium flavescentis). Its ITS sequence is as follows:
[0055] GGGGAAATTCGGACTTCACTCCCACCCCTGTGAACATACCTATTGTTGCCTCGGCGGATCAGCCCGGCCCCGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTTTAGTGTAACTTCTG AGTAAAACAAACAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGC ACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACAGCTTGGTGTTGGGATTCGCGGAGCAATCCGCGGTCCCCAAATCGATTGGCGGTCACGTCGAGCTT CCATAGCGTAGTAATTTACACCTCGTTACTGGTAATCGTCGCGGCCACGCCGTTAAACCCCAACTTCTGAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA
[0056] The isolated strain was cultured in liquid for 3-5 days to obtain a seed solution. Fresh Fusarium AF-4 mycelium was added at 0.08 g FW / mL to a 24-hour fermentation broth of S. bambusicola (GDMCC 60438). After 72 hours of culture using the same conditions as in Example 1, mycelial biomass, pigment content, and yield were measured and calculated. The results are shown in Table 2.
[0057] Example 3
[0058] Strain isolation and identification were performed as described in Example 1. The isolated microorganism was designated AF-7 and identified by comparison as a Fusarium fungus, named Fusarium sp. AF-7 (deposited in the patent strain collection of Guangdong Institute of Microbiology, GDMCC61085, isolated from a bamboo node of bitter bamboo parasitized by Fusarium spp.). Its ITS sequence is as follows:
[0059] CATTTCTCCCCGGTTTGATATGCTTAAGTTCAGCGGGTATTCCTACCTGATCCGAGGTCAACATTCAGAAGTTGGGGTTTAACGGCGTGGCCGCGACGATTACCAGTAACGAGGTGTAAATTACTACGCTATGGAAGCTC GACGTGACCGCCAATCGATTTGGGGACCGCGGATTGCTCCGCGAATCCCAACACCAAGCTTGTGCTTGAGGGTTGAAATGACGCTCGAACAGGCATGCCCGCCAGAATACTGGCGGGCGCAATGTGCGTTCAAAGATTCGA TGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTTGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTTGATTTATTTGTTTGTTTTACTCAGAAGTTACACTAAAAACAGAGTTT AGGGGTCCTCTGGCGGGCCGTCCCGTTTTACCGGGGCCGGGCTGATCCGCCGAGGCAACAATAGGTATGTTCACAGGGGTTTGGGAGTTGTAAACTCGGTAATGATCCCTCCGCTGGTTCACCAACGGAGACCTTGTTAC
[0060] GCTTTTTTAACCTTCCA
[0061] The isolated Fusarium sp. AF-7 strain was cultured in liquid for 3-5 days to obtain a seed broth. Fresh Fusarium sp. AF-7 mycelium was added to a 24-hour fermentation broth of S. bambusicola (GDMCC 60438) at a concentration of 0.08 g FW / mL. After 72 hours of culture using the same conditions as in Example 1, mycelial biomass, pigment content, and yield were measured and calculated. The results are shown in Table 2.
[0062] Example 4
[0063] The strain was isolated and identified as described in Example 1. The isolated microorganism was designated BF-1 and identified as a Fusarium sp. fungus by comparison and named Fusarium sp. BF-1. Its ITS sequence is as follows:
[0064] ATTCGGGATCCTACTGATCCGAGGTCACCACTAAAAAATTGGGGGTTTTATGGCGGGAGGACAGAGCCTGACAAAAGCGAGAAATAAATTACTACGCTCAGAGGACTACCGCCGCTCCGCCACTGTCTTTAAGGAACTGCAGTAC AGCAGATTCCCAACACTAAGCTAGGCTTAAGGGTTGAAATGACGCTCGAACAGGCATGCCCACCAGAATACTGATGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCG CTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTTAACTTATTAAAATAAGACGCTCAGAATATAAAATAAAACAGAGTTTAGTGTACCGCCGGCGGCCCGCGGCTGGAGTTGGCAGTCCGCAACTACAG GGTAGCTGCAGGTGCCTCCAACCGAGCTTACGCCGAGGCATAACTGGGTAGGTTAACAGATGGTATGGGAGTTGTATAACTCTGTAATGATCCCTCCGCTGGTTCACCAACGGAGACCTTGTTACGCTTTTTTCCTTCCAATGT
[0065] The isolated Fusarium sp. BF-1 strain was cultured in liquid for 3-5 days to obtain a seed broth. Fresh Fusarium sp. BF-1 mycelium was added to a 24-hour fermentation broth of S. bambusicola (GDMCC 60438) at a concentration of 0.08 g FW / mL. After 72 hours of culture using the same conditions as in Example 1, mycelial biomass, pigment content, and yield were measured and calculated. The results are shown in Table 2.
[0066] Example 5
[0067] The strain was isolated and identified as described in Example 1. The isolated microorganism was designated BF-3 and identified as Arthrinium sp. BF-3 by comparison. Its ITS sequence is as follows:
[0068] TTTTCCTCTCCCCGGTTTTTGATATGCTTAAGTTCAGCGGGTATTCCTACCTGATCCGAGGTCAACCACTAAAAAATTGGGGGTTTTATGGCGGGAGGACAGAGCCTGACAAAAGCGAGAAATAAATTACTACGCTCAGAGGACTACCGCCGCT CCGCCACTGTCTTTAAGGAACTGCAGTACAGCAGATTCCCAACACTAAGCTAGGCTTAAGGGTTGAAATGACGCTCGAACAGGCATGCCCACCAGAATACTGATGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCA CATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTTAACTTATTAAAATAAGACGCTCAGAATATAAAATAAAACAGAGTTTAGTGTACCGCCGGCGGGCCGCGGCTGGAGTTGGCAGTCC GCAACTACAGGGTAGCTGCAGGTGCCTCCAACCGAGCTTACGCCGAGGCATAACTGGGTAGGTTAACAGATGGTATGGGAGTTGTATAACTCTGTAATGATCCCTCCGCTGGTTCACCAACGGAGACCTTGTTACGATTTTTATACCTTCCAAAA
[0069] The isolated Arthrinium sp. BF-3 strain was cultured in liquid for 3-5 days to obtain a seed broth. Fresh Arthrinium sp. BF-3 mycelium was added to a 24-hour fermentation broth of S. bambusicola (GDMCC 60438). After 72 hours of culture, the mycelial biomass, pigment content, and yield were measured and calculated according to the conditions described in Example 1. The results are shown in Table 2.
[0070] Example 6
[0071] Strain isolation and identification were performed as described in Example 1. The isolated microorganism was designated BF-5 and identified by comparison as a fungus of the genus Alternaria, named Alternaria sp. BF-5 (deposited in the patent strain collection of Guangdong Institute of Microbiology, GDMCC61086, isolated from a bamboo node of bitter bamboo parasitized by F. bambusoides). Its ITS sequence is as follows:
[0072] CTTTCCTCCCCATTTGATATGCTTAAGTTCAGCGGGTATCCCTACCTGATCCGAGGTCAAAAGTTGAAAAAAAAGGCTTAATGGATGCTAGACCTTTGCTGATAGAGAGTGCGACTTGTGCTGCGCTCCGAAACCAGTAGGCCGGCTGC CAATTACTTTAAGGCGAGTCTCCAGCAAAGCTAGAGACAAGACGCCCAACACCAAGCAAAGCTTGAGGGTACAAATGACGCTCGAACAGGCATGCCCTTTGGAATACCAAAGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAAT TCTGCAATTCACACTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTGTAATTATTAATTTGTTACTGACGCTGATTGCAATTACAAAAGGTTTATGTTTGTCCTAGTGGTGGGCGAACC CACCAAGGAAACAAGAAGTACGCAAAAGACAAGGGTGAATAATTCAGCAAGGCTGTAACCCCGAGAGGTTCCAGCCCGCCTTCATATTTGTGTAATGATCCCTCCGCAGGTTCACCTACGGAGACCTTGTTACGCTTTTTTTACTTCCATC
[0073] The isolated strain, Alternaria sp. BF-5, was cultured in liquid for 3-5 days to obtain a seed broth. Fresh mycelia of Alternaria sp. BF-5 were added to a 24-hour fermentation broth of S. bambusicola (GDMCC 60438). After 72 hours of culture, the mycelial biomass, pigment content, and yield were measured and calculated according to the conditions described in Example 1. The results are shown in Table 2.
[0074] Example 7
[0075] The strain was isolated and identified as described in Example 1. The isolated microorganism was designated BF-6 and identified as Arthrinium sp. BF-6 by comparison. The ITS sequence is as follows:
[0076] TTTCCTTCGCGCCTTTGATATGCTTAAGTTCAGCGGGTATTCCTACCTGATCCGAGGTCAACCACTAAAAAATTGGGGGTTTTATGGCGGGAGGACAGAGCCTGACAAAAGCGAGAAATAAATTACTACGCTCAGAGGACTACCGCCGCTCC GCCACTGTCTTTAAGGAACTGCAGTACAGCAGATTCCCAACACTAAGCTAGGCTTAAGGGTTGAAATGACGCTCGAACAGGCATGCCCACCAGAATACTGATGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCA CATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTTAACTTATTAAAATAAGACGCTCAGAATATAAAATAAAACAGAGTTTAGTGTACCGCCGGCGGGCCGCGGCTGGAGTTGGCAGTC CGCAACTACAGGGTAGCTGCAGGTGCCTCCAACCGAGCTTACGCCGAGGCATAACTGGGTAGGTTAACAGATGGTATGGGAGTTGTATAACTCTGTAATGATCCCTCCGCTGGTTCACCAACGGAGACCTTGTTACGCTTTTTTACTTCCAAA
[0077] The isolated Arthrinium sp. BF-6 strain was cultured in liquid for 3-5 days to obtain a seed broth. Fresh Arthrinium sp. BF-6 mycelium was added at 0.08 g FW / mL to a 24-hour fermentation broth of S. bambusicola (GDMCC 60438). After 72 hours of culture, the mycelial biomass, pigment content, and yield were measured and calculated according to the conditions described in Example 1. The results are shown in Table 2.
[0078] Example 8
[0079] The strain was isolated and identified as described in Example 1. The isolated microorganism was designated BF-7 and identified as Shiraia sp. BF-7 by comparison. The ITS sequence is as follows:
[0080] TCGGGATCCTACTGATCCGAGGTCAAACGTGGTAAAAAGCTTATCTGGACGCCAGTATTCCGGCTTGGACTCGCAAATTGTGCTGCGCTCCAAGGCCAAAATGCCGGCTGCCAATATCTTTAAGGCG AGTCCAGTCGCAGTAGGATAGGACAAACACCCAACACCAAGCAGAGCTTGAGGGTACAAATGACGCTCGAACAGGCATGCCCCATGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATT CACTGAATTCTGCAATTCACACTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTGTAAATATTTTTTTTTTCAGACGCTGATTGCAATTACAATG AGTTTAAGAGATCCTATCGACTGGAAACCCAGCCGAGGAAACATGTAGTACGCAAAAAACATGGGTGCAGACGGGGGCTATATTGCTATAACCCCGTACTACTAGGTAATGTCGTCCGCAGTCGCACG
[0081] The isolated Shiraia sp. BF-7 strain was cultured in liquid for 3-5 days to obtain a seed broth. Fresh Shiraia sp. BF-7 mycelium was added to a 24-hour fermentation broth of S. bambusicola (GDMCC 60438) at 0.08 g FW / mL. After 72 hours of culture using the same conditions as in Example 1, mycelial biomass, pigment content, and yield were measured and calculated. The results are shown in Table 2.
[0082] Example 9
[0083] Strain isolation and identification were performed as described in Example 1. The isolated microorganism was designated BF-8 and identified by comparison as a fungus of the genus Neopestalotiopsis, named Neopestalotiopsis sp. BF-8 (deposited in the patent strain collection of Guangdong Institute of Microbiology, GDMCC61087, isolated from a bamboo node of bitter bamboo parasitized by Pseudomonas aeruginosa). Its ITS sequence is as follows:
[0084] TCTTGATTGGGACGCGGAGGGATCATTATAGAGTTTTCTAAACTCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTT TATGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGA ACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTTTTATTAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTA TCCTCTGAGCGTAGTAATTTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAACCCCCAATTTTTTGTGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA
[0085] Neopestalotiopsis sp. BF-8 was isolated and cultured in liquid for 3-5 days to obtain a seed broth. Fresh Neopestalotiopsis sp. BF-8 mycelium was added to a 24-hour fermentation broth of S. bambusicola (GDMCC 60438). After 72 hours of culture, the mycelial biomass, pigment content, and yield were measured and calculated according to the conditions described in Example 1. The results are shown in Table 2.
[0086] Example 10
[0087] The strain was isolated and identified as described in Example 1. The isolated microorganism was designated BF-9 and identified as Shiraia sp. BF-9 by comparison. The ITS sequence is as follows:
[0088] CCGGCATCTACTGATCCGAGGTCAAACGTGGTAAAAAGCTTATCTGGACGCCAGTATTCCGGCTTGGACTCGCAAATTGTGCTGCGCTCCAAGGCCAAAATGCCGGCTGCCAATATCTTTAAGGCGA GTCCAGTCGCAGAGGATAGGACAAACACCCAACACCAAGCAGAGCTTGAGGGTACAAATGACGCTCGAACAGGCATGCCCCATGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCA CTGAATTCTGCAATTCACACTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTGTAAATATTTTTTTTTTCAGACGCTGATTGCAATTACAATGAGTTTAAGAGATCCTATCGACTGGAAACCCAGCCGAGGAAACATGTAGTACGCAAAAAACATGGGTGCAGACGGGGGCTATATTGCTATAACCCCGTACTACTAGGTAATGTCCTCCGCAGTCACTACAG
[0089] The isolated Shiraia sp. BF-9 strain was cultured in liquid for 3-5 days to obtain a seed broth. Fresh Shiraia sp. BF-9 mycelium was added to a 24-hour fermentation broth of S. bambusicola (GDMCC 60438) at a concentration of 0.08 g FW / mL. After 72 hours of culture using the same conditions as in Example 1, mycelial biomass, pigment content, and yield were measured and calculated. The results are shown in Table 2.
[0090] The present invention also uses the bacterium Pseudomonas fulva to co-culture with bamboo fungus, and finds that it has no obvious effect on the pigment content and yield, indicating that the growth metabolism, signal transduction and communication mechanisms caused by the same substance among different bamboo fungi are different.
[0091] Table 2 shows the results of co-fermentation of HA by the microorganisms in Examples 1-10 and S. bambusicola (GDMCC 60438).
[0092] Table 2
[0093]
[0094]
[0095] The above description is merely a preferred embodiment of the present invention and does not constitute any form of limitation to the present invention. Although the present invention has been disclosed as a preferred embodiment as above, it is not intended to limit the present invention. Any technician familiar with this profession will, without departing from the scope of the technical solution of the present invention, of course make some changes or modifications using the disclosed technical content to become equivalent embodiments of equivalent changes. However, any simple modifications, equivalent changes and modifications made to the above embodiments based on the technical essence of the present invention without departing from the content of the technical solution of the present invention are within the scope of the technical solution of the present invention.
Claims
1. A method for increasing the yield of perylenequinone secondary metabolites produced by fermentation of bamboo shoots, characterized in that: The method comprises the following steps: Co-fermentation of Bambusa spp. and fungi, followed by isolation and / or purification of perylenequinone secondary metabolites; The perylenequinone secondary metabolite is hypocrellin A; The bamboo fungus is GDMCC 60438, and the fungus is Fusarium sp. AF-7, with the accession number being GDMCC61085.
2. The method according to claim 1, characterized in that The fungus is added in the form of a liquid fermentation mixture, pure mycelium, solid culture, fruiting body or fruiting body of the fungus.
3. The method according to claim 1, characterized in that In the co-fermentation culture, the fungus is added at the early, middle or late fermentation stage of the bamboo fungus.
4. The method according to claim 3, characterized in that The initial fermentation stage is the first 1 / 3 of the fermentation cycle; the middle fermentation stage is the 1 / 3-2 / 3 of the fermentation cycle; and the final fermentation stage is the last 1 / 3 of the fermentation cycle.
Citation Information
Patent Citations
Accompanying bacterium for increasing fermentation yield of hypocrellin and application thereof
CN107099489A
Shiraia bambusicola with high yield of Hypocrellin A and application of Shiraia bambusicola
CN110172409A